ClinVar Miner

List of variants in gene TBC1D24 reported as benign for Developmental and epileptic encephalopathy, 1; Autosomal dominant nonsyndromic hearing loss 65; Caused by mutation in the TBC1 domain family, member 24

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 21
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_001199107.2(TBC1D24):c.207T>C (p.Pro69=) rs13339237 0.06245
NM_001199107.2(TBC1D24):c.1440G>A (p.Ser480=) rs12373107 0.02286
NM_001199107.2(TBC1D24):c.1143-6C>T rs73490287 0.02047
NM_001199107.2(TBC1D24):c.1526-20C>T rs114367256 0.01755
NM_001199107.2(TBC1D24):c.1509C>T (p.Ser503=) rs189089167 0.01110
NM_001199107.2(TBC1D24):c.885C>G (p.Phe295Leu) rs72768728 0.00609
NM_001199107.2(TBC1D24):c.1500G>A (p.Ala500=) rs201059992 0.00334
NM_001199107.2(TBC1D24):c.1326C>T (p.Tyr442=) rs184639841 0.00324
NM_001199107.2(TBC1D24):c.1427C>A (p.Ala476Asp) rs202216463 0.00304
NM_001199107.2(TBC1D24):c.441C>T (p.Asp147=) rs149371169 0.00200
NM_001199107.2(TBC1D24):c.1142+17C>A rs199499346 0.00163
NM_001199107.2(TBC1D24):c.1002C>T (p.Ala334=) rs184389316 0.00160
NM_001199107.2(TBC1D24):c.169C>T (p.Arg57Cys) rs202162520 0.00121
NM_001199107.2(TBC1D24):c.657G>A (p.Glu219=) rs587781187 0.00109
NM_001199107.2(TBC1D24):c.1473C>G (p.Pro491=) rs370427146 0.00071
NM_001199107.2(TBC1D24):c.204G>A (p.Thr68=) rs201374999 0.00038
NM_001199107.2(TBC1D24):c.1074C>T (p.Pro358=) rs75961715 0.00021
NM_001199107.2(TBC1D24):c.663C>T (p.Pro221=) rs148670169 0.00019
NM_001199107.2(TBC1D24):c.1207-16C>G rs201618854 0.00016
NM_001199107.2(TBC1D24):c.965+11G>A rs568663296 0.00002
NM_001199107.2(TBC1D24):c.1206+20CCAGGGCTGGCTCTGATGGGCT[2] rs777798547

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.