ClinVar Miner

List of variants in gene CDKN2A studied for Familial melanoma

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 876
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_058195.4(CDKN2A):c.193+9477T>G rs3731217 0.12347
NM_000077.5(CDKN2A):c.442G>A (p.Ala148Thr) rs3731249 0.02007
NM_000077.5(CDKN2A):c.379G>T (p.Ala127Ser) rs6413464 0.00527
NM_000077.5(CDKN2A):c.174A>C (p.Arg58=) rs201208890 0.00273
NM_000077.5(CDKN2A):c.430C>T (p.Arg144Cys) rs116150891 0.00248
NM_000077.5(CDKN2A):c.150+37G>C rs45456595 0.00212
NM_000077.5(CDKN2A):c.273G>A (p.Leu91=) rs4987127 0.00045
NM_000077.5(CDKN2A):c.298G>T (p.Ala100Ser) rs200863613 0.00038
NM_000077.5(CDKN2A):c.318G>A (p.Val106=) rs199888003 0.00026
NM_058195.4(CDKN2A):c.69C>T (p.Phe23=) rs374360796 0.00024
NM_000077.5(CDKN2A):c.373G>C (p.Asp125His) rs146179135 0.00022
NM_000077.5(CDKN2A):c.51C>A (p.Ala17=) rs764362225 0.00019
NM_000077.5(CDKN2A):c.151-14G>A rs767030551 0.00016
NM_000077.5(CDKN2A):c.365G>T (p.Gly122Val) rs373291490 0.00016
NM_000077.5(CDKN2A):c.384G>A (p.Arg128=) rs199901898 0.00016
NM_000077.5(CDKN2A):c.261G>A (p.Arg87=) rs546300971 0.00010
NM_000077.5(CDKN2A):c.69T>G (p.Gly23=) rs766772030 0.00010
NM_000077.5(CDKN2A):c.325G>C (p.Ala109Pro) rs372481694 0.00009
NM_000077.5(CDKN2A):c.87G>A (p.Arg29=) rs540871544 0.00009
NM_000077.5(CDKN2A):c.146T>C (p.Ile49Thr) rs199907548 0.00006
NM_058195.4(CDKN2A):c.160C>A (p.Arg54Ser) rs896054565 0.00006
NM_058195.4(CDKN2A):c.94G>A (p.Gly32Arg) rs879254043 0.00006
NM_000077.5(CDKN2A):c.160A>C (p.Met54Leu) rs201314211 0.00005
NM_000077.5(CDKN2A):c.197A>G (p.His66Arg) rs756750256 0.00004
NM_000077.5(CDKN2A):c.405G>A (p.Gly135=) rs751586391 0.00004
NM_000077.5(CDKN2A):c.457+20G>T rs769663648 0.00004
NM_000077.5(CDKN2A):c.147C>A (p.Ile49=) rs200738474 0.00003
NM_000077.5(CDKN2A):c.151-13T>C rs757122222 0.00003
NM_000077.5(CDKN2A):c.206A>G (p.Glu69Gly) rs372670098 0.00003
NM_000077.5(CDKN2A):c.25A>T (p.Met9Leu) rs748866274 0.00003
NM_000077.5(CDKN2A):c.458-17C>T rs777951032 0.00003
NM_058195.4(CDKN2A):c.152G>C (p.Arg51Thr) rs1014358179 0.00003
NM_058195.4(CDKN2A):c.193+16G>A rs752309957 0.00003
NM_058195.4(CDKN2A):c.56G>T (p.Arg19Leu) rs748616717 0.00003
NM_058195.4(CDKN2A):c.71T>C (p.Val24Ala) rs749723804 0.00003
NM_000077.5(CDKN2A):c.122C>A (p.Pro41Gln) rs373407950 0.00002
NM_000077.5(CDKN2A):c.150+20C>T rs550846229 0.00002
NM_000077.5(CDKN2A):c.151-18T>C rs779541481 0.00002
NM_000077.5(CDKN2A):c.151G>A (p.Val51Ile) rs762630679 0.00002
NM_000077.5(CDKN2A):c.198C>T (p.His66=) rs374984975 0.00002
NM_000077.5(CDKN2A):c.226G>A (p.Ala76Thr) rs774633329 0.00002
NM_000077.5(CDKN2A):c.342C>G (p.Pro114=) rs878853648 0.00002
NM_000077.5(CDKN2A):c.400G>C (p.Ala134Pro) rs372599739 0.00002
NM_000077.5(CDKN2A):c.459C>T (p.Asp153=) rs778871932 0.00002
NM_058195.4(CDKN2A):c.167G>A (p.Gly56Glu) rs748327367 0.00002
NM_058195.4(CDKN2A):c.193+15C>T rs757840893 0.00002
NM_058195.4(CDKN2A):c.77A>G (p.His26Arg) rs780803896 0.00002
NM_058195.4(CDKN2A):c.84G>C (p.Pro28=) rs751027808 0.00002
NM_058195.4(CDKN2A):c.92C>G (p.Thr31Arg) rs528789830 0.00002
NM_058195.4(CDKN2A):c.97G>A (p.Glu33Lys) rs1287464120 0.00002
NM_000077.5(CDKN2A):c.103G>A (p.Gly35Arg) rs757066045 0.00001
NM_000077.5(CDKN2A):c.104G>C (p.Gly35Ala) rs746834149 0.00001
NM_000077.5(CDKN2A):c.106G>A (p.Ala36Thr) rs777948908 0.00001
NM_000077.5(CDKN2A):c.121C>G (p.Pro41Ala) rs765321737 0.00001
NM_000077.5(CDKN2A):c.127A>G (p.Ser43Gly) rs766854048 0.00001
NM_000077.5(CDKN2A):c.144G>A (p.Pro48=) rs876659638 0.00001
NM_000077.5(CDKN2A):c.14C>A (p.Ala5Glu) rs1554656700 0.00001
NM_000077.5(CDKN2A):c.150+6T>C rs1025333664 0.00001
NM_000077.5(CDKN2A):c.151-4G>C rs529380972 0.00001
NM_000077.5(CDKN2A):c.155T>C (p.Met52Thr) rs752573958 0.00001
NM_000077.5(CDKN2A):c.159G>C (p.Met53Ile) rs104894095 0.00001
NM_000077.5(CDKN2A):c.178G>A (p.Ala60Thr) rs769382085 0.00001
NM_000077.5(CDKN2A):c.184C>G (p.Leu62Val) rs1819722375 0.00001
NM_000077.5(CDKN2A):c.200G>A (p.Gly67Asp) rs863224605 0.00001
NM_000077.5(CDKN2A):c.210C>T (p.Pro70=) rs864622570 0.00001
NM_000077.5(CDKN2A):c.219C>A (p.Ala73=) rs730881679 0.00001
NM_000077.5(CDKN2A):c.224C>T (p.Pro75Leu) rs772411700 0.00001
NM_000077.5(CDKN2A):c.225C>G (p.Pro75=) rs762397298 0.00001
NM_000077.5(CDKN2A):c.230C>G (p.Thr77Ser) rs1350680332 0.00001
NM_000077.5(CDKN2A):c.241C>T (p.Pro81Ser) rs1334828764 0.00001
NM_000077.5(CDKN2A):c.258C>T (p.Ala86=) rs1001405220 0.00001
NM_000077.5(CDKN2A):c.259C>T (p.Arg87Trp) rs749714198 0.00001
NM_000077.5(CDKN2A):c.267C>T (p.Gly89=) rs1404957845 0.00001
NM_000077.5(CDKN2A):c.270C>T (p.Phe90=) rs746459174 0.00001
NM_000077.5(CDKN2A):c.297G>A (p.Arg99=) rs587778191 0.00001
NM_000077.5(CDKN2A):c.299C>T (p.Ala100Val) rs1344319395 0.00001
NM_000077.5(CDKN2A):c.300C>T (p.Ala100=) rs876660818 0.00001
NM_000077.5(CDKN2A):c.301G>A (p.Gly101Arg) rs104894094 0.00001
NM_000077.5(CDKN2A):c.307C>T (p.Arg103Trp) rs767642535 0.00001
NM_000077.5(CDKN2A):c.315C>A (p.Asp105Glu) rs763269347 0.00001
NM_000077.5(CDKN2A):c.320G>A (p.Arg107His) rs370823171 0.00001
NM_000077.5(CDKN2A):c.32C>T (p.Pro11Leu) rs1374664673 0.00001
NM_000077.5(CDKN2A):c.335G>T (p.Arg112Leu) rs587782797 0.00001
NM_000077.5(CDKN2A):c.343G>T (p.Val115Leu) rs779913365 0.00001
NM_000077.5(CDKN2A):c.344T>A (p.Val115Glu) rs750655995 0.00001
NM_000077.5(CDKN2A):c.351G>C (p.Leu117=) rs1060504182 0.00001
NM_000077.5(CDKN2A):c.352G>A (p.Ala118Thr) rs1554653960 0.00001
NM_000077.5(CDKN2A):c.360G>T (p.Glu120Asp) rs757308315 0.00001
NM_000077.5(CDKN2A):c.383G>A (p.Arg128Gln) rs971657556 0.00001
NM_000077.5(CDKN2A):c.388C>T (p.Leu130=) rs1060501261 0.00001
NM_000077.5(CDKN2A):c.396G>C (p.Ala132=) rs745702441 0.00001
NM_000077.5(CDKN2A):c.39T>G (p.Ala13=) rs786201931 0.00001
NM_000077.5(CDKN2A):c.402G>T (p.Ala134=) rs878853649 0.00001
