ClinVar Miner

Submissions for variant NM_005359.5(SMAD4):c.1343_1367delAGCAGCAGGCGGCTACTGCACAAGC (p.Gln448Leufs) (rs1568211187)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Invitae RCV000694006 SCV000822431 pathogenic Juvenile polyposis syndrome 2018-09-02 criteria provided, single submitter clinical testing This sequence change results in a premature translational stop signal in the SMAD4 gene (p.Gln448Leufs*20). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 105 amino acids of the SMAD4 protein. This variant is not present in population databases (ExAC no frequency). This variant has been reported in individuals affected with juvenile polyposis syndrome (PMID: 23399955). This variant is expected to delete a portion of the C-terminal region of the SMAD4 protein containing the MH2 domain (residues Trp323-Asp552) (PMID: 22243968). Although experimental studies have not been performed for this particular variant, deletion of the MH2 domain likely impairs complex formation of the SMAD4 protein for proper TGFβ signaling (PMID: 9389648, 12821112, 19135894). Downstream truncating variants affecting this domain have been observed in individuals affected with juvenile polyposis (PMID: 15031030). This suggests that deletion of this region of the SMAD4 protein is causative of disease. For these reasons, this variant has been classified as Pathogenic.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.