ClinVar Miner

Submissions for variant NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[1] (p.434_441APAYTPSP[1]) (rs397517209)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 4
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine RCV000038722 SCV000062400 uncertain significance not specified 2012-04-11 criteria provided, single submitter clinical testing The 1320_1343del variant (LDB3) has not been reported in the literature nor prev iously identified by our laboratory. However, one individual with DCM was found to have a duplication of the same region. This variant causes an in-frame dele tion of 8 amino acids and is within a region of repeating sequence within the LD B3 gene. This may make this region prone to deletions and duplication, but it r emains unclear whether an increased or decreased number of repeats impacts the p rotein. In summary, additional information is needed to fully assess the clinic al significance of the 1320_1343del variant.
Invitae RCV000474477 SCV000545676 uncertain significance Myofibrillar myopathy, ZASP-related 2018-10-12 criteria provided, single submitter clinical testing This sequence change deletes 24 nucleotides from exon 9 of the LDB3 mRNA (c.1320_1343del). This leads to the deletion of 8 amino acid residues in the LDB3 protein (p.Ala442_Pro449del) but otherwise preserves the integrity of the reading frame. The LDB3 gene has multiple clinically relevant transcripts. The p.Ala442_Pro449del variant occurs in alternate transcript NM_007078.2 which corresponds to position c.*17041_*17064del in NM_001080116.1, the primary transcript listed in the Methods. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has been reported in an individual affected with dilated cardiomyopathy (PMID: 24503780). Clinvar contains an entry for this variant (Variation ID: 45514) Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
GeneDx RCV000038722 SCV000569076 likely benign not specified 2017-06-26 criteria provided, single submitter clinical testing This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease.
Stanford Center for Inherited Cardiovascular Disease,Stanford University RCV000786342 SCV000925120 uncertain significance not provided 2016-06-06 no assertion criteria provided provider interpretation c.1320_1343del (p.Ala442_Pro449del) in LDB3 Given the lack of case data and location of the in-frame deletion in a region of repetitive sequence within the gene, we consider this variant to be of uncertain significance and we do not feel it is suitable for assessing risk in healthy relatives ("predictive genetic testing"). The variant has been seen in at least 1 unrelated case of DCM (not including this patient's family). We have seen the variant in a patient with DCM and a very likely pathogenic LMNA variant. Testing was done by Invitae. Pugh et al., 2014 reported the variant in an individual with DCM. The Invitae report notes, "This sequence change deletes 24 nucleotides from exon 9 of the LDB3 mRNA (c.1320_1343del). This leads to the deletion of 8 amino acid residue(s) in the LDB3 protein (p.Ala442_Pro449del) but otherwise preserves the integrity of the reading frame...The functional effect of in-frame deletions in LDB3 is unknown." This variant is absent from ExAC, the Exome Aggregation Consortium dataset (http://exac.broadinstitute.org/), which currently includes variant calls on ~64,000 individuals of European, African, Latino and Asian descent (as of 6/6/2016). The mean coverage at that site in ExAC is 16x to ~20x.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.