Submissions for variant NM_176795.5(HRAS):c.488_507del (p.Leu163fs)

dbSNP: rs776060230

Total submissions: 4

Submitter	RCV	SCV	Clinical significance	Condition	Last evaluated	Review status	Method	Comment
ClinGen RASopathy Variant Curation Expert Panel	RCV001030086	SCV001192879	benign	RASopathy	2019-11-04	reviewed by expert panel	curation	The c.488_507delTCTGGGACCCCCCGGGACCC (p.Leu163HisfsTer30) variant in HRAS is classified as benign because it has been identified in 0.07227% (lower bound of the 95% CI of 21/19470) of East Asian chromosomes in gnomAD (BA1; gnomad.broadinstitute.org). This variant was observed in 1 fetus and 1 older proband with clinical presentations that lacked clear associations with a RASopathy. In summary, this variant meets criteria to be classified as benign. ACMG/AMP Criteria applied: BA1.
GeneDx	RCV001619882	SCV001847107	benign	not provided	2021-01-19	criteria provided, single submitter	clinical testing
Labcorp Genetics (formerly Invitae), Labcorp	RCV003514457	SCV004301410	benign	Costello syndrome	2024-01-25	criteria provided, single submitter	clinical testing
PreventionGenetics, part of Exact Sciences	RCV003928669	SCV004740626	likely benign	HRAS-related disorder	2020-09-01	no assertion criteria provided	clinical testing	This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications).