Total submissions: 1
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Department of Pathology and Laboratory Medicine, |
RCV001355601 | SCV001550531 | likely pathogenic | Dystonia 16 | no assertion criteria provided | clinical testing | This variant was not identified in the literature, nor was it identified in the ClinVar, dbSNP, or LOVD databases. A different insertion at the same location (c.610-1T>TTAAAGAAATGTGGTTCTCTGGAGAAATATTA) is reported in LOVD by the VKGL data sharing initiative Nederland as benign and not affecting protein function.  Allele frequency in the general population is extremely low (0.07%, ExAC) with recommended threshold of 1.0% in the general population. This is an acceptor site variant in a gene where loss of function is a known mechanism of disease. In addition, 2 of 4 in silico or computational prediction software programs (SpliceSiteFinder, MaxEntScan, NNSPLICE, GeneSplicer) predict a greater than 10% difference in splicing. In summary, based on the above information the clinical significance of this variant cannot be determined with certainty at this time although we would lean towards a more pathogenic role for this variant. This variant is classified as likely pathogenic.Pathogenic variants in PRKRA cause dystonia with mild parkinsonism, characterized by dystonia with prominent oromandibular involvement, dysphagia, and retrocollis. Parkinsonian features are mild (or even absent) and do not respond to levodopa therapy (GeneReviews, Klein_2017_NCBI ID:NBK1155). Onset usually occurs between 7 and 18 years; the condition is progressive (MIM: 612067). Dystonia associated with PRKRA is inherited in an autosomal recessive fashion. |