Total submissions: 2
| Submitter | RCV | SCV | Clinical significance | Condition | Last evaluated | Review status | Method | Comment |
|---|---|---|---|---|---|---|---|---|
| Labcorp Genetics |
RCV001942033 | SCV002235080 | pathogenic | Anauxetic dysplasia | 2023-11-28 | criteria provided, single submitter | clinical testing | This variant occurs in the RMRP gene, which encodes an RNA molecule that does not result in a protein product. This variant is present in population databases (no rsID available, gnomAD 0.007%). This variant has been observed in individuals with cartilage-hair hypoplasia (PMID: 32021596). Other insertions and duplications immediately upstream of the coding sequence have been reported in individuals affected with cartilage-hair hypoplasia-anauxetic dysplasia (CHH-AD) spectrum disorders (PMID: 16244706, 11207361, 12107819). While functional studies for this variant have not been reported, experimental analyses using patient derived cells, as well as in vitro transfection studies, have shown that promoter insertions result in silencing of RMRP transcription and reduced expression of the gene product (PMID: 11207361, 16254002). For these reasons, this variant has been classified as Pathogenic. |
| Laboratorio de Biologia Molecular/Medicina Genomica - |
RCV004762275 | SCV004814081 | pathogenic | Metaphyseal chondrodysplasia, McKusick type | 2024-01-25 | criteria provided, single submitter | clinical testing | The variant n.-24-3dupTACTACTCTGTGAAGCTGAGAA was identified in a compound heterozygous state with another variant in the transcribed region of RMRP gene in an individual affected with Cartilage-Hair Hypoplasia. This alteration is located within the promoter region of the RMRP gene, which encodes an untranslated RNA. Segregation analysis showed that each of the unaffected parents was heterozygous for one of the two variants. Other insertions and duplications in this region have been reported in individuals affected with cartilage-hair hypoplasia-anauxetic dysplasia spectrum disorders (PMID: 11207361, 21956908, 21396580). This variant involves the duplication of 22 nucleotides between the TATA box and the transcription initiation site and functional studies have shown that this type of alteration result in reduced expression of the RMRP gene (PMIDs: 11207361, 16254002). For these reasons, this variant has been classified as Pathogenic. |