ClinVar Miner

Submissions for variant NM_005359.5(SMAD4):c.669_691delTCAGCCTGCCAGTATACTGGGGG (p.Ser223Argfs) (rs1064793271)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
GeneDx RCV000481001 SCV000565582 pathogenic not provided 2014-12-19 criteria provided, single submitter clinical testing This deletion of 23 nucleotides in SMAD4 is denoted c.669_691del23 at the cDNA level and p.Ser223ArgfsX4 (S223RfsX4) at the protein level. The normal sequence, with the bases that are deleted in braces, is TAGG[23]GCAG. The deletion causes a frameshift, which changes a Serine to an Arginine at codon 223, and creates a premature stop codon at position 4 of the new reading frame. Although this variant has not, to our knowledge, been reported in the literature, it is predicted to cause loss of normal protein function through either protein truncation or nonsense-mediated mRNA decay. we consider this variant to be pathogenic.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.