ClinVar Miner

Submissions for variant NM_007078.3(LDB3):c.1296_1319CCCTGCCCCTGCCTACACCCCCTC[3] (p.434_441APAYTPSP[3]) (rs397517209)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Invitae RCV000639865 SCV000761448 uncertain significance Myofibrillar myopathy, ZASP-related 2018-03-21 criteria provided, single submitter clinical testing This sequence change in exon 10 of the LDB3 mRNA (NM_007078.2:c.1320_1343dup) results in the duplication of 8 amino acids of the LDB3 protein (p.Ala442_Pro449dup). The LDB3 gene has multiple clinically relevant isoforms. The p.Ala442_Pro449dup variant occurs in alternate transcript NM_007078.2, which corresponds to position c.*17041_*17064dup in NM_001080116.1, the primary transcript listed in the Methods. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has been reported in an individual affected with dilated cardiomyopathy (PMID: 27532257). ClinVar contains an entry for this variant (Variation ID: 45515). Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the duplicated amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
Laboratory for Molecular Medicine, Partners HealthCare Personalized Medicine RCV000038723 SCV000062401 uncertain significance not specified 2008-09-09 no assertion criteria provided clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.