ClinVar Miner

Submissions for variant NM_019066.5(MAGEL2):c.1344ACCCGTGATCCGCCAGGCCCC[1] (p.442PVIRQAP[2])

dbSNP: rs794726941
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 4
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics RCV000513935 SCV000609517 uncertain significance not provided 2017-03-07 criteria provided, single submitter clinical testing
Eurofins Ntd Llc (ga) RCV000513935 SCV000705788 uncertain significance not provided 2017-01-18 criteria provided, single submitter clinical testing
Invitae RCV000513935 SCV001033882 benign not provided 2024-01-23 criteria provided, single submitter clinical testing
GeneDx RCV000513935 SCV001766240 likely benign not provided 2018-10-05 criteria provided, single submitter clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.