ClinVar Miner

Submissions for variant NM_004415.4(DSP):c.8493_8516del (p.2827_2830SGSR[3]) (rs1554109280)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Integrated Genetics/Laboratory Corporation of America RCV000589309 SCV000698453 uncertain significance not provided 2017-05-17 criteria provided, single submitter clinical testing Variant summary: The c.8493_8516delGGGATCTCGCTCCGGATCTCGCTC (p.Gly2832_Ser2839del) in DSP gene leads to an in-frame deletion of 8 amino acids from the repeat region that is located outside of any known functional domain. The variant is absent from the control population dataset of ExAC but was identified once in the gnomAD dataset (0.000004; 1/243970). The variant of interest has not, to our knowledge, been reported in affected individuals via publications or cited by a reputable database/clinical laboratory. Shorter in-frame deletions within this repeated region have been reported in at least two DCM patients as well is in ostensibly healthy individuals from published reports and ExAC/gnomAD datasets, although the clinical significance of these variants in pathogenesis of the DCM/ARVD remains uncertained. Taking together, the variant was classified as VUS until more information becomes available.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.