ClinVar Miner

Submissions for variant NM_019066.5(MAGEL2):c.479CCCATCCTCCTCCTCCGGGGACCCCGATGG[1] (p.160AHPPPPGTPM[1])

dbSNP: rs751352401
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 4
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Eurofins Ntd Llc (ga) RCV000173482 SCV000224600 uncertain significance not provided 2015-01-29 criteria provided, single submitter clinical testing
Invitae RCV000173482 SCV003247128 benign not provided 2023-12-27 criteria provided, single submitter clinical testing
Breakthrough Genomics, Breakthrough Genomics RCV000173482 SCV005193644 uncertain significance not provided criteria provided, single submitter not provided
GenomeConnect - Brain Gene Registry RCV003313050 SCV004012821 not provided Schaaf-Yang syndrome no assertion provided phenotyping only Variant interpreted as Uncertain significance and reported on 12-21-2018 by Lab University of Wisconsin - Madison / WSLH. Assertions are reported exactly as they appear on the patient provided laboratory report. GenomeConnect does not attempt to reinterpret the variant. The IDDRC-CTSA National Brain Gene Registry (BGR) is a study funded by the U.S. National Center for Advancing Translational Sciences (NCATS) and includes 13 Intellectual and Developmental Disability Research Center (IDDRC) institutions. The study is led by Principal Investigator Dr. Philip Payne from Washington University. The BGR is a data commons of gene variants paired with subject clinical information. This database helps scientists learn more about genetic changes and their impact on the brain and behavior. Participation in the Brain Gene Registry requires participation in GenomeConnect. More information about the Brain Gene Registry can be found on the study website - https://braingeneregistry.wustl.edu/.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.