ClinVar Miner

List of variants in gene NFKB2 reported as likely benign for Immunodeficiency, common variable, 10

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 247
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_001322934.2(NFKB2):c.21+13G>A rs199513883 0.00288
NM_001322934.2(NFKB2):c.2145G>A (p.Ser715=) rs200006038 0.00128
NM_001322934.2(NFKB2):c.2072-3C>T rs201550645 0.00121
NM_001322934.2(NFKB2):c.1736G>A (p.Arg579His) rs200227171 0.00065
NM_001322934.2(NFKB2):c.2113C>G (p.Leu705Val) rs376121715 0.00054
NM_001322934.2(NFKB2):c.2167G>A (p.Asp723Asn) rs199577673 0.00050
NM_001322934.2(NFKB2):c.2249C>T (p.Ala750Val) rs41293042 0.00041
NM_001322934.2(NFKB2):c.2350G>A (p.Gly784Arg) rs367889547 0.00021
NM_001322934.2(NFKB2):c.2676C>T (p.His892=) rs572862942 0.00019
NM_001322934.2(NFKB2):c.1590C>T (p.Pro530=) rs369780227 0.00016
NM_001322934.2(NFKB2):c.2466+19T>C rs978484878 0.00016
NM_001322934.2(NFKB2):c.2349C>T (p.Asp783=) rs762058625 0.00014
NM_001322934.2(NFKB2):c.1560C>T (p.Val520=) rs376651842 0.00010
NM_001322934.2(NFKB2):c.2463C>T (p.Tyr821=) rs540283644 0.00010
NM_001322934.2(NFKB2):c.992-14T>C rs773538044 0.00007
NM_001322934.2(NFKB2):c.1469+19G>A rs1010426394 0.00006
NM_001322934.2(NFKB2):c.1980C>T (p.Asn660=) rs770000992 0.00006
NM_001322934.2(NFKB2):c.2067G>A (p.Lys689=) rs745876650 0.00006
NM_001322934.2(NFKB2):c.2271C>T (p.Pro757=) rs370993988 0.00006
NM_001322934.2(NFKB2):c.2286C>T (p.Ser762=) rs899733509 0.00006
NM_001322934.2(NFKB2):c.9T>C (p.Ser3=) rs748114844 0.00006
NM_001322934.2(NFKB2):c.1380C>A (p.Ala460=) rs751586725 0.00005
NM_001322934.2(NFKB2):c.2139C>T (p.Ser713=) rs371867635 0.00005
NM_001322934.2(NFKB2):c.2169C>T (p.Asp723=) rs777674970 0.00005
NM_001322934.2(NFKB2):c.2224-14G>A rs746048054 0.00005
NM_001322934.2(NFKB2):c.396-16G>A rs368775776 0.00005
NM_001322934.2(NFKB2):c.579C>T (p.Arg193=) rs766437395 0.00005
NM_001322934.2(NFKB2):c.1101C>T (p.Tyr367=) rs771607267 0.00004
NM_001322934.2(NFKB2):c.118C>T (p.Leu40=) rs368708648 0.00004
NM_001322934.2(NFKB2):c.1368C>T (p.Arg456=) rs1368578412 0.00004
NM_001322934.2(NFKB2):c.1470-16G>A rs368440166 0.00004
NM_001322934.2(NFKB2):c.1470-8A>T rs747203380 0.00004
NM_001322934.2(NFKB2):c.1938G>A (p.Glu646=) rs563687760 0.00004
NM_001322934.2(NFKB2):c.216G>A (p.Lys72=) rs369551276 0.00004
NM_001322934.2(NFKB2):c.2223+16G>C rs199772393 0.00004
NM_001322934.2(NFKB2):c.2517C>A (p.Gly839=) rs1232671317 0.00004
NM_001322934.2(NFKB2):c.502+18G>A rs754132804 0.00004
NM_001322934.2(NFKB2):c.522G>T (p.Leu174=) rs374045556 0.00004
NM_001322934.2(NFKB2):c.840T>C (p.Asp280=) rs199585223 0.00004
NM_001322934.2(NFKB2):c.1117+9G>A rs770791475 0.00003
