ClinVar Miner

Submissions for variant NM_004387.4(NKX2-5):c.167_186dup (p.Ala63fs)

dbSNP: rs2113906336
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 3
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Invitae RCV001967917 SCV002219734 pathogenic Atrial septal defect 7 2021-09-04 criteria provided, single submitter clinical testing For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the NKX2-5 protein in which other variant(s) (p.Ala262Argfs*32) have been determined to be pathogenic (PMID: 22920929; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. This variant has not been reported in the literature in individuals affected with NKX2-5-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Ala63Thrfs*120) in the NKX2-5 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 262 amino acid(s) of the NKX2-5 protein.
Ambry Genetics RCV002397979 SCV002704426 likely pathogenic Cardiovascular phenotype 2021-01-05 criteria provided, single submitter clinical testing The c.167_186dup20 variant, located in coding exon 1 of the NKX2-5 gene, results from a duplication of ACGCTGGGCCCGAGGCGGCT at nucleotide position 167, causing a translational frameshift with a predicted alternate stop codon (p.A63Tfs*120). This alteration occurs at the 3' terminus of the NKX2-5 gene and is not expected to trigger nonsense-mediated mRNA decay. However, this variant impacts the last 75%/262AA of the protein and premature stop codons are typically deleterious in nature. This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). Based on the majority of available evidence to date, this variant is likely to be pathogenic.
Revvity Omics, Revvity RCV003134277 SCV003815087 likely pathogenic not provided 2021-11-30 criteria provided, single submitter clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.