ClinVar Miner

Submissions for variant NM_022725.3(FANCF):c.230_252del (p.Val77fs) (rs730880277)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Invitae RCV000472440 SCV000547717 pathogenic Fanconi anemia 2019-12-05 criteria provided, single submitter clinical testing This sequence change deletes 23 nucleotides from exon 1 of the FANCF mRNA (c.230_252delTTCCGGGATTAGCGAACTTCCAG), causing a frameshift at codon 77. This creates a premature translational stop signal in the last exon of the FANCF mRNA (p.Val77Glyfs*6). While this is not anticipated to result in nonsense mediated decay, it is expected to result in a truncated FANCF protein. While this variant is present in population databases (rs730880277), the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This particular truncation has been reported in the literature in cells isolated from a Fanconi-anemia (FA) patient (PMID: 10615118). This variant is also referred to as "23 bp nt. 230-252". ClinVar contains an entry for this variant (Variation ID: 6340). Experimental studies of cells isolated from a FA-patient have shown that this change in the homozygous state disrupts protein expression and leads to hypersensitiviy of DNA cross-linking agents (PMID: 10615118). Different downstream truncating missense substitutions and deletions in FANCF have been reported to be deleterious (PMID: 10615118, 16084127). This indicates that the amino acid residues truncated in the c.230_252del (p.Val77Glyfs*6) variant are critical for FANCF function. For these reasons, this variant has been classified as Pathogenic.
OMIM RCV000006712 SCV000026903 pathogenic Fanconi anemia, complementation group F 2000-01-01 no assertion criteria provided literature only

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.