ClinVar Miner

Submissions for variant NM_020066.5(FMN2):c.3339ACCCGGAGCGGGCATACCCCCTCCTCCCCCTCT[1] (p.1115GAGIPPPPPLP[2])

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
CeGaT Center for Human Genetics Tuebingen RCV003415056 SCV004127396 likely benign not provided 2023-08-01 criteria provided, single submitter clinical testing FMN2: PM4, BS2
PreventionGenetics, part of Exact Sciences RCV003929021 SCV004745835 benign FMN2-related disorder 2019-10-31 no assertion criteria provided clinical testing This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications).

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.