ClinVar Miner

Submissions for variant NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[3] (p.434APAYTPSP[3])

dbSNP: rs397517209
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 3
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Labcorp Genetics (formerly Invitae), Labcorp RCV000639865 SCV000761448 uncertain significance Myofibrillar myopathy 4 2023-12-28 criteria provided, single submitter clinical testing The LDB3 gene has multiple clinically relevant transcripts. This variant occurs in alternate transcript NM_007078.3, and corresponds to NM_001080116.1:c.*17041_*17064dup in the primary transcript. This variant, c.1320_1343dup, results in the insertion of 8 amino acid(s) of the LDB3 protein (p.Ala442_Pro449dup), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has been observed in individual(s) with dilated cardiomyopathy (PMID: 27532257). ClinVar contains an entry for this variant (Variation ID: 45515). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
GeneDx RCV001555572 SCV001777014 likely benign not provided 2021-01-22 criteria provided, single submitter clinical testing Has not been previously published as pathogenic or benign to our knowledge; Identified independently and in conjunction with additional variants in individuals referred for cardiac genetic testing at GeneDx; segregation data is limited or absent at this time; In-frame duplication of 8 amino acids
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine RCV000038723 SCV000062401 uncertain significance not specified 2008-09-09 no assertion criteria provided clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.