NM_000077.5(CDKN2A):c.404G>A (p.Gly135Glu) rs1182554152 0.00001
NM_000077.5(CDKN2A):c.406G>A (p.Gly136Ser) rs777840257 0.00001
NM_000077.5(CDKN2A):c.407G>A (p.Gly136Asp) rs758832729 0.00001
NM_000077.5(CDKN2A):c.407G>C (p.Gly136Ala) rs758832729 0.00001
NM_000077.5(CDKN2A):c.412A>G (p.Arg138Gly) rs145012438 0.00001
NM_000077.5(CDKN2A):c.415G>C (p.Gly139Arg) rs587781733 0.00001
NM_000077.5(CDKN2A):c.416G>A (p.Gly139Asp) rs149937815 0.00001
NM_000077.5(CDKN2A):c.421A>G (p.Asn141Asp) rs1399873046 0.00001
NM_000077.5(CDKN2A):c.425A>G (p.His142Arg) rs759922342 0.00001
NM_000077.5(CDKN2A):c.427G>A (p.Ala143Thr) rs754195015 0.00001
NM_000077.5(CDKN2A):c.437A>T (p.Asp146Val) rs1819681703 0.00001
NM_000077.5(CDKN2A):c.440C>T (p.Ala147Val) rs1060501267 0.00001
NM_000077.5(CDKN2A):c.443C>T (p.Ala148Val) rs876659307 0.00001
NM_000077.5(CDKN2A):c.449G>A (p.Gly150Asp) rs1181255434 0.00001
NM_000077.5(CDKN2A):c.452C>T (p.Pro151Leu) rs1060501275 0.00001
NM_000077.5(CDKN2A):c.457+10G>A rs1230430074 0.00001
NM_000077.5(CDKN2A):c.458-105A>G rs1060501266 0.00001
NM_000077.5(CDKN2A):c.458-10C>G rs748219065 0.00001
NM_000077.5(CDKN2A):c.458-9C>T rs1167368771 0.00001
NM_000077.5(CDKN2A):c.468T>C (p.Asp156=) rs749753811 0.00001
NM_000077.5(CDKN2A):c.54G>A (p.Thr18=) rs765702324 0.00001
NM_000077.5(CDKN2A):c.57C>T (p.Ala19=) rs1060504186 0.00001
NM_000077.5(CDKN2A):c.71G>C (p.Arg24Pro) rs104894097 0.00001
NM_000077.5(CDKN2A):c.76G>C (p.Glu26Gln) rs1317637377 0.00001
NM_000077.5(CDKN2A):c.81G>T (p.Glu27Asp) rs1060504184 0.00001
NM_000077.5(CDKN2A):c.94C>G (p.Leu32Val) rs745827714 0.00001
NM_058195.4(CDKN2A):c.100T>G (p.Trp34Gly) rs765285880 0.00001
NM_058195.4(CDKN2A):c.115G>A (p.Ala39Thr) rs1064795551 0.00001
NM_058195.4(CDKN2A):c.121G>A (p.Ala41Thr) rs1064793582 0.00001
NM_058195.4(CDKN2A):c.135C>G (p.Leu45=) rs766676234 0.00001
NM_058195.4(CDKN2A):c.136G>A (p.Val46Met) rs786203467 0.00001
NM_058195.4(CDKN2A):c.13T>A (p.Phe5Ile) rs776987532 0.00001
NM_058195.4(CDKN2A):c.141G>A (p.Leu47=) rs1234187442 0.00001
NM_058195.4(CDKN2A):c.178C>T (p.Leu60Phe) rs769257927 0.00001
NM_058195.4(CDKN2A):c.187A>C (p.Arg63=) rs1190780216 0.00001
NM_058195.4(CDKN2A):c.193+13C>T rs777267719 0.00001
NM_058195.4(CDKN2A):c.193+17A>G rs778691942 0.00001
NM_058195.4(CDKN2A):c.193+7A>G rs770519197 0.00001
NM_058195.4(CDKN2A):c.193+9G>A rs965897956 0.00001
NM_058195.4(CDKN2A):c.35G>A (p.Arg12Gln) rs201877069 0.00001
NM_058195.4(CDKN2A):c.36G>T (p.Arg12=) rs1305455942 0.00001
NM_058195.4(CDKN2A):c.39C>T (p.Arg13=) rs747061582 0.00001
NM_058195.4(CDKN2A):c.42G>A (p.Ala14=) rs1288648134 0.00001
NM_058195.4(CDKN2A):c.46G>A (p.Gly16Ser) rs773459232 0.00001
NM_058195.4(CDKN2A):c.47G>A (p.Gly16Asp) rs1444669684 0.00001
NM_058195.4(CDKN2A):c.49C>T (p.Pro17Ser) rs3731190 0.00001
NM_058195.4(CDKN2A):c.62G>A (p.Arg21Lys) rs1057517601 0.00001
NM_058195.4(CDKN2A):c.79A>C (p.Ile27Leu) rs1057517575 0.00001
NM_058195.4(CDKN2A):c.82C>T (p.Pro28Ser) rs1587358521 0.00001
NM_058195.4(CDKN2A):c.85C>T (p.Arg29Trp) rs1316222103 0.00001
NC_000009.11:g.(?_21968228)_(21968346_?)dup
NC_000009.11:g.(?_21968228)_(21971217_?)del
NC_000009.11:g.(?_21968228)_(21974826_?)dup
NC_000009.11:g.(?_21968228)_(21974875_?)dup
NC_000009.11:g.(?_21970891)_(21973573_?)del
NC_000009.11:g.(?_21970891)_(21975027_?)del
NC_000009.11:g.(?_21971106)_(21972068_?)del
NC_000009.11:g.(?_21974667)_(21974875_?)dup
NC_000009.11:g.(?_21990646)_(21994323_?)del
NC_000009.11:g.(?_21994128)_(21994330_?)del
NC_000009.12:g.(?_21974668)_(21994341_?)del
NC_000009.12:g.(?_21994129)_(21994341_?)del
NC_000009.12:g.(?_21994129)_(21994341_?)dup
NC_000009.12:g.(?_21994140)_(21994331_?)del
NM_000077.4(CDKN2A):c.-306-?_*477+?dup
NM_000077.5(CDKN2A):c.*9G>T rs863224604
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000077.5(CDKN2A):c.100G>A (p.Ala34Thr) rs1554656349
NM_000077.5(CDKN2A):c.101C>T (p.Ala34Val) rs1554656344
NM_000077.5(CDKN2A):c.102G>A (p.Ala34=)
NM_000077.5(CDKN2A):c.102G>C (p.Ala34=)
NM_000077.5(CDKN2A):c.104G>A (p.Gly35Glu) rs746834149
NM_000077.5(CDKN2A):c.104G>T (p.Gly35Val) rs746834149
NM_000077.5(CDKN2A):c.105G>A (p.Gly35=) rs2131112602
NM_000077.5(CDKN2A):c.106G>T (p.Ala36Ser) rs777948908
NM_000077.5(CDKN2A):c.106dup (p.Ala36fs) rs398123152
NM_000077.5(CDKN2A):c.107C>T (p.Ala36Val) rs200382984
NM_000077.5(CDKN2A):c.108G>C (p.Ala36=) rs1587339774
NM_000077.5(CDKN2A):c.110T>G (p.Leu37Arg) rs2131112527
NM_000077.5(CDKN2A):c.111G>A (p.Leu37=) rs1016841954
NM_000077.5(CDKN2A):c.112C>T (p.Pro38Ser) rs1587339752
NM_000077.5(CDKN2A):c.113C>G (p.Pro38Arg)
NM_000077.5(CDKN2A):c.116A>G (p.Asn39Ser)
NM_000077.5(CDKN2A):c.117C>A (p.Asn39Lys) rs864622439
NM_000077.5(CDKN2A):c.117C>T (p.Asn39=) rs864622439
NM_000077.5(CDKN2A):c.118G>C (p.Ala40Pro) rs1554656295
NM_000077.5(CDKN2A):c.118G>T (p.Ala40Ser) rs1554656295
NM_000077.5(CDKN2A):c.120A>T (p.Ala40=) rs1435003150
NM_000077.5(CDKN2A):c.120del (p.Pro41fs)
NM_000077.5(CDKN2A):c.121C>T (p.Pro41Ser)
NM_000077.5(CDKN2A):c.123G>A (p.Pro41=) rs754366579
NM_000077.5(CDKN2A):c.123G>C (p.Pro41=)
NM_000077.5(CDKN2A):c.124A>G (p.Asn42Asp) rs1587339662
NM_000077.5(CDKN2A):c.125A>G (p.Asn42Ser) rs1060501264
NM_000077.5(CDKN2A):c.126T>C (p.Asn42=) rs1587339638
NM_000077.5(CDKN2A):c.126T>G (p.Asn42Lys) rs1587339638
NM_000077.5(CDKN2A):c.126dup (p.Ser43Ter) rs2131112280
NM_000077.5(CDKN2A):c.128G>A (p.Ser43Asn) rs761079352
NM_000077.5(CDKN2A):c.128G>C (p.Ser43Thr) rs761079352
NM_000077.5(CDKN2A):c.129T>C (p.Ser43=) rs2131112224
NM_000077.5(CDKN2A):c.129_131dup (p.Tyr44dup) rs1819947833
NM_000077.5(CDKN2A):c.130del (p.Tyr44fs)
NM_000077.5(CDKN2A):c.131_132insAA (p.Tyr44Ter) rs730881673
NM_000077.5(CDKN2A):c.131dup (p.Tyr44Ter) rs730881673
NM_000077.5(CDKN2A):c.132C>A (p.Tyr44Ter) rs1554656253
NM_000077.5(CDKN2A):c.132C>G (p.Tyr44Ter) rs1554656253
NM_000077.5(CDKN2A):c.132C>T (p.Tyr44=) rs1554656253
