ClinVar Miner

Submissions for variant NM_005591.4(MRE11):c.1960_1979dup (p.Lys661fs)

gnomAD frequency: 0.00007  dbSNP: rs587781442
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 5
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Ambry Genetics RCV000129354 SCV000184118 likely pathogenic Hereditary cancer-predisposing syndrome 2023-01-04 criteria provided, single submitter clinical testing The c.1960_1979dup20 variant, located in coding exon 17 of the MRE11A gene, results from a duplication of GACATTTTTCCTACCACTTC at nucleotide position 1960, causing a translational frameshift with a predicted alternate stop codon (p.K661Tfs*45). This alteration is expected to result in loss of function by premature protein truncation. Based on the majority of available evidence to date, this variant is likely to be pathogenic.
Labcorp Genetics (formerly Invitae), Labcorp RCV001034650 SCV000764127 uncertain significance Ataxia-telangiectasia-like disorder 2022-08-19 criteria provided, single submitter clinical testing This sequence change creates a premature translational stop signal (p.Lys661Thrfs*45) in the MRE11 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 48 amino acid(s) of the MRE11 protein. This variant is present in population databases (rs587781442, gnomAD 0.02%). This premature translational stop signal has been observed in individual(s) with ataxia-telangiectasia-like disorder (PMID: 33426167). This variant is also known as c.1876_1895dup; p.Lys633fs. ClinVar contains an entry for this variant (Variation ID: 141025). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
Mendelics RCV000642448 SCV001138406 pathogenic Ataxia-telangiectasia-like disorder 1 2019-05-28 criteria provided, single submitter clinical testing
GeneDx RCV001795249 SCV002032663 uncertain significance not provided 2021-06-09 criteria provided, single submitter clinical testing Frameshift variant predicted to result in protein truncation as the last 55 amino acids are replaced with 44 different amino acids, although loss-of-function variants have not been reported downstream of this position in the protein; Observed in a patient in the published literature, but no additional information was provided (LaDuca et al., 2017); This variant is associated with the following publications: (PMID: 27535533, 28152038)
Baylor Genetics RCV000642448 SCV004193791 likely pathogenic Ataxia-telangiectasia-like disorder 1 2024-03-27 criteria provided, single submitter clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.