ClinVar Miner

Submissions for variant NM_007294.4(BRCA1):c.3705_3747dup (p.Glu1250delinsGlnTyrThrPheSerValTyrTer) (rs797044631)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 6
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) RCV000173828 SCV000783584 pathogenic Breast-ovarian cancer, familial 1 2017-12-15 reviewed by expert panel curation Variant allele predicted to encode a truncated non-functional protein.
Quest Diagnostics Nichols Institute San Juan Capistrano RCV000508610 SCV000605848 pathogenic not provided 2016-07-18 criteria provided, single submitter clinical testing
Ambry Genetics RCV000509890 SCV000607996 pathogenic Hereditary cancer-predisposing syndrome 2020-05-04 criteria provided, single submitter clinical testing The c.3705_3747dup43 pathogenic mutation, located in coding exon 9 of the BRCA1 gene, results from a duplication of CAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACC at nucleotide position 3705, causing a translational frameshift with a predicted alternate stop codon (p.E1250Qfs*8). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.
Women's Health and Genetics/Laboratory Corporation of America, LabCorp RCV000589793 SCV000699060 likely pathogenic Hereditary breast and ovarian cancer syndrome 2016-01-04 criteria provided, single submitter clinical testing Variant summary: This c.3705_3747dup43 variant causes a frameshift, which alters the proteins amino acid sequence beginning at position 1250 and leads to a premature termination codon 8 amino acids downstream. It is predicted to cause a truncated or absent BRCA1 protein. Heterozygous loss-of-function due to mutations in this gene is an established disease mechanism in HBOC. Truncations downstream of this position have been classified as pathogenic by our laboratory (e.g. p.Glu1257fs). This variant was not found in approximately 121390 chromosomes from broad and large populations from ExAC. To our knowledge, this variant has not been reported in affected individuals via publications and/or reputable databases/clinical laboratories. Taken together, this variant has currently been classified as Likely Pathogenic.
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics RCV000508610 SCV000859225 pathogenic not provided 2018-01-25 criteria provided, single submitter clinical testing
Invitae RCV000589793 SCV000946660 pathogenic Hereditary breast and ovarian cancer syndrome 2019-04-10 criteria provided, single submitter clinical testing This sequence change creates a premature translational stop signal (p.Glu1250Glnfs*8) in the BRCA1 gene. It is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with BRCA1-related disease. ClinVar contains an entry for this variant (Variation ID: 440468). Loss-of-function variants in BRCA1 are known to be pathogenic (PMID: 20104584). For these reasons, this variant has been classified as Pathogenic.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.