ClinVar Miner

Submissions for variant NM_020433.5(JPH2):c.625_645del (p.Glu209_Pro215del)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 1
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Ambry Genetics RCV004991857 SCV005602388 uncertain significance Cardiovascular phenotype 2024-11-27 criteria provided, single submitter clinical testing The c.625_645del21 variant (also known as p.E209_P215del), located in coding exon 2 of the JPH2 gene, results from an in-frame GAGGCGGCCGCGCGGGCGCCC deletion at nucleotide positions 625 to 645. This results in the in-frame deletion 7 amino acids at codons 209 to 215. This amino acid region is not well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the available evidence, the clinical significance of this variant remains unclear.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.