Submissions for variant NM_152564.5(VPS13B):c.11846_11875del (p.Met3949_Glu3959delinsLys)

Total submissions: 3

Submitter	RCV	SCV	Clinical significance	Condition	Last evaluated	Review status	Method	Comment
Ambry Genetics	RCV002335836	SCV002642884	uncertain significance	Inborn genetic diseases	2018-03-09	criteria provided, single submitter	clinical testing	The c.11921_11950del30 variant (also known as p.M3974_E3984delinsK) is located in coding exon 61 of the VPS13B gene. This variant results from an in-frame TGCAAATACCATGCCCTGTGGTGGCTGCAG deletion at nucleotide positions 11921 to 11950. The deleted amino acids are replaced by a lysine. The deleted amino acid positions are well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al., PLoS ONE 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.
Labcorp Genetics (formerly Invitae), Labcorp	RCV003096601	SCV003300742	uncertain significance	Cohen syndrome	2022-05-19	criteria provided, single submitter	clinical testing	This variant, c.11921_11950del, is a complex sequence change that results in the deletion of 11 and insertion of 1 amino acid(s) in the VPS13B protein (p.Met3974_Glu3984delinsLys). This variant is present in population databases (rs747131665, gnomAD 0.004%). This variant has not been reported in the literature in individuals affected with VPS13B-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
PreventionGenetics, part of Exact Sciences	RCV003395462	SCV004112498	uncertain significance	VPS13B-related disorder	2023-06-15	criteria provided, single submitter	clinical testing	The VPS13B c.11846_11875del30 variant is predicted to result in an in-frame deletion (p.Met3949_Glu3959delinsLys). To our knowledge, this variant has not been reported in the literature. This variant is reported in 0.0062% of alleles in individuals of European (Non-Finnish) descent in gnomAD (http://gnomad.broadinstitute.org/variant/8-100887745-ATGCAAATACCATGCCCTGTGGTGGCTGCAG-A). At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence.