ClinVar Miner

List of variants reported as likely pathogenic for Familial adenomatous polyposis 1

Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 64
Download table as spreadsheet
HGVS dbSNP
NC_000005.9:g.(?_112072721)_(112090728_?)dup
NC_000005.9:g.(?_112072721)_(112111440_?)dup
NC_000005.9:g.(?_112090570)_(112157688_?)dup
NC_000005.9:g.(?_112090578)_(112111444_?)dup
NC_000005.9:g.(?_112090582)_(112111440_?)dup
NC_000005.9:g.112001178_112043328del42151
NM_000038.5(APC):c.-18-?_834+?dup
NM_000038.5(APC):c.1530_1548+10delTGGAGATGTAGCCAACAAGGTATGTTTTT rs1554081752
NM_000038.5(APC):c.531+5_531+8delGTAA rs1554071617
NM_000038.6(APC):c.-30418_-30417delinsTAGCAAGGG
NM_000038.6(APC):c.1312+3A>G rs863225311
NM_000038.6(APC):c.1313-2A>G rs1561545780
NM_000038.6(APC):c.135+1G>T rs750508765
NM_000038.6(APC):c.136-1G>A rs1554069481
NM_000038.6(APC):c.1530dup (p.Gly511fs) rs1554081749
NM_000038.6(APC):c.1548+2T>C rs1057517561
NM_000038.6(APC):c.1626+1G>A rs1554081934
NM_000038.6(APC):c.1626+2T>C rs876658858
NM_000038.6(APC):c.1627-2A>G
NM_000038.6(APC):c.1705del (p.Ser568_Val569insTer) rs1554082135
NM_000038.6(APC):c.1743+1G>A rs761458613
NM_000038.6(APC):c.1743+1G>T rs761458613
NM_000038.6(APC):c.1744-11_1744-1del rs1064792977
NM_000038.6(APC):c.1917dup (p.Arg640fs) rs397515732
NM_000038.6(APC):c.1956C>T (p.His652=) rs1064793716
NM_000038.6(APC):c.1957A>G (p.Arg653Gly) rs1114167580
NM_000038.6(APC):c.1958G>T (p.Arg653Met) rs1060503318
NM_000038.6(APC):c.1959-1G>A rs863225321
NM_000038.6(APC):c.2057_2058del (p.Asn686fs) rs1561574581
NM_000038.6(APC):c.220+2T>A rs587781809
NM_000038.6(APC):c.220G>T (p.Glu74Ter) rs876658941
NM_000038.6(APC):c.221-1G>C rs863225327
NM_000038.6(APC):c.221-2A>G rs786201291
NM_000038.6(APC):c.2383_2384CT[1] (p.Tyr796fs) rs1561576666
NM_000038.6(APC):c.2804dup (p.Tyr935Ter) rs863225332
NM_000038.6(APC):c.281_282del (p.Arg94fs) rs1561464190
NM_000038.6(APC):c.3013_3019del (p.Ala1005fs) rs1057517553
NM_000038.6(APC):c.3785dup (p.Tyr1262Ter) rs863225345
NM_000038.6(APC):c.388del (p.Ser130fs) rs1554069828
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.3922_3926AAAGA[1] (p.Glu1309fs) rs121913224
NM_000038.6(APC):c.422+2T>C rs879254169
NM_000038.6(APC):c.422+2T>G rs879254169
NM_000038.6(APC):c.423-9A>G rs1554071494
NM_000038.6(APC):c.424_531+69dup rs1561477658
NM_000038.6(APC):c.4617_4618AG[1] (p.Glu1540fs) rs1554086015
NM_000038.6(APC):c.476dup (p.Tyr159Ter) rs878853451
NM_000038.6(APC):c.524_531+4del rs863225364
NM_000038.6(APC):c.531+1G>C rs876659973
NM_000038.6(APC):c.531+5G>C rs587779798
NM_000038.6(APC):c.532-2A>G rs752152148
NM_000038.6(APC):c.532-8G>A rs1060503323
NM_000038.6(APC):c.5659_5663del (p.Asn1887fs) rs1554086854
NM_000038.6(APC):c.5669C>G (p.Ser1890Ter) rs1554086862
NM_000038.6(APC):c.5952_5955del (p.Glu1985fs) rs1057517544
NM_000038.6(APC):c.6287C>G (p.Ser2096Ter) rs1561606344
NM_000038.6(APC):c.6371T>A (p.Leu2124Ter) rs1057517568
NM_000038.6(APC):c.70C>T (p.Arg24Ter) rs145945630
NM_000038.6(APC):c.834G>A (p.Gln278=) rs1060503261
NM_000038.6(APC):c.933+1G>A rs876660765
NM_000038.6(APC):c.933+2T>C rs1057517559
NM_000038.6(APC):c.934-2A>G rs1554079938
NM_001127511.3(APC):c.-190G>A rs879253785
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.