NM_000077.5(CDKN2A):c.132del (p.Ser43_Tyr44insTer) rs1131691187
NM_000077.5(CDKN2A):c.133G>A (p.Gly45Ser) rs1328708469
NM_000077.5(CDKN2A):c.133G>C (p.Gly45Arg) rs1328708469
NM_000077.5(CDKN2A):c.133G>T (p.Gly45Cys) rs1328708469
NM_000077.5(CDKN2A):c.133_135del (p.Gly45del) rs2131112114
NM_000077.5(CDKN2A):c.134G>C (p.Gly45Ala) rs2131112123
NM_000077.5(CDKN2A):c.136C>A (p.Arg46=) rs1563892516
NM_000077.5(CDKN2A):c.136C>T (p.Arg46Trp) rs1563892516
NM_000077.5(CDKN2A):c.137G>A (p.Arg46Gln) rs1554656241
NM_000077.5(CDKN2A):c.137G>C (p.Arg46Pro) rs1554656241
NM_000077.5(CDKN2A):c.139A>C (p.Arg47=) rs773755761
NM_000077.5(CDKN2A):c.140G>A (p.Arg47Lys)
NM_000077.5(CDKN2A):c.142C>A (p.Pro48Thr) rs786204195
NM_000077.5(CDKN2A):c.143C>A (p.Pro48Gln) rs763804037
NM_000077.5(CDKN2A):c.143C>G (p.Pro48Arg) rs763804037
NM_000077.5(CDKN2A):c.143C>T (p.Pro48Leu)
NM_000077.5(CDKN2A):c.144G>T (p.Pro48=) rs876659638
NM_000077.5(CDKN2A):c.146T>G (p.Ile49Ser) rs199907548
NM_000077.5(CDKN2A):c.147C>G (p.Ile49Met) rs200738474
NM_000077.5(CDKN2A):c.147C>T (p.Ile49=) rs200738474
NM_000077.5(CDKN2A):c.148C>T (p.Gln50Ter) rs864622636
NM_000077.5(CDKN2A):c.149A>C (p.Gln50Pro) rs587778189
NM_000077.5(CDKN2A):c.149A>G (p.Gln50Arg) rs587778189
NM_000077.5(CDKN2A):c.149A>T (p.Gln50Leu) rs587778189
NM_000077.5(CDKN2A):c.14C>T (p.Ala5Val) rs1554656700
NM_000077.5(CDKN2A):c.150+10G>A rs557891718
NM_000077.5(CDKN2A):c.150+10G>T rs557891718
NM_000077.5(CDKN2A):c.150+11G>A rs1587339427
NM_000077.5(CDKN2A):c.150+12G>A rs1057520264
NM_000077.5(CDKN2A):c.150+12G>T rs1057520264
NM_000077.5(CDKN2A):c.150+15T>A
NM_000077.5(CDKN2A):c.150+15T>C
NM_000077.5(CDKN2A):c.150+15T>G rs2131111640
NM_000077.5(CDKN2A):c.150+18A>G rs1251604295
NM_000077.5(CDKN2A):c.150+1del rs878853644
NM_000077.5(CDKN2A):c.150+2T>C rs1060501265
NM_000077.5(CDKN2A):c.150+3G>T
NM_000077.5(CDKN2A):c.150+3dup rs1235245881
NM_000077.5(CDKN2A):c.150+4G>A rs1563892453
NM_000077.5(CDKN2A):c.150+4G>C
NM_000077.5(CDKN2A):c.150+5G>T rs1554656188
NM_000077.5(CDKN2A):c.150+6dup rs2131111772
NM_000077.5(CDKN2A):c.150+7AG[4] rs2131111719
NM_000077.5(CDKN2A):c.150+8G>A rs1419306566
NM_000077.5(CDKN2A):c.150G>A (p.Gln50=)
NM_000077.5(CDKN2A):c.150G>C (p.Gln50His) rs1057519882
NM_000077.5(CDKN2A):c.150G>T (p.Gln50His) rs1057519882
NM_000077.5(CDKN2A):c.151-11C>T
NM_000077.5(CDKN2A):c.151-12T>C
NM_000077.5(CDKN2A):c.151-14G>C
NM_000077.5(CDKN2A):c.151-18T>A
NM_000077.5(CDKN2A):c.151-19A>C
NM_000077.5(CDKN2A):c.151-1G>A rs730881677
NM_000077.5(CDKN2A):c.151-1G>C rs730881677
NM_000077.5(CDKN2A):c.151-2A>G rs1554654224
NM_000077.5(CDKN2A):c.151-7C>G rs1482685317
NM_000077.5(CDKN2A):c.151-7C>T rs1482685317
NM_000077.5(CDKN2A):c.151-861_252del
NM_000077.5(CDKN2A):c.151-9C>G rs1428942269
NM_000077.5(CDKN2A):c.151G>T (p.Val51Phe)
NM_000077.5(CDKN2A):c.153C>A (p.Val51=) rs2131096751
NM_000077.5(CDKN2A):c.154ATG[2] (p.Met54del) rs2131096613
NM_000077.5(CDKN2A):c.156G>A (p.Met52Ile) rs1377159790
NM_000077.5(CDKN2A):c.156G>C (p.Met52Ile)
NM_000077.5(CDKN2A):c.157A>G (p.Met53Val) rs2131096682
NM_000077.5(CDKN2A):c.158T>C (p.Met53Thr) rs2131096665
NM_000077.5(CDKN2A):c.159G>A (p.Met53Ile) rs104894095
NM_000077.5(CDKN2A):c.15G>A (p.Ala5=)
NM_000077.5(CDKN2A):c.15G>T (p.Ala5=) rs768278082
NM_000077.5(CDKN2A):c.15_16delinsCT (p.Gly6Trp) rs2131114105
NM_000077.5(CDKN2A):c.160A>T (p.Met54Leu) rs201314211
NM_000077.5(CDKN2A):c.162G>A (p.Met54Ile) rs776792523
NM_000077.5(CDKN2A):c.163G>C (p.Gly55Arg) rs1563889961
NM_000077.5(CDKN2A):c.164G>A (p.Gly55Asp) rs561034503
NM_000077.5(CDKN2A):c.164G>T (p.Gly55Val)
NM_000077.5(CDKN2A):c.167G>A (p.Ser56Asn) rs104894109
NM_000077.5(CDKN2A):c.167G>T (p.Ser56Ile) rs104894109
NM_000077.5(CDKN2A):c.168C>A (p.Ser56Arg) rs771138120
NM_000077.5(CDKN2A):c.168C>G (p.Ser56Arg) rs771138120
NM_000077.5(CDKN2A):c.168C>T (p.Ser56=) rs771138120
NM_000077.5(CDKN2A):c.16G>A (p.Gly6Arg) rs587778190
NM_000077.5(CDKN2A):c.16G>T (p.Gly6Trp) rs587778190
NM_000077.5(CDKN2A):c.170C>A (p.Ala57Asp) rs372266620
NM_000077.5(CDKN2A):c.170C>G (p.Ala57Gly) rs372266620
NM_000077.5(CDKN2A):c.170C>T (p.Ala57Val) rs372266620
NM_000077.5(CDKN2A):c.172C>A (p.Arg58=) rs121913387
NM_000077.5(CDKN2A):c.172C>G (p.Arg58Gly) rs121913387
NM_000077.5(CDKN2A):c.172C>T (p.Arg58Ter) rs121913387
NM_000077.5(CDKN2A):c.173G>A (p.Arg58Gln)
NM_000077.5(CDKN2A):c.173G>T (p.Arg58Leu)
NM_000077.5(CDKN2A):c.174A>G (p.Arg58=) rs201208890
NM_000077.5(CDKN2A):c.175G>A (p.Val59Met) rs1819723898
NM_000077.5(CDKN2A):c.175G>T (p.Val59Leu)
NM_000077.5(CDKN2A):c.176T>C (p.Val59Ala) rs104894099
NM_000077.5(CDKN2A):c.176T>G (p.Val59Gly) rs104894099
NM_000077.5(CDKN2A):c.177G>A (p.Val59=) rs527503775
NM_000077.5(CDKN2A):c.178G>C (p.Ala60Pro) rs769382085
NM_000077.5(CDKN2A):c.179C>T (p.Ala60Val) rs36204594
NM_000077.5(CDKN2A):c.17G>A (p.Gly6Glu) rs864622656
NM_000077.5(CDKN2A):c.17G>C (p.Gly6Ala) rs864622656
NM_000077.5(CDKN2A):c.17G>T (p.Gly6Val) rs864622656
NM_000077.5(CDKN2A):c.180G>A (p.Ala60=) rs1286147184
NM_000077.5(CDKN2A):c.183G>C (p.Glu61Asp) rs878853645
NM_000077.5(CDKN2A):c.183GCT[5] (p.Leu65dup) rs2131096063
NM_000077.5(CDKN2A):c.188T>C (p.Leu63Pro) rs2131096164
NM_000077.5(CDKN2A):c.188_257del (p.Leu63fs)
NM_000077.5(CDKN2A):c.189G>A (p.Leu63=) rs1309566180
NM_000077.5(CDKN2A):c.189del (p.Leu64fs) rs1587332338
NM_000077.5(CDKN2A):c.18G>A (p.Gly6=)
NM_000077.5(CDKN2A):c.18G>C (p.Gly6=) rs1819965928
NM_000077.5(CDKN2A):c.18G>T (p.Gly6=) rs1819965928
NM_000077.5(CDKN2A):c.190C>G (p.Leu64Val)
NM_000077.5(CDKN2A):c.192G>T (p.Leu64=) rs876659128
NM_000077.5(CDKN2A):c.193C>T (p.Leu65Phe) rs1819721047
NM_000077.5(CDKN2A):c.194T>C (p.Leu65Pro) rs1587332314
NM_000077.5(CDKN2A):c.196C>G (p.His66Asp) rs1819720314
NM_000077.5(CDKN2A):c.196C>T (p.His66Tyr) rs1819720314
NM_000077.5(CDKN2A):c.197dup (p.His66fs) rs1563889847
