Total submissions: 2
| Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
|---|---|---|---|---|---|---|---|---|
| Ambry Genetics | RCV000214865 | SCV000277331 | uncertain significance | Hereditary cancer-predisposing syndrome | 2015-07-20 | criteria provided, single submitter | clinical testing | The c.3139_3180del42 variant (also known as 3258del42 or p.V1047_E1060del) located in coding exon 9 of the BRCA1 gene. This variant results from an in-frame GTAGGTTCCAGTACTAATGAAGTGGGCTCCAGTATTAATGAA deletion between nucleotide positions 3139 and 3180. This results in the deletion of 14 amino acids between codons 1047 and 1060. This variant was not reported in population based cohorts in the following databases: Database of Single Nucleotide Polymorphisms (dbSNP), NHLBI Exome Sequencing Project (ESP), and 1000 Genomes Project. In the ESP, this variant was not observed in 6502 samples (13004 alleles) with coverage at this position. To date, this alteration has been detected with an allele frequency of approximately 0.001% (greater than 150000 alleles tested) in our clinical cohort. Since supporting evidence is limited at this time, the clinical significance of c.3139_3180del42 remains unclear. |
| Invitae | RCV000802159 | SCV000941977 | uncertain significance | Hereditary breast ovarian cancer syndrome | 2021-01-21 | criteria provided, single submitter | clinical testing | In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acids is currently unknown. This variant has not been reported in the literature in individuals with BRCA1-related disease. ClinVar contains an entry for this variant (Variation ID: 233035). This variant is not present in population databases (ExAC no frequency). This variant, c.3139_3180del, results in the deletion of 14 amino acids of the BRCA1 protein (p.Val1047_Glu1060del), but otherwise preserves the integrity of the reading frame. |