ClinVar Miner

Submissions for variant NM_198252.3(GSN):c.-9-2057_-9-2037dup

dbSNP: rs762432847
Minimum review status: Collection method:
Minimum conflict level:
ClinVar version:
Total submissions: 3
Download table as spreadsheet
Submitter RCV SCV Clinical significance Condition Last evaluated Review status Method Comment
Labcorp Genetics (formerly Invitae), Labcorp RCV001958440 SCV002217915 uncertain significance not provided 2024-01-02 criteria provided, single submitter clinical testing This variant, c.45_65dup, results in the insertion of 7 amino acid(s) of the GSN protein (p.Ala17_Leu23dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with GSN-related conditions. ClinVar contains an entry for this variant (Variation ID: 1446163). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
Ambry Genetics RCV002331512 SCV002636506 uncertain significance Inborn genetic diseases 2023-07-03 criteria provided, single submitter clinical testing The c.45_65dupCCTGGCGCTGTGCGCGCTGTC (p.L23_P24insLALCALS) alteration is located in exon 1 (coding exon 1) of the GSN gene. The alteration consists of an in-frame duplication of 21 nucleotides from position 45 to 65, resulting in the duplication of 7 residues. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear.
Fulgent Genetics, Fulgent Genetics RCV002497842 SCV002777900 uncertain significance Finnish type amyloidosis 2022-04-14 criteria provided, single submitter clinical testing

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.