ClinVar Miner

Submissions for variant NM_006231.4(POLE):c.3854_3880del (p.Gln1285_Gln1293del)

dbSNP: rs1593750014
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Ambry Genetics RCV001021295 SCV001182894 uncertain significance Hereditary cancer-predisposing syndrome 2019-12-04 criteria provided, single submitter clinical testing The c.3854_3880del27 variant (also known as p.Q1285_Q1293del) is located in coding exon 31 of the POLE gene. This variant results from an in-frame deletion of 27 nucleotides (AGCGCCTCGCCCGCAGGAAGAGGCAGC) at nucleotide positions 3854 to 3880. This results in the in-frame deletion of 9 residues from codon 1285 to 1293. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.