ClinVar Miner

Submissions for variant NM_004333.6(BRAF):c.1388_1408dup (p.Ile463_Gly469dup) (rs1562956929)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital RCV000736073 SCV000864294 likely pathogenic Rasopathy 2017-11-03 criteria provided, single submitter clinical testing PM1, PM2 and PM4; This in-frame duplication of coding sequence in the BRAF gene at nucleotide position 1388 (NM_004333.4:c. 1388_1408dupTTGGATCTGGATCATTTGGAA) leads to a duplication of amino acid residues between position 463 and 469 [p.(Ile463_Gly469dup)][NC_000007.13:g.140481400_140481420dupTTCCAAATGATCCAGATCCAA]. This duplication is located within the protein kinase domain of BRAF, a domain that lacks benign alteration and in which other alterations known to be associated with Noonan syndrome related disorders are clustered (ACMG: PM1; PubMed:16439621). Furthermore, the duplication results in a protein length change within a non-repetitive region (ACMG: PM4). While this variant has not been observed in healthy individuals (gnomAD), it has also not previously been reported in an affected individual (Clinvar) (ACMG: PM2). To our knowledge, in-frame BRAF duplications or insertions have also not previously been reported in association Noonan related syndromes. However, this specific location within the protein appears to be critical for biological function as a missense alteration (p.Gly469Glu) that overlaps with this patient's variant is reported to be one of the most common BRAF alterations found in Cardiofaciocutaneous (CFC) Syndrome (OMIM: 115150)(PMID: 25180280) and an in-frame deletion in the adjacent residue (p.Thr470del) has been observed in an individual with CFC syndrome (PMID: 21204800). No evidence was found to support any of the ACMG criteria for benign classification; therefore, this alteration meets ACMG guidelines for classification as a likely pathogenic variant.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.