NM_001322934.2(NFKB2):c.1386C>G (p.Leu462=) rs762807587 0.00003
NM_001322934.2(NFKB2):c.1620G>A (p.Thr540=) rs45454603 0.00003
NM_001322934.2(NFKB2):c.255C>T (p.Tyr85=) rs766359206 0.00003
NM_001322934.2(NFKB2):c.2604C>T (p.Tyr868=) rs778242288 0.00003
NM_001322934.2(NFKB2):c.2616A>G (p.Ser872=) rs992741348 0.00003
NM_001322934.2(NFKB2):c.2293+9C>T rs752429321 0.00002
NM_001322934.2(NFKB2):c.2559A>T (p.Arg853=) rs1304804019 0.00002
NM_001322934.2(NFKB2):c.2578+7G>A rs749032341 0.00002
NM_001322934.2(NFKB2):c.2601G>A (p.Ala867=) rs1438477157 0.00002
NM_001322934.2(NFKB2):c.345G>A (p.Ser115=) rs548502111 0.00002
NM_001322934.2(NFKB2):c.502+16G>T rs889117789 0.00002
NM_001322934.2(NFKB2):c.1395C>T (p.Gly465=) rs1196791753 0.00001
NM_001322934.2(NFKB2):c.145-15C>T rs529004645 0.00001
NM_001322934.2(NFKB2):c.145-4T>G rs374924291 0.00001
NM_001322934.2(NFKB2):c.1470-15C>A rs758172818 0.00001
NM_001322934.2(NFKB2):c.1585-16C>G rs1393147833 0.00001
NM_001322934.2(NFKB2):c.1585-17C>T rs375242665 0.00001
NM_001322934.2(NFKB2):c.1701G>A (p.Ala567=) rs772477531 0.00001
NM_001322934.2(NFKB2):c.1776G>A (p.Leu592=) rs571236055 0.00001
NM_001322934.2(NFKB2):c.1799-13C>T rs918533916 0.00001
NM_001322934.2(NFKB2):c.1878G>A (p.Val626=) rs773380243 0.00001
NM_001322934.2(NFKB2):c.1969-10G>A rs747889400 0.00001
NM_001322934.2(NFKB2):c.1969-7C>T rs746920543 0.00001
NM_001322934.2(NFKB2):c.2043G>A (p.Pro681=) rs757196237 0.00001
NM_001322934.2(NFKB2):c.2072-17C>T rs756130328 0.00001
NM_001322934.2(NFKB2):c.21+15C>T rs1318527251 0.00001
NM_001322934.2(NFKB2):c.2148C>T (p.Asp716=) rs367660052 0.00001
NM_001322934.2(NFKB2):c.2196G>A (p.Thr732=) rs369544913 0.00001
NM_001322934.2(NFKB2):c.2298G>A (p.Pro766=) rs375500980 0.00001
NM_001322934.2(NFKB2):c.2302C>T (p.Leu768=) rs1554991897 0.00001
NM_001322934.2(NFKB2):c.2418G>A (p.Thr806=) rs1488705625 0.00001
NM_001322934.2(NFKB2):c.2430A>C (p.Thr810=) rs1589872751 0.00001
NM_001322934.2(NFKB2):c.2467-15C>T rs1176473181 0.00001
NM_001322934.2(NFKB2):c.2518C>T (p.Leu840=) rs765424403 0.00001
NM_001322934.2(NFKB2):c.2556C>T (p.Thr852=) rs1169027638 0.00001
NM_001322934.2(NFKB2):c.273C>T (p.Ile91=) rs762145275 0.00001
NM_001322934.2(NFKB2):c.360C>T (p.Cys120=) rs373367494 0.00001
NM_001322934.2(NFKB2):c.396-5C>T rs373971415 0.00001
NM_001322934.2(NFKB2):c.502+9G>A rs183218508 0.00001
NM_001322934.2(NFKB2):c.549G>A (p.Lys183=) rs367930950 0.00001
NM_001322934.2(NFKB2):c.585T>C (p.Ser195=) rs543351754 0.00001
NM_001322934.2(NFKB2):c.924A>G (p.Gln308=) rs1477050280 0.00001
NC_000010.11:g.102397406CGGGTATGGGTGCAGGGGGTGGGT[3]
NM_001322934.2(NFKB2):c.*76C>T
NM_001322934.2(NFKB2):c.1020G>A (p.Arg340=)
NM_001322934.2(NFKB2):c.1027T>C (p.Leu343=)
NM_001322934.2(NFKB2):c.103+10T>C rs1251667593
NM_001322934.2(NFKB2):c.1035C>T (p.Thr345=)
NM_001322934.2(NFKB2):c.1089A>G (p.Ala363=)
NM_001322934.2(NFKB2):c.1092C>T (p.Ala364=)
NM_001322934.2(NFKB2):c.1110T>C (p.Ala370=)
NM_001322934.2(NFKB2):c.1117+15_1117+17del
NM_001322934.2(NFKB2):c.114C>T (p.Pro38=)
NM_001322934.2(NFKB2):c.1357C>T (p.Leu453=)
NM_001322934.2(NFKB2):c.1368C>A (p.Arg456=) rs1368578412
NM_001322934.2(NFKB2):c.1374C>G (p.Ala458=)
NM_001322934.2(NFKB2):c.1374C>T (p.Ala458=)
NM_001322934.2(NFKB2):c.1380C>T (p.Ala460=)
NM_001322934.2(NFKB2):c.1383A>C (p.Leu461=)
NM_001322934.2(NFKB2):c.1398C>T (p.Val466=) rs1589865966
NM_001322934.2(NFKB2):c.144+17G>C
NM_001322934.2(NFKB2):c.1446G>C (p.Thr482=) rs2135436054
NM_001322934.2(NFKB2):c.145-5T>G rs2135429394
NM_001322934.2(NFKB2):c.1458G>A (p.Glu486=)
NM_001322934.2(NFKB2):c.1461C>T (p.Asn487=)
NM_001322934.2(NFKB2):c.1469+12A>C rs2061192313
NM_001322934.2(NFKB2):c.1469+13G>C rs892036144
NM_001322934.2(NFKB2):c.1470-15C>T
NM_001322934.2(NFKB2):c.1470-17C>G rs1436691362
NM_001322934.2(NFKB2):c.1470-7C>T
NM_001322934.2(NFKB2):c.1476G>A (p.Leu492=)
NM_001322934.2(NFKB2):c.1497G>A (p.Gly499=)
NM_001322934.2(NFKB2):c.1545G>A (p.Gln515=) rs776155769
NM_001322934.2(NFKB2):c.1584+10C>A
NM_001322934.2(NFKB2):c.1584+10C>T rs1371555123
NM_001322934.2(NFKB2):c.1584+20G>A
NM_001322934.2(NFKB2):c.1584+9G>T rs1195678530
NM_001322934.2(NFKB2):c.1585-8A>C rs1589867408
NM_001322934.2(NFKB2):c.1596C>T (p.His532=)
NM_001322934.2(NFKB2):c.159T>C (p.Phe53=) rs753714205
NM_001322934.2(NFKB2):c.1629G>A (p.Val543=) rs2135437613
NM_001322934.2(NFKB2):c.1656C>T (p.Asp552=) rs2135437654
NM_001322934.2(NFKB2):c.1683C>T (p.Asp561=)
NM_001322934.2(NFKB2):c.1713C>T (p.Gly571=)
NM_001322934.2(NFKB2):c.1767G>A (p.Val589=)
NM_001322934.2(NFKB2):c.177C>T (p.Gly59=)
NM_001322934.2(NFKB2):c.1799-10G>A
NM_001322934.2(NFKB2):c.1845C>T (p.Cys615=)
NM_001322934.2(NFKB2):c.1857G>A (p.Leu619=)
NM_001322934.2(NFKB2):c.1890G>A (p.Glu630=)
NM_001322934.2(NFKB2):c.1917T>C (p.His639=)
NM_001322934.2(NFKB2):c.1926A>G (p.Thr642=) rs1309682474
NM_001322934.2(NFKB2):c.1950C>G (p.Val650=)
NM_001322934.2(NFKB2):c.1968+12G>A
NM_001322934.2(NFKB2):c.1968+18G>A rs1438308031
NM_001322934.2(NFKB2):c.1969-10G>T
NM_001322934.2(NFKB2):c.1969-11C>T
NM_001322934.2(NFKB2):c.1969-18C>T
NM_001322934.2(NFKB2):c.1971C>G (p.Leu657=) rs1235585705
NM_001322934.2(NFKB2):c.1977C>A (p.Ala659=)
NM_001322934.2(NFKB2):c.1986C>T (p.Asn662=)
NM_001322934.2(NFKB2):c.198C>T (p.Pro66=) rs778061308
NM_001322934.2(NFKB2):c.2055C>T (p.Arg685=)
