ClinVar Miner

Submissions for variant NM_019098.5(CNGB3):c.2158CAAAAAGAAAATGAAGATAAA[1] (p.720QKENEDK[1]) (rs746549330)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 5
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
CeGaT Praxis fuer Humangenetik Tuebingen RCV000762527 SCV000892854 uncertain significance not provided 2018-06-01 criteria provided, single submitter clinical testing
Invitae RCV000762527 SCV001023959 benign not provided 2020-12-05 criteria provided, single submitter clinical testing
Bioscientia Institut fuer Medizinische Diagnostik GmbH,Sonic Healthcare RCV001029857 SCV001192643 likely pathogenic Stargardt disease 1 2019-10-21 no assertion criteria provided clinical testing
Natera, Inc. RCV001275881 SCV001461528 benign Achromatopsia 2020-09-16 no assertion criteria provided clinical testing
Department of Pathology and Laboratory Medicine,Sinai Health System RCV000762527 SCV001550145 uncertain significance not provided no assertion criteria provided clinical testing The CNGB3 p.Gln727_Lys733del variant was identified in 1 of 972 (frequency: 0.001) proband chromosomes from individuals with retinal dystrophy (Sergouniotis_2016_PMID:27628848). The variant was identified in dbSNP (ID: rs746549330; rs377050872) and ClinVar (classified as benign by Invitae and as uncertain significance by CeGaT Praxis fuer Humangenetik Tuebingen). The variant was identified in control databases in 293 of 280558 chromosomes (1 homozygous) at a frequency of 0.001044 increasing the likelihood this could be a low frequency benign variant (Genome Aggregation Database March 6, 2019, v2.1.1). The variant was observed in the following populations: African in 219 of 24932 chromosomes (freq: 0.008784), East Asian in 18 of 19764 chromosomes (freq: 0.000911), Latino in 20 of 35110 chromosomes (freq: 0.00057), Other in 3 of 7154 chromosomes (freq: 0.000419), South Asian in 10 of 30168 chromosomes (freq: 0.000332) and European (non-Finnish) in 23 of 128060 chromosomes (freq: 0.00018), but was not observed in the Ashkenazi Jewish or European (Finnish) populations. This variant is an in-frame deletion resulting in the removal of residues 727 to 733; the impact of this alteration on CNGB3 protein function is not known. The variant occurs outside of the splicing consensus sequence and in silico or computational prediction software programs (SpliceSiteFinder, MaxEntScan, NNSPLICE, GeneSplicer) do not predict a difference in splicing. In summary, based on the above information the clinical significance of this variant cannot be determined with certainty at this time. This variant is classified as a variant of uncertain significance.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.