NM_000077.5(CDKN2A):c.198C>A (p.His66Gln) rs374984975
NM_000077.5(CDKN2A):c.198C>G (p.His66Gln) rs374984975
NM_000077.5(CDKN2A):c.199G>A (p.Gly67Ser) rs758389471
NM_000077.5(CDKN2A):c.199G>C (p.Gly67Arg) rs758389471
NM_000077.5(CDKN2A):c.19A>T (p.Ser7Cys) rs1554656670
NM_000077.5(CDKN2A):c.19_22dup (p.Ser8fs)
NM_000077.5(CDKN2A):c.201C>A (p.Gly67=)
NM_000077.5(CDKN2A):c.202G>A (p.Ala68Thr)
NM_000077.5(CDKN2A):c.202G>C (p.Ala68Pro) rs1819719137
NM_000077.5(CDKN2A):c.202G>T (p.Ala68Ser) rs1819719137
NM_000077.5(CDKN2A):c.202_203delinsTT (p.Ala68Leu) rs876658534
NM_000077.5(CDKN2A):c.203C>G (p.Ala68Gly) rs1060501260
NM_000077.5(CDKN2A):c.203C>T (p.Ala68Val) rs1060501260
NM_000077.5(CDKN2A):c.204_205delinsTT (p.Glu69Ter) rs2131095862
NM_000077.5(CDKN2A):c.205G>A (p.Glu69Lys) rs121913383
NM_000077.5(CDKN2A):c.206A>C (p.Glu69Ala)
NM_000077.5(CDKN2A):c.207G>A (p.Glu69=) rs1587332220
NM_000077.5(CDKN2A):c.207G>T (p.Glu69Asp) rs1587332220
NM_000077.5(CDKN2A):c.208C>A (p.Pro70Thr) rs1819718265
NM_000077.5(CDKN2A):c.208C>T (p.Pro70Ser) rs1819718265
NM_000077.5(CDKN2A):c.209C>T (p.Pro70Leu) rs786202575
NM_000077.5(CDKN2A):c.212A>C (p.Asn71Thr)
NM_000077.5(CDKN2A):c.212A>G (p.Asn71Ser) rs559848002
NM_000077.5(CDKN2A):c.213C>T (p.Asn71=) rs2131095688
NM_000077.5(CDKN2A):c.214T>A (p.Cys72Ser) rs1554654142
NM_000077.5(CDKN2A):c.214T>G (p.Cys72Gly) rs1554654142
NM_000077.5(CDKN2A):c.216C>T (p.Cys72=) rs1563889729
NM_000077.5(CDKN2A):c.217G>A (p.Ala73Thr)
NM_000077.5(CDKN2A):c.218_220del (p.Ala73del)
NM_000077.5(CDKN2A):c.218_220dup (p.Ala73dup) rs1554654136
NM_000077.5(CDKN2A):c.219C>G (p.Ala73=) rs730881679
NM_000077.5(CDKN2A):c.220G>A (p.Asp74Asn) rs760640852
NM_000077.5(CDKN2A):c.221A>T (p.Asp74Val) rs200429615
NM_000077.5(CDKN2A):c.221del (p.Asp74fs) rs1563889685
NM_000077.5(CDKN2A):c.222C>G (p.Asp74Glu) rs1587332001
NM_000077.5(CDKN2A):c.223C>T (p.Pro75Ser) rs1202706337
NM_000077.5(CDKN2A):c.225C>A (p.Pro75=) rs762397298
NM_000077.5(CDKN2A):c.225C>T (p.Pro75=) rs762397298
NM_000077.5(CDKN2A):c.225_243del (p.Ala76fs) rs730881674
NM_000077.5(CDKN2A):c.226G>T (p.Ala76Ser)
NM_000077.5(CDKN2A):c.229A>G (p.Thr77Ala) rs1563889628
NM_000077.5(CDKN2A):c.22A>C (p.Ser8Arg) rs1554656665
NM_000077.5(CDKN2A):c.232C>G (p.Leu78Val)
NM_000077.5(CDKN2A):c.232C>T (p.Leu78Phe) rs1563889606
NM_000077.5(CDKN2A):c.233T>G (p.Leu78Arg) rs1554654118
NM_000077.5(CDKN2A):c.234C>T (p.Leu78=) rs1587331920
NM_000077.5(CDKN2A):c.235A>C (p.Thr79Pro) rs1554654113
NM_000077.5(CDKN2A):c.236C>A (p.Thr79Asn) rs1034265990
NM_000077.5(CDKN2A):c.236C>G (p.Thr79Ser) rs1034265990
NM_000077.5(CDKN2A):c.236C>T (p.Thr79Ile) rs1034265990
NM_000077.5(CDKN2A):c.238C>T (p.Arg80Ter) rs121913388
NM_000077.5(CDKN2A):c.238del (p.Arg80fs) rs1563889584
NM_000077.5(CDKN2A):c.239G>A (p.Arg80Gln) rs1057519883
NM_000077.5(CDKN2A):c.239G>C (p.Arg80Pro)
NM_000077.5(CDKN2A):c.23G>C (p.Ser8Thr) rs1554656656
NM_000077.5(CDKN2A):c.240_253del (p.Pro81fs) rs730881675
NM_000077.5(CDKN2A):c.242C>G (p.Pro81Arg) rs11552823
NM_000077.5(CDKN2A):c.242C>T (p.Pro81Leu) rs11552823
NM_000077.5(CDKN2A):c.243C>G (p.Pro81=) rs1060504185
NM_000077.5(CDKN2A):c.243C>T (p.Pro81=) rs1060504185
NM_000077.5(CDKN2A):c.244G>A (p.Val82Met) rs1060501269
NM_000077.5(CDKN2A):c.244G>C (p.Val82Leu) rs1060501269
NM_000077.5(CDKN2A):c.244G>T (p.Val82Leu) rs1060501269
NM_000077.5(CDKN2A):c.245T>A (p.Val82Glu) rs1819711290
NM_000077.5(CDKN2A):c.246G>A (p.Val82=) rs1060504181
NM_000077.5(CDKN2A):c.246G>C (p.Val82=) rs1060504181
NM_000077.5(CDKN2A):c.247C>T (p.His83Tyr) rs121913385
NM_000077.5(CDKN2A):c.248_272del (p.His83fs)
NM_000077.5(CDKN2A):c.249C>A (p.His83Gln) rs34968276
NM_000077.5(CDKN2A):c.249C>T (p.His83=) rs34968276
NM_000077.5(CDKN2A):c.250G>A (p.Asp84Asn) rs11552822
NM_000077.5(CDKN2A):c.250G>C (p.Asp84His)
NM_000077.5(CDKN2A):c.250G>T (p.Asp84Tyr) rs11552822
NM_000077.5(CDKN2A):c.251A>C (p.Asp84Ala) rs587782792
NM_000077.5(CDKN2A):c.251A>T (p.Asp84Val)
NM_000077.5(CDKN2A):c.252C>G (p.Asp84Glu)
NM_000077.5(CDKN2A):c.252C>T (p.Asp84=) rs1472715728
NM_000077.5(CDKN2A):c.253G>A (p.Ala85Thr) rs878853646
NM_000077.5(CDKN2A):c.253G>C (p.Ala85Pro) rs878853646
NM_000077.5(CDKN2A):c.253G>T (p.Ala85Ser) rs878853646
NM_000077.5(CDKN2A):c.253_254delinsTT (p.Ala85Phe) rs1064796336
NM_000077.5(CDKN2A):c.254C>T (p.Ala85Val) rs2131094921
NM_000077.5(CDKN2A):c.258C>A (p.Ala86=) rs1001405220
NM_000077.5(CDKN2A):c.259C>A (p.Arg87=) rs749714198
NM_000077.5(CDKN2A):c.259C>G (p.Arg87Gly)
NM_000077.5(CDKN2A):c.25A>G (p.Met9Val) rs748866274
NM_000077.5(CDKN2A):c.260G>C (p.Arg87Pro) rs878853647
NM_000077.5(CDKN2A):c.262G>A (p.Glu88Lys) rs121913384
NM_000077.5(CDKN2A):c.262G>C (p.Glu88Gln) rs121913384
NM_000077.5(CDKN2A):c.262G>T (p.Glu88Ter) rs121913384
NM_000077.5(CDKN2A):c.264G>A (p.Glu88=) rs1819706385
NM_000077.5(CDKN2A):c.265G>A (p.Gly89Ser) rs137854597
NM_000077.5(CDKN2A):c.265G>T (p.Gly89Cys)
NM_000077.5(CDKN2A):c.266G>A (p.Gly89Asp) rs137854599
NM_000077.5(CDKN2A):c.266G>C (p.Gly89Ala) rs137854599
NM_000077.5(CDKN2A):c.268T>C (p.Phe90Leu)
NM_000077.5(CDKN2A):c.269T>G (p.Phe90Cys) rs1554654069
NM_000077.5(CDKN2A):c.26T>A (p.Met9Lys) rs145445140
NM_000077.5(CDKN2A):c.26T>C (p.Met9Thr) rs145445140
NM_000077.5(CDKN2A):c.26T>G (p.Met9Arg) rs145445140
NM_000077.5(CDKN2A):c.271C>A (p.Leu91Met)
NM_000077.5(CDKN2A):c.271C>T (p.Leu91=) rs1554654063
NM_000077.5(CDKN2A):c.272T>A (p.Leu91Gln) rs1563889362
NM_000077.5(CDKN2A):c.274G>C (p.Asp92His)
NM_000077.5(CDKN2A):c.276C>A (p.Asp92Glu) rs1587331567
NM_000077.5(CDKN2A):c.277A>G (p.Thr93Ala)
NM_000077.5(CDKN2A):c.278C>A (p.Thr93Lys)
NM_000077.5(CDKN2A):c.278C>G (p.Thr93Arg) rs876659723
NM_000077.5(CDKN2A):c.279G>T (p.Thr93=) rs2131094486
NM_000077.5(CDKN2A):c.27G>A (p.Met9Ile) rs1587340400
NM_000077.5(CDKN2A):c.280C>G (p.Leu94Val)
NM_000077.5(CDKN2A):c.282G>A (p.Leu94=) rs1064793589
