ClinVar Miner

List of variants reported as risk factor for Amyotrophic lateral sclerosis, susceptibility to

Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 7
Download table as spreadsheet
HGVS dbSNP
NM_004082.4(DCTN1):c.1712T>C (p.Met571Thr) rs121909343
NM_004082.4(DCTN1):c.2353C>T (p.Arg785Trp) rs121909344
NM_004082.4(DCTN1):c.3302G>A (p.Arg1101Lys) rs121909345
NM_004082.4(DCTN1):c.3746C>T (p.Thr1249Ile) rs72466496
NM_006262.4(PRPH):c.421G>T (p.Asp141Tyr) rs58599399
NM_021076.4(NEFH):c.2015_2056CAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG[1] (p.672_685AEAKSPEKAKSPVK[1]) rs606231212
PRPH, 1-BP DEL, 228C

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.