ClinVar Miner

Submissions for variant NM_053025.4(MYLK):c.3096_3131del (p.1032_1043AETLKPMGNAKP[1]) (rs758966808)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Invitae RCV000551877 SCV000650535 uncertain significance Aortic aneurysm, familial thoracic 7 2017-06-11 criteria provided, single submitter clinical testing This variant, c.3096_3131delTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGC, results in the deletion of 12 amino acids of the MYLK protein (p.Ala1044_Pro1055del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs758966808, ExAC 0.04%), and has an allele count higher than expected for a pathogenic variant (PMID: 28166811). This variant has not been reported in the literature in individuals with a MYLK-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. In summary, this variant has uncertain impact on MYLK function. The available evidence is currently insufficient to determine its role in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
Ambry Genetics RCV000621969 SCV000739296 uncertain significance Cardiovascular phenotype 2016-06-21 criteria provided, single submitter clinical testing Lines of evidence used in support of classification: Insufficient evidence

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.