NM_000077.5(CDKN2A):c.283del (p.Val95fs) rs1554654052
NM_000077.5(CDKN2A):c.284T>G (p.Val95Gly)
NM_000077.5(CDKN2A):c.285G>A (p.Val95=) rs1587331518
NM_000077.5(CDKN2A):c.286G>C (p.Val96Leu) rs1587331506
NM_000077.5(CDKN2A):c.286G>T (p.Val96Leu)
NM_000077.5(CDKN2A):c.287_291del (p.Val96fs)
NM_000077.5(CDKN2A):c.288G>A (p.Val96=) rs557319056
NM_000077.5(CDKN2A):c.28G>A (p.Glu10Lys)
NM_000077.5(CDKN2A):c.28G>T (p.Glu10Ter)
NM_000077.5(CDKN2A):c.290T>C (p.Leu97Pro) rs1819702487
NM_000077.5(CDKN2A):c.291G>C (p.Leu97=) rs1587331492
NM_000077.5(CDKN2A):c.292C>T (p.His98Tyr) rs1064793953
NM_000077.5(CDKN2A):c.293A>G (p.His98Arg)
NM_000077.5(CDKN2A):c.294C>T (p.His98=) rs752685118
NM_000077.5(CDKN2A):c.295C>A (p.Arg99=) rs34886500
NM_000077.5(CDKN2A):c.295C>G (p.Arg99Gly) rs34886500
NM_000077.5(CDKN2A):c.295C>T (p.Arg99Trp) rs34886500
NM_000077.5(CDKN2A):c.296G>A (p.Arg99Gln) rs754806883
NM_000077.5(CDKN2A):c.296G>C (p.Arg99Pro) rs754806883
NM_000077.5(CDKN2A):c.296G>T (p.Arg99Leu)
NM_000077.5(CDKN2A):c.297G>T (p.Arg99=) rs587778191
NM_000077.5(CDKN2A):c.301G>C (p.Gly101Arg) rs104894094
NM_000077.5(CDKN2A):c.301G>T (p.Gly101Trp) rs104894094
NM_000077.5(CDKN2A):c.302G>C (p.Gly101Ala) rs750414596
NM_000077.5(CDKN2A):c.303G>T (p.Gly101=) rs1554654044
NM_000077.5(CDKN2A):c.303_304insC (p.Ala102fs)
NM_000077.5(CDKN2A):c.304G>A (p.Ala102Thr) rs35741010
NM_000077.5(CDKN2A):c.305C>A (p.Ala102Glu) rs137854598
NM_000077.5(CDKN2A):c.305C>T (p.Ala102Val) rs137854598
NM_000077.5(CDKN2A):c.306G>T (p.Ala102=) rs1064794863
NM_000077.5(CDKN2A):c.307_308del (p.Arg103fs) rs886041162
NM_000077.5(CDKN2A):c.308G>A (p.Arg103Gln) rs143282362
NM_000077.5(CDKN2A):c.308G>C (p.Arg103Pro) rs143282362
NM_000077.5(CDKN2A):c.30G>A (p.Glu10=)
NM_000077.5(CDKN2A):c.30del (p.Glu10fs) rs1554656624
NM_000077.5(CDKN2A):c.311T>C (p.Leu104Pro) rs1819698963
NM_000077.5(CDKN2A):c.313G>A (p.Asp105Asn) rs774829510
NM_000077.5(CDKN2A):c.315C>T (p.Asp105=) rs763269347
NM_000077.5(CDKN2A):c.316G>A (p.Val106Met) rs775860099
NM_000077.5(CDKN2A):c.316G>T (p.Val106Leu)
NM_000077.5(CDKN2A):c.317T>A (p.Val106Glu) rs1554654028
NM_000077.5(CDKN2A):c.317T>C (p.Val106Ala) rs1554654028
NM_000077.5(CDKN2A):c.319C>A (p.Arg107Ser) rs1554654024
NM_000077.5(CDKN2A):c.319C>T (p.Arg107Cys) rs1554654024
NM_000077.5(CDKN2A):c.31C>A (p.Pro11Thr) rs1587340371
NM_000077.5(CDKN2A):c.31C>G (p.Pro11Ala) rs1587340371
NM_000077.5(CDKN2A):c.320G>C (p.Arg107Pro) rs370823171
NM_000077.5(CDKN2A):c.320_321delinsTT (p.Arg107Leu) rs1819698005
NM_000077.5(CDKN2A):c.321C>G (p.Arg107=) rs772527888
NM_000077.5(CDKN2A):c.322G>A (p.Asp108Asn) rs121913381
NM_000077.5(CDKN2A):c.322G>T (p.Asp108Tyr) rs121913381
NM_000077.5(CDKN2A):c.323A>T (p.Asp108Val)
NM_000077.5(CDKN2A):c.324T>A (p.Asp108Glu) rs2131093707
NM_000077.5(CDKN2A):c.325G>T (p.Ala109Ser) rs372481694
NM_000077.5(CDKN2A):c.326C>A (p.Ala109Asp) rs1064794838
NM_000077.5(CDKN2A):c.327C>G (p.Ala109=) rs1060504187
NM_000077.5(CDKN2A):c.327C>T (p.Ala109=) rs1060504187
NM_000077.5(CDKN2A):c.328T>A (p.Trp110Arg) rs747717236
NM_000077.5(CDKN2A):c.328T>C (p.Trp110Arg)
NM_000077.5(CDKN2A):c.329G>A (p.Trp110Ter) rs1057519852
NM_000077.5(CDKN2A):c.32dup (p.Ser12fs) rs1819962958
NM_000077.5(CDKN2A):c.330G>A (p.Trp110Ter) rs121913389
NM_000077.5(CDKN2A):c.331G>A (p.Gly111Ser) rs778971134
NM_000077.5(CDKN2A):c.332G>A (p.Gly111Asp) rs2131093568
NM_000077.5(CDKN2A):c.332G>T (p.Gly111Val) rs2131093568
NM_000077.5(CDKN2A):c.334C>A (p.Arg112Ser)
NM_000077.5(CDKN2A):c.334C>G (p.Arg112Gly) rs876660436
NM_000077.5(CDKN2A):c.334C>T (p.Arg112Cys)
NM_000077.5(CDKN2A):c.335G>A (p.Arg112His) rs587782797
NM_000077.5(CDKN2A):c.335_337dup (p.Arg112dup) rs768966657
NM_000077.5(CDKN2A):c.338T>C (p.Leu113Pro) rs1819695317
NM_000077.5(CDKN2A):c.339G>A (p.Leu113=) rs575031539
NM_000077.5(CDKN2A):c.339_340delinsCT (p.Pro114Ser) rs387906410
NM_000077.5(CDKN2A):c.340C>A (p.Pro114Thr) rs104894104
NM_000077.5(CDKN2A):c.340C>T (p.Pro114Ser) rs104894104
NM_000077.5(CDKN2A):c.340_355del (p.Pro114fs) rs1554653956
NM_000077.5(CDKN2A):c.341C>T (p.Pro114Leu) rs121913386
NM_000077.5(CDKN2A):c.343G>A (p.Val115Met) rs779913365
NM_000077.5(CDKN2A):c.343G>C (p.Val115Leu)
NM_000077.5(CDKN2A):c.344T>G (p.Val115Gly) rs750655995
NM_000077.5(CDKN2A):c.345G>A (p.Val115=) rs1819693631
NM_000077.5(CDKN2A):c.348C>A (p.Asp116Glu) rs995881157
NM_000077.5(CDKN2A):c.349C>T (p.Leu117=) rs767692456
NM_000077.5(CDKN2A):c.34T>G (p.Ser12Ala) rs2131113779
NM_000077.5(CDKN2A):c.34del (p.Ser12fs) rs2131113797
NM_000077.5(CDKN2A):c.350T>C (p.Leu117Pro) rs1819693018
NM_000077.5(CDKN2A):c.351G>A (p.Leu117=) rs1060504182
NM_000077.5(CDKN2A):c.353C>T (p.Ala118Val) rs1060501270
NM_000077.5(CDKN2A):c.355G>A (p.Glu119Lys) rs1563888963
NM_000077.5(CDKN2A):c.355GAG[3] (p.Glu120dup) rs1554653952
NM_000077.5(CDKN2A):c.358G>T (p.Glu120Ter)
NM_000077.5(CDKN2A):c.358del (p.Glu120fs) rs1060501263
NM_000077.5(CDKN2A):c.359_360dup (p.Leu121fs) rs1563888944
NM_000077.5(CDKN2A):c.35C>A (p.Ser12Ter) rs141798398
NM_000077.5(CDKN2A):c.35C>G (p.Ser12Trp) rs141798398
NM_000077.5(CDKN2A):c.35C>T (p.Ser12Leu) rs141798398
NM_000077.5(CDKN2A):c.360G>A (p.Glu120=) rs757308315
NM_000077.5(CDKN2A):c.361C>G (p.Leu121Val) rs142371511
NM_000077.5(CDKN2A):c.361C>T (p.Leu121=) rs142371511
NM_000077.5(CDKN2A):c.362T>C (p.Leu121Pro) rs1162584542
NM_000077.5(CDKN2A):c.362T>G (p.Leu121Arg)
NM_000077.5(CDKN2A):c.363G>A (p.Leu121=) rs2131092992
NM_000077.5(CDKN2A):c.364G>A (p.Gly122Ser) rs113798404
NM_000077.5(CDKN2A):c.364G>C (p.Gly122Arg) rs113798404
NM_000077.5(CDKN2A):c.366C>T (p.Gly122=) rs2131092946
NM_000077.5(CDKN2A):c.367C>T (p.His123Tyr)
NM_000077.5(CDKN2A):c.367del (p.His123fs)
NM_000077.5(CDKN2A):c.369T>A (p.His123Gln) rs6413463
NM_000077.5(CDKN2A):c.369T>C (p.His123=) rs6413463
NM_000077.5(CDKN2A):c.36G>C (p.Ser12=) rs1313234793
