Total submissions: 1
Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
---|---|---|---|---|---|---|---|---|
Ambry Genetics | RCV001021295 | SCV001182894 | uncertain significance | Hereditary cancer-predisposing syndrome | 2019-12-04 | criteria provided, single submitter | clinical testing | The c.3854_3880del27 variant (also known as p.Q1285_Q1293del) is located in coding exon 31 of the POLE gene. This variant results from an in-frame deletion of 27 nucleotides (AGCGCCTCGCCCGCAGGAAGAGGCAGC) at nucleotide positions 3854 to 3880. This results in the in-frame deletion of 9 residues from codon 1285 to 1293. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. |