ClinVar Miner

Submissions for variant NM_172056.2(KCNH2):c.735_754dup (p.Arg252fs) (rs794728425)

Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 2
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
GeneDx RCV000181963 SCV000234266 pathogenic Cardiac arrhythmia 2014-02-03 criteria provided, single submitter clinical testing c.735_754dupCGGCCAGCTCCCATCGCCCC: p.Arg252ProfsX115 (R252PfsX115) in exon 4 of the KCNH2 gene (NM_000238.2). The normal sequence with the bases that are inserted in braces is: GCCCC{CGGCCAGCTCCCATCGCCCC}GGGC. Although thec.735_754dupCGGCCAGCTCCCATCGCCCC mutation in the KCNH2 gene has not been reported to our knowledge, this mutation causes a shift in reading frame starting at codon Arginine 252, changing it to a Proline, and creating a premature stop codon at position 115 of the new reading frame, denoted p.Arg252ProfsX115. This mutation is expected to result in either an abnormal, truncated protein product or loss of protein from this allele through nonsense-mediated mRNA decay. Other frameshift mutations in the KCNH2 gene have been reported in association with LQTS. In summary, c.754_755dup20 in the KCNH2 gene is interpreted as a disease-causing mutation. The variant is found in LQT panel(s).
Invitae RCV000232953 SCV000283987 pathogenic Long QT syndrome 2017-03-07 criteria provided, single submitter clinical testing This sequence change duplicates 20 nucleotides in exon 4 of the KCNH2 mRNA (c.735_754dup20), causing a frameshift at codon 252. This creates a premature translational stop signal (p.Arg252Profs*115) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, truncating variants in KCNH2 are known to be pathogenic (PMID: 19862833). For these reasons, this variant has been classified as Pathogenic.

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.