NM_000077.5(CDKN2A):c.36G>T (p.Ser12=) rs1313234793
NM_000077.5(CDKN2A):c.370C>G (p.Arg124Gly) rs34170727
NM_000077.5(CDKN2A):c.370C>T (p.Arg124Cys) rs34170727
NM_000077.5(CDKN2A):c.372C>T (p.Arg124=) rs2131092856
NM_000077.5(CDKN2A):c.373G>A (p.Asp125Asn) rs146179135
NM_000077.5(CDKN2A):c.374A>G (p.Asp125Gly) rs1408195053
NM_000077.5(CDKN2A):c.376G>C (p.Val126Leu) rs1350305259
NM_000077.5(CDKN2A):c.377T>A (p.Val126Asp) rs104894098
NM_000077.5(CDKN2A):c.379G>C (p.Ala127Pro) rs6413464
NM_000077.5(CDKN2A):c.37G>T (p.Ala13Ser) rs1416122398
NM_000077.5(CDKN2A):c.380C>T (p.Ala127Val)
NM_000077.5(CDKN2A):c.381_391del (p.Tyr129fs)
NM_000077.5(CDKN2A):c.381_393delinsGATGCG (p.Arg128fs) rs1554653915
NM_000077.5(CDKN2A):c.382C>T (p.Arg128Trp) rs1563888826
NM_000077.5(CDKN2A):c.383G>C (p.Arg128Pro) rs971657556
NM_000077.5(CDKN2A):c.385T>C (p.Tyr129His)
NM_000077.5(CDKN2A):c.387C>A (p.Tyr129Ter)
NM_000077.5(CDKN2A):c.387C>T (p.Tyr129=) rs1554653922
NM_000077.5(CDKN2A):c.388C>A (p.Leu130Met) rs1060501261
NM_000077.5(CDKN2A):c.389T>A (p.Leu130Gln)
NM_000077.5(CDKN2A):c.38C>A (p.Ala13Asp) rs745612549
NM_000077.5(CDKN2A):c.38C>T (p.Ala13Val) rs745612549
NM_000077.5(CDKN2A):c.391C>A (p.Arg131Ser) rs755927351
NM_000077.5(CDKN2A):c.391C>T (p.Arg131Cys) rs755927351
NM_000077.5(CDKN2A):c.392G>A (p.Arg131His) rs1563888782
NM_000077.5(CDKN2A):c.393C>G (p.Arg131=) rs1476521287
NM_000077.5(CDKN2A):c.393C>T (p.Arg131=) rs1476521287
NM_000077.5(CDKN2A):c.394G>A (p.Ala132Thr) rs2131092506
NM_000077.5(CDKN2A):c.395C>T (p.Ala132Val) rs1413479756
NM_000077.5(CDKN2A):c.397G>A (p.Ala133Thr) rs1201199303
NM_000077.5(CDKN2A):c.397G>T (p.Ala133Ser) rs1201199303
NM_000077.5(CDKN2A):c.39T>C (p.Ala13=) rs786201931
NM_000077.5(CDKN2A):c.400G>T (p.Ala134Ser) rs372599739
NM_000077.5(CDKN2A):c.401C>T (p.Ala134Val) rs757497674
NM_000077.5(CDKN2A):c.402G>A (p.Ala134=) rs878853649
NM_000077.5(CDKN2A):c.403G>T (p.Gly135Trp) rs1819686306
NM_000077.5(CDKN2A):c.404G>C (p.Gly135Ala) rs1182554152
NM_000077.5(CDKN2A):c.404G>T (p.Gly135Val) rs1182554152
NM_000077.5(CDKN2A):c.407del (p.Gly136fs) rs749588877
NM_000077.5(CDKN2A):c.407dup (p.Thr137fs) rs749588877
NM_000077.5(CDKN2A):c.411C>A (p.Thr137=)
NM_000077.5(CDKN2A):c.411C>T (p.Thr137=)
NM_000077.5(CDKN2A):c.412A>C (p.Arg138=) rs145012438
NM_000077.5(CDKN2A):c.413G>A (p.Arg138Lys) rs1819684763
NM_000077.5(CDKN2A):c.413G>C (p.Arg138Thr)
NM_000077.5(CDKN2A):c.415G>A (p.Gly139Ser) rs587781733
NM_000077.5(CDKN2A):c.416G>T (p.Gly139Val)
NM_000077.5(CDKN2A):c.418A>C (p.Ser140Arg) rs1587330504
NM_000077.5(CDKN2A):c.41A>G (p.Asp14Gly) rs2131113670
NM_000077.5(CDKN2A):c.41_43delinsG (p.Asp14fs) rs1587340291
NM_000077.5(CDKN2A):c.423C>A (p.Asn141Lys) rs1819683853
NM_000077.5(CDKN2A):c.423C>T (p.Asn141=) rs1819683853
NM_000077.5(CDKN2A):c.424C>G (p.His142Asp) rs1587330478
NM_000077.5(CDKN2A):c.428C>G (p.Ala143Gly) rs767149947
NM_000077.5(CDKN2A):c.429C>A (p.Ala143=) rs1060504183
NM_000077.5(CDKN2A):c.429_430delinsAT (p.Arg144Cys)
NM_000077.5(CDKN2A):c.42C>A (p.Asp14Glu) rs1819961127
NM_000077.5(CDKN2A):c.42C>G (p.Asp14Glu) rs1819961127
NM_000077.5(CDKN2A):c.42C>T (p.Asp14=)
NM_000077.5(CDKN2A):c.430C>G (p.Arg144Gly) rs116150891
NM_000077.5(CDKN2A):c.431G>A (p.Arg144His) rs1060501274
NM_000077.5(CDKN2A):c.431G>C (p.Arg144Pro) rs1060501274
NM_000077.5(CDKN2A):c.431G>T (p.Arg144Leu) rs1060501274
NM_000077.5(CDKN2A):c.432C>G (p.Arg144=)
NM_000077.5(CDKN2A):c.433A>G (p.Ile145Val) rs1587330426
NM_000077.5(CDKN2A):c.434T>A (p.Ile145Lys) rs730881680
NM_000077.5(CDKN2A):c.434T>C (p.Ile145Thr) rs730881680
NM_000077.5(CDKN2A):c.436G>A (p.Asp146Asn) rs1563888589
NM_000077.5(CDKN2A):c.436G>T (p.Asp146Tyr)
NM_000077.5(CDKN2A):c.438T>G (p.Asp146Glu)
NM_000077.5(CDKN2A):c.441C>A (p.Ala147=) rs1057524065
NM_000077.5(CDKN2A):c.442G>C (p.Ala148Pro) rs3731249
NM_000077.5(CDKN2A):c.442G>T (p.Ala148Ser) rs3731249
NM_000077.5(CDKN2A):c.444G>C (p.Ala148=) rs768280139
NM_000077.5(CDKN2A):c.448G>T (p.Gly150Cys)
NM_000077.5(CDKN2A):c.44G>A (p.Trp15Ter) rs876658556
NM_000077.5(CDKN2A):c.44_46dup (p.Trp15_Leu16insArg) rs730881672
NM_000077.5(CDKN2A):c.450T>C (p.Gly150=) rs762612798
NM_000077.5(CDKN2A):c.455del (p.Pro151_Ser152insTer)
NM_000077.5(CDKN2A):c.456A>G (p.Ser152=) rs2131091484
NM_000077.5(CDKN2A):c.457+12T>C rs1563888491
NM_000077.5(CDKN2A):c.457+13G>A
NM_000077.5(CDKN2A):c.457+14A>T
NM_000077.5(CDKN2A):c.457+16C>A rs2131091282
NM_000077.5(CDKN2A):c.457+17del
NM_000077.5(CDKN2A):c.457+1G>T rs1587330312
NM_000077.5(CDKN2A):c.457+1_457+10del rs1587330284
NM_000077.5(CDKN2A):c.457+2T>G rs1587330309
NM_000077.5(CDKN2A):c.457+3G>A rs1206827598
NM_000077.5(CDKN2A):c.457+3G>T
NM_000077.5(CDKN2A):c.457+5G>T
NM_000077.5(CDKN2A):c.457G>A (p.Asp153Asn) rs45476696
NM_000077.5(CDKN2A):c.457G>C (p.Asp153His)
NM_000077.5(CDKN2A):c.457G>T (p.Asp153Tyr) rs45476696
NM_000077.5(CDKN2A):c.458-10C>T rs748219065
NM_000077.5(CDKN2A):c.458-12T>C rs983505944
NM_000077.5(CDKN2A):c.458-12T>G rs983505944
NM_000077.5(CDKN2A):c.458-14T>G
NM_000077.5(CDKN2A):c.458-15T>A rs772321849
NM_000077.5(CDKN2A):c.458-2A>G rs1587325266
NM_000077.5(CDKN2A):c.458-3C>A
NM_000077.5(CDKN2A):c.458-4G>C rs876660514
NM_000077.5(CDKN2A):c.458-4G>T rs876660514
NM_000077.5(CDKN2A):c.458-5T>C
NM_000077.5(CDKN2A):c.458-8del rs1390306527
NM_000077.5(CDKN2A):c.458-9_458-6dup
NM_000077.5(CDKN2A):c.458A>G (p.Asp153Gly) rs1060501272
NM_000077.5(CDKN2A):c.458A>T (p.Asp153Val) rs1060501272
NM_000077.5(CDKN2A):c.45G>A (p.Trp15Ter) rs138677674
NM_000077.5(CDKN2A):c.45G>T (p.Trp15Cys) rs138677674
NM_000077.5(CDKN2A):c.460del (p.Ile154fs) rs2131079518
NM_000077.5(CDKN2A):c.461T>A (p.Ile154Asn) rs1554653284
NM_000077.5(CDKN2A):c.462C>A (p.Ile154=) rs1554653281
NM_000077.5(CDKN2A):c.462C>T (p.Ile154=) rs1554653281
NM_000077.5(CDKN2A):c.463C>G (p.Pro155Ala) rs1060501271
