Total submissions: 3
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Labcorp Genetics |
RCV001852688 | SCV002195469 | uncertain significance | not provided | 2023-04-24 | criteria provided, single submitter | clinical testing | This variant, c.140_163del, results in the deletion of 8 amino acid(s) of the AIP protein (p.Gly47_Arg54del), but otherwise preserves the integrity of the reading frame. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. ClinVar contains an entry for this variant (Variation ID: 41163). This variant has been observed in individual(s) with acromegaly (PMID: 22720333). This variant is present in population databases (rs267606537, gnomAD 0.0009%). |
Ambry Genetics | RCV004619191 | SCV005117513 | uncertain significance | Hereditary cancer-predisposing syndrome | 2024-06-20 | criteria provided, single submitter | clinical testing | The c.140_163del24 variant (also known as p.G47_R54del) is located in coding exon 2 of the AIP gene. This variant results from an in-frame GCACCGTGCTGGACGACAGCCGGG deletion at nucleotide positions 140 to 163. This results in the in-frame deletion of eight amino acids (GTVLDDSR) at codons 47 to 54. This variant has been reported in several patients with pituitary adenomas (Daly AF et al. J Clin Endocrinol Metab, 2007 May;92:1891-6; Joshi K et al. Horm Res Paediatr, 2018 Jun;90:196-202) including one individual whose tumor demonstrated a deletion on chromosome 11 and, therefore, loss of wild type AIP (Gummadavelli A et al. J Clin Neurosci, 2020 Aug;78:420-422). This amino acid region is generally well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the available evidence, the clinical significance of this variant remains unclear. |
Gene |
RCV000034062 | SCV000057992 | not provided | Somatotroph adenoma | no assertion provided | literature only |