NM_000077.5(CDKN2A):c.464C>G (p.Pro155Arg) rs1162344499
NM_000077.5(CDKN2A):c.465C>A (p.Pro155=) rs1471079871
NM_000077.5(CDKN2A):c.465C>G (p.Pro155=) rs1471079871
NM_000077.5(CDKN2A):c.465C>T (p.Pro155=) rs1471079871
NM_000077.5(CDKN2A):c.466G>A (p.Asp156Asn) rs755445934
NM_000077.5(CDKN2A):c.466G>T (p.Asp156Tyr) rs755445934
NM_000077.5(CDKN2A):c.470G>A (p.Ter157=) rs1473161353
NM_000077.5(CDKN2A):c.470G>T (p.Ter157Leu)
NM_000077.5(CDKN2A):c.47T>A (p.Leu16Gln) rs864622263
NM_000077.5(CDKN2A):c.47T>C (p.Leu16Pro) rs864622263
NM_000077.5(CDKN2A):c.47T>G (p.Leu16Arg) rs864622263
NM_000077.5(CDKN2A):c.47_50del (p.Leu16fs) rs587782206
NM_000077.5(CDKN2A):c.50C>T (p.Ala17Val) rs751809654
NM_000077.5(CDKN2A):c.51C>G (p.Ala17=) rs764362225
NM_000077.5(CDKN2A):c.51C>T (p.Ala17=) rs764362225
NM_000077.5(CDKN2A):c.52A>G (p.Thr18Ala) rs758455611
NM_000077.5(CDKN2A):c.52_57dup (p.Thr18_Ala19dup) rs1563892769
NM_000077.5(CDKN2A):c.53C>A (p.Thr18Lys) rs560518923
NM_000077.5(CDKN2A):c.53C>T (p.Thr18Met) rs560518923
NM_000077.5(CDKN2A):c.54G>C (p.Thr18=)
NM_000077.5(CDKN2A):c.54G>T (p.Thr18=) rs765702324
NM_000077.5(CDKN2A):c.55G>T (p.Ala19Ser) rs1819957749
NM_000077.5(CDKN2A):c.57C>G (p.Ala19=) rs1060504186
NM_000077.5(CDKN2A):c.58G>A (p.Ala20Thr) rs760065045
NM_000077.5(CDKN2A):c.58G>C (p.Ala20Pro) rs760065045
NM_000077.5(CDKN2A):c.58G>T (p.Ala20Ser) rs760065045
NM_000077.5(CDKN2A):c.59C>A (p.Ala20Glu)
NM_000077.5(CDKN2A):c.59C>G (p.Ala20Gly) rs864622484
NM_000077.5(CDKN2A):c.59C>T (p.Ala20Val) rs864622484
NM_000077.5(CDKN2A):c.60G>A (p.Ala20=)
NM_000077.5(CDKN2A):c.61G>A (p.Ala21Thr) rs1064793082
NM_000077.5(CDKN2A):c.62C>A (p.Ala21Asp) rs1329324238
NM_000077.5(CDKN2A):c.62C>T (p.Ala21Val) rs1329324238
NM_000077.5(CDKN2A):c.64C>G (p.Arg22Gly) rs374921006
NM_000077.5(CDKN2A):c.64C>T (p.Arg22Trp) rs374921006
NM_000077.5(CDKN2A):c.65G>A (p.Arg22Gln) rs1554656491
NM_000077.5(CDKN2A):c.65G>T (p.Arg22Leu) rs1554656491
NM_000077.5(CDKN2A):c.66G>A (p.Arg22=) rs776810546
NM_000077.5(CDKN2A):c.67G>A (p.Gly23Ser) rs1131691186
NM_000077.5(CDKN2A):c.67G>C (p.Gly23Arg) rs1131691186
NM_000077.5(CDKN2A):c.67G>T (p.Gly23Cys) rs1131691186
NM_000077.5(CDKN2A):c.68G>A (p.Gly23Asp) rs1064794292
NM_000077.5(CDKN2A):c.69T>A (p.Gly23=)
NM_000077.5(CDKN2A):c.69del (p.Arg24fs) rs1563892715
NM_000077.5(CDKN2A):c.70C>G (p.Arg24Gly) rs761014328
NM_000077.5(CDKN2A):c.71G>A (p.Arg24Gln) rs104894097
NM_000077.5(CDKN2A):c.71G>T (p.Arg24Leu) rs104894097
NM_000077.5(CDKN2A):c.72G>T (p.Arg24=) rs1449870708
NM_000077.5(CDKN2A):c.73G>A (p.Val25Ile) rs2131113089
NM_000077.5(CDKN2A):c.73G>T (p.Val25Leu) rs2131113089
NM_000077.5(CDKN2A):c.75A>G (p.Val25=) rs980682752
NM_000077.5(CDKN2A):c.76G>T (p.Glu26Ter) rs1317637377
NM_000077.5(CDKN2A):c.77A>C (p.Glu26Ala)
NM_000077.5(CDKN2A):c.79G>T (p.Glu27Ter) rs1554656411
NM_000077.5(CDKN2A):c.80A>G (p.Glu27Gly) rs1554656403
NM_000077.5(CDKN2A):c.81G>A (p.Glu27=) rs1060504184
NM_000077.5(CDKN2A):c.82G>A (p.Val28Met) rs876658895
NM_000077.5(CDKN2A):c.83T>G (p.Val28Gly) rs775176191
NM_000077.5(CDKN2A):c.84G>A (p.Val28=) rs1461154048
NM_000077.5(CDKN2A):c.85C>A (p.Arg29=) rs1554656382
NM_000077.5(CDKN2A):c.85C>T (p.Arg29Trp) rs1554656382
NM_000077.5(CDKN2A):c.86G>A (p.Arg29Gln)
NM_000077.5(CDKN2A):c.86G>C (p.Arg29Pro) rs1819952993
NM_000077.5(CDKN2A):c.86G>T (p.Arg29Leu)
NM_000077.5(CDKN2A):c.87G>C (p.Arg29=) rs540871544
NM_000077.5(CDKN2A):c.89C>T (p.Ala30Val) rs879254078
NM_000077.5(CDKN2A):c.90G>A (p.Ala30=) rs1563892643
NM_000077.5(CDKN2A):c.90G>T (p.Ala30=) rs1563892643
NM_000077.5(CDKN2A):c.91C>T (p.Leu31=) rs1819951961
NM_000077.5(CDKN2A):c.93G>T (p.Leu31=) rs2131112754
NM_000077.5(CDKN2A):c.94C>T (p.Leu32=) rs745827714
NM_000077.5(CDKN2A):c.95T>C (p.Leu32Pro) rs878853650
NM_000077.5(CDKN2A):c.95_112del (p.Leu32_Leu37del) rs1819949737
NM_000077.5(CDKN2A):c.95_112dup (p.Leu32_Leu37dup) rs1819949737
NM_000077.5(CDKN2A):c.96G>A (p.Leu32=) rs2131112692
NM_000077.5(CDKN2A):c.97G>A (p.Glu33Lys)
NM_000077.5(CDKN2A):c.98A>G (p.Glu33Gly)
NM_000077.5(CDKN2A):c.98A>T (p.Glu33Val)
NM_058195.4(CDKN2A):c.102G>A (p.Trp34Ter) rs1820531050
NM_058195.4(CDKN2A):c.103G>C (p.Ala35Pro) rs1473253589
NM_058195.4(CDKN2A):c.104C>T (p.Ala35Val) rs2131148491
NM_058195.4(CDKN2A):c.106G>C (p.Ala36Pro) rs1587358428
NM_058195.4(CDKN2A):c.107C>T (p.Ala36Val) rs1396662899
NM_058195.4(CDKN2A):c.108G>A (p.Ala36=) rs2131148456
NM_058195.4(CDKN2A):c.110C>G (p.Pro37Arg) rs1361441265
NM_058195.4(CDKN2A):c.111A>G (p.Pro37=) rs1039977006
NM_058195.4(CDKN2A):c.111A>T (p.Pro37=) rs1039977006
NM_058195.4(CDKN2A):c.112G>A (p.Gly38Arg) rs1346248530
NM_058195.4(CDKN2A):c.112G>C (p.Gly38Arg) rs1346248530
NM_058195.4(CDKN2A):c.113G>A (p.Gly38Glu) rs1563902798
NM_058195.4(CDKN2A):c.117G>C (p.Ala39=) rs2131148386
NM_058195.4(CDKN2A):c.119C>T (p.Pro40Leu) rs1587358382
NM_058195.4(CDKN2A):c.11G>A (p.Arg4Lys) rs149063626
NM_058195.4(CDKN2A):c.123C>T (p.Ala41=) rs2131148330
NM_058195.4(CDKN2A):c.124G>A (p.Ala42Thr) rs905621048
NM_058195.4(CDKN2A):c.124G>T (p.Ala42Ser) rs905621048
NM_058195.4(CDKN2A):c.126T>G (p.Ala42=) rs759238530
NM_058195.4(CDKN2A):c.126_127insCA (p.Val43fs) rs2131148302
NM_058195.4(CDKN2A):c.127G>C (p.Val43Leu) rs1820529552
NM_058195.4(CDKN2A):c.128T>C (p.Val43Ala) rs2131148286
NM_058195.4(CDKN2A):c.129G>C (p.Val43=) rs776615460
NM_058195.4(CDKN2A):c.12G>A (p.Arg4=) rs2131149058
NM_058195.4(CDKN2A):c.131C>T (p.Ala44Val) rs1261184323
NM_058195.4(CDKN2A):c.133C>A (p.Leu45Ile) rs1554659193
NM_058195.4(CDKN2A):c.133C>G (p.Leu45Val) rs1554659193
NM_058195.4(CDKN2A):c.133del (p.Leu45fs) rs2131148265
NM_058195.4(CDKN2A):c.135C>A (p.Leu45=) rs766676234
NM_058195.4(CDKN2A):c.135C>T (p.Leu45=) rs766676234
NM_058195.4(CDKN2A):c.136G>C (p.Val46Leu) rs786203467
NM_058195.4(CDKN2A):c.138G>A (p.Val46=) rs761002695
NM_058195.4(CDKN2A):c.140T>C (p.Leu47Pro) rs2131148222
NM_058195.4(CDKN2A):c.144G>C (p.Met48Ile) rs1820528469
NM_058195.4(CDKN2A):c.145C>T (p.Leu49=) rs1554659187
NM_058195.4(CDKN2A):c.149T>G (p.Leu50Arg) rs1554659181
NM_058195.4(CDKN2A):c.14T>A (p.Phe5Tyr) rs2131149044
NM_058195.4(CDKN2A):c.14T>C (p.Phe5Ser) rs2131149044
NM_058195.4(CDKN2A):c.153G>A (p.Arg51=) rs773369448
NM_058195.4(CDKN2A):c.154A>G (p.Ser52Gly) rs1587358275
NM_058195.4(CDKN2A):c.158A>G (p.Gln53Arg) rs772048734
NM_058195.4(CDKN2A):c.15C>G (p.Phe5Leu) rs1587358694
NM_058195.4(CDKN2A):c.15C>T (p.Phe5=) rs1587358694
NM_058195.4(CDKN2A):c.15_17del (p.Phe5del) rs1587358674
NM_058195.4(CDKN2A):c.160C>T (p.Arg54Cys) rs896054565
NM_058195.4(CDKN2A):c.163C>G (p.Leu55Val) rs1820527497
NM_058195.4(CDKN2A):c.166G>A (p.Gly56Arg) rs1820527345
NM_058195.4(CDKN2A):c.168G>A (p.Gly56=) rs2131148111
NM_058195.4(CDKN2A):c.170A>G (p.Gln57Arg) rs774711850
NM_058195.4(CDKN2A):c.172C>T (p.Gln58Ter) rs2131148082
NM_058195.4(CDKN2A):c.176C>T (p.Pro59Leu) rs1477583857
NM_058195.4(CDKN2A):c.177G>A (p.Pro59=) rs878853643
NM_058195.4(CDKN2A):c.177G>C (p.Pro59=) rs878853643
NM_058195.4(CDKN2A):c.178C>A (p.Leu60Ile) rs769257927
NM_058195.4(CDKN2A):c.181C>T (p.Pro61Ser) rs1587358229
NM_058195.4(CDKN2A):c.182C>G (p.Pro61Arg) rs1820526529
NM_058195.4(CDKN2A):c.182C>T (p.Pro61Leu) rs1820526529
NM_058195.4(CDKN2A):c.185G>T (p.Arg62Ile) rs1369774700
NM_058195.4(CDKN2A):c.187del (p.Arg63fs) rs1820526139
NM_058195.4(CDKN2A):c.188G>A (p.Arg63Lys) rs780425629
NM_058195.4(CDKN2A):c.188G>T (p.Arg63Ile) rs780425629
NM_058195.4(CDKN2A):c.18G>C (p.Leu6Phe) rs1820537175
NM_058195.4(CDKN2A):c.191C>A (p.Pro64Gln) rs1348413029
NM_058195.4(CDKN2A):c.191C>G (p.Pro64Arg) rs1348413029
NM_058195.4(CDKN2A):c.191C>T (p.Pro64Leu) rs1348413029
NM_058195.4(CDKN2A):c.192A>G (p.Pro64=) rs1554659172
NM_058195.4(CDKN2A):c.192A>T (p.Pro64=) rs1554659172
NM_058195.4(CDKN2A):c.193+10G>C rs2131147888
NM_058195.4(CDKN2A):c.193+10del rs2131147894
NM_058195.4(CDKN2A):c.193+11C>T rs540037788
NM_058195.4(CDKN2A):c.193+17A>C rs778691942
NM_058195.4(CDKN2A):c.193+1G>A rs1060501262
NM_058195.4(CDKN2A):c.193+1del rs1820525500
NM_058195.4(CDKN2A):c.193+20A>G rs2131147849
NM_058195.4(CDKN2A):c.193+2T>C rs2131147945
NM_058195.4(CDKN2A):c.193+3A>C rs2131147939
NM_058195.4(CDKN2A):c.193+4G>A rs2131147933
NM_058195.4(CDKN2A):c.193+5G>A rs587782083
NM_058195.4(CDKN2A):c.193+5_193+16dup rs2131147866
NM_058195.4(CDKN2A):c.193+6A>T rs2131147918
NM_058195.4(CDKN2A):c.193+9G>C rs965897956
NM_058195.4(CDKN2A):c.193G>C (p.Gly65Arg) rs2131147969
NM_058195.4(CDKN2A):c.1A>G (p.Met1Val) rs1820538394
NM_058195.4(CDKN2A):c.20T>C (p.Val7Ala) rs771335991
NM_058195.4(CDKN2A):c.22A>G (p.Thr8Ala) rs1820536864
NM_058195.4(CDKN2A):c.22A>T (p.Thr8Ser) rs1820536864
NM_058195.4(CDKN2A):c.23C>G (p.Thr8Ser) rs1820536698
NM_058195.4(CDKN2A):c.26T>C (p.Leu9Pro) rs876659353
NM_058195.4(CDKN2A):c.27C>G (p.Leu9=) rs1221654243
NM_058195.4(CDKN2A):c.28C>G (p.Arg10Gly) rs1554659242
NM_058195.4(CDKN2A):c.30G>A (p.Arg10=) rs876658436
NM_058195.4(CDKN2A):c.30G>T (p.Arg10=) rs876658436
NM_058195.4(CDKN2A):c.32T>G (p.Ile11Ser) rs1820535713
NM_058195.4(CDKN2A):c.34C>G (p.Arg12Gly) rs1587358659
NM_058195.4(CDKN2A):c.37C>T (p.Arg13Cys) rs1389587108
NM_058195.4(CDKN2A):c.39C>G (p.Arg13=) rs747061582
NM_058195.4(CDKN2A):c.3G>A (p.Met1Ile) rs1820538211
NM_058195.4(CDKN2A):c.3G>C (p.Met1Ile) rs1820538211
NM_058195.4(CDKN2A):c.40G>A (p.Ala14Thr) rs1241364288
NM_058195.4(CDKN2A):c.40G>C (p.Ala14Pro) rs1241364288
NM_058195.4(CDKN2A):c.42G>C (p.Ala14=) rs1288648134
NM_058195.4(CDKN2A):c.42G>T (p.Ala14=) rs1288648134
NM_058195.4(CDKN2A):c.43T>C (p.Cys15Arg) rs1554659236
NM_058195.4(CDKN2A):c.46G>C (p.Gly16Arg) rs773459232
NM_058195.4(CDKN2A):c.47G>T (p.Gly16Val) rs1444669684
NM_058195.4(CDKN2A):c.48C>T (p.Gly16=) rs786202556
NM_058195.4(CDKN2A):c.4G>A (p.Val2Met) rs1820538120
NM_058195.4(CDKN2A):c.4G>T (p.Val2Leu) rs1820538120
NM_058195.4(CDKN2A):c.50C>A (p.Pro17Gln) rs1820534329
NM_058195.4(CDKN2A):c.50C>T (p.Pro17Leu) rs1820534329
NM_058195.4(CDKN2A):c.51G>T (p.Pro17=) rs2131148827
NM_058195.4(CDKN2A):c.53C>A (p.Pro18Gln) rs1587358603
NM_058195.4(CDKN2A):c.53C>G (p.Pro18Arg) rs1587358603
NM_058195.4(CDKN2A):c.53C>T (p.Pro18Leu) rs1587358603
NM_058195.4(CDKN2A):c.54G>A (p.Pro18=) rs1554659233
NM_058195.4(CDKN2A):c.54G>T (p.Pro18=) rs1554659233
NM_058195.4(CDKN2A):c.55C>A (p.Arg19=) rs2131148812
NM_058195.4(CDKN2A):c.55C>T (p.Arg19Ter) rs2131148812
NM_058195.4(CDKN2A):c.56G>A (p.Arg19Gln) rs748616717
NM_058195.4(CDKN2A):c.58del (p.Arg19_Val20insTer) rs1563902931
NM_058195.4(CDKN2A):c.72G>A (p.Val24=) rs2131148725
NM_058195.4(CDKN2A):c.72G>C (p.Val24=) rs2131148725
NM_058195.4(CDKN2A):c.75T>C (p.Val25=) rs1057522328
NM_058195.4(CDKN2A):c.76C>T (p.His26Tyr) rs1820533255
NM_058195.4(CDKN2A):c.78C>T (p.His26=) rs756946306
NM_058195.4(CDKN2A):c.7C>A (p.Arg3Ser) rs1554659249
NM_058195.4(CDKN2A):c.7C>T (p.Arg3Cys) rs1554659249
NM_058195.4(CDKN2A):c.81C>G (p.Ile27Met) rs1413839473
NM_058195.4(CDKN2A):c.81C>T (p.Ile27=) rs1413839473
NM_058195.4(CDKN2A):c.83C>G (p.Pro28Arg) rs1282190742
NM_058195.4(CDKN2A):c.83C>T (p.Pro28Leu) rs1282190742
NM_058195.4(CDKN2A):c.84G>A (p.Pro28=) rs751027808
NM_058195.4(CDKN2A):c.87_99del (p.Leu30fs) rs2131148531
NM_058195.4(CDKN2A):c.88C>T (p.Leu30Phe) rs2131148620
NM_058195.4(CDKN2A):c.8G>A (p.Arg3His) rs1820537912
NM_058195.4(CDKN2A):c.90C>T (p.Leu30=) rs786201711
NM_058195.4(CDKN2A):c.92C>T (p.Thr31Met) rs528789830
NM_058195.4(CDKN2A):c.93G>C (p.Thr31=) rs1330218502
NM_058195.4(CDKN2A):c.94G>C (p.Gly32Arg) rs879254043
NM_058195.4(CDKN2A):c.95G>A (p.Gly32Glu) rs370655358
NM_058195.4(CDKN2A):c.97G>T (p.Glu33Ter) rs1287464120
NM_058195.4(CDKN2A):c.97dup (p.Glu33fs) rs779306249
NM_058195.4(CDKN2A):c.98A>G (p.Glu33Gly) rs1820531368

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.