NM_001322934.2(NFKB2):c.2071+10del
NM_001322934.2(NFKB2):c.2071+15C>T
NM_001322934.2(NFKB2):c.2071+9C>T
NM_001322934.2(NFKB2):c.2072-11C>A
NM_001322934.2(NFKB2):c.2072-15G>A rs2061235937
NM_001322934.2(NFKB2):c.2072-20T>C
NM_001322934.2(NFKB2):c.21+18C>T
NM_001322934.2(NFKB2):c.2106G>A (p.Leu702=) rs765756267
NM_001322934.2(NFKB2):c.2124C>G (p.Pro708=) rs1461595391
NM_001322934.2(NFKB2):c.2145G>T (p.Ser715=)
NM_001322934.2(NFKB2):c.219C>T (p.Gly73=) rs1468635663
NM_001322934.2(NFKB2):c.2223+13C>T
NM_001322934.2(NFKB2):c.2223+14G>A
NM_001322934.2(NFKB2):c.2223+15G>A
NM_001322934.2(NFKB2):c.2223+18C>T
NM_001322934.2(NFKB2):c.2223+20A>G
NM_001322934.2(NFKB2):c.2224-10del
NM_001322934.2(NFKB2):c.2232C>G (p.Thr744=)
NM_001322934.2(NFKB2):c.2265G>A (p.Glu755=)
NM_001322934.2(NFKB2):c.2293+15G>A rs2135440881
NM_001322934.2(NFKB2):c.2293+19C>T rs2135440888
NM_001322934.2(NFKB2):c.2294-11G>A
NM_001322934.2(NFKB2):c.2294-16T>C
NM_001322934.2(NFKB2):c.2294-18T>C
NM_001322934.2(NFKB2):c.2304G>A (p.Leu768=)
NM_001322934.2(NFKB2):c.231T>C (p.Tyr77=) rs2135429535
NM_001322934.2(NFKB2):c.2332C>T (p.Leu778=)
NM_001322934.2(NFKB2):c.2412A>G (p.Val804=)
NM_001322934.2(NFKB2):c.244-11G>T rs370015116
NM_001322934.2(NFKB2):c.244-5C>T
NM_001322934.2(NFKB2):c.2445C>T (p.Gly815=)
NM_001322934.2(NFKB2):c.2466+11C>A rs2135442112
NM_001322934.2(NFKB2):c.2496G>A (p.Leu832=)
NM_001322934.2(NFKB2):c.2571C>T (p.Pro857=)
NM_001322934.2(NFKB2):c.2578+13C>T
NM_001322934.2(NFKB2):c.2578+9G>A
NM_001322934.2(NFKB2):c.2579-13C>G
NM_001322934.2(NFKB2):c.2579-6C>T
NM_001322934.2(NFKB2):c.2598T>C (p.Ser866=)
NM_001322934.2(NFKB2):c.2601G>C (p.Ala867=) rs1438477157
NM_001322934.2(NFKB2):c.2652T>C (p.Pro884=)
NM_001322934.2(NFKB2):c.2682C>T (p.His894=) rs1393546647
NM_001322934.2(NFKB2):c.279G>A (p.Val93=) rs1313856840
NM_001322934.2(NFKB2):c.285G>C (p.Leu95=)
NM_001322934.2(NFKB2):c.315T>C (p.His105=)
NM_001322934.2(NFKB2):c.321C>T (p.His107=) rs1327128300
NM_001322934.2(NFKB2):c.325C>T (p.Leu109=) rs118178925
NM_001322934.2(NFKB2):c.357C>A (p.Ile119=) rs747137315
NM_001322934.2(NFKB2):c.395+10C>T
NM_001322934.2(NFKB2):c.395+15C>A
NM_001322934.2(NFKB2):c.395+15C>G
NM_001322934.2(NFKB2):c.395+15C>T rs747767183
NM_001322934.2(NFKB2):c.395+16G>A
NM_001322934.2(NFKB2):c.396-19T>G rs1318736194
NM_001322934.2(NFKB2):c.396-7_396-6del
NM_001322934.2(NFKB2):c.396-9T>C
NM_001322934.2(NFKB2):c.402C>T (p.Asn134=) rs1815693368
NM_001322934.2(NFKB2):c.415C>T (p.Leu139=)
NM_001322934.2(NFKB2):c.420T>C (p.His140=) rs2135430349
NM_001322934.2(NFKB2):c.471G>A (p.Gln157=)
NM_001322934.2(NFKB2):c.472C>A (p.Arg158=)
NM_001322934.2(NFKB2):c.474G>C (p.Arg158=)
NM_001322934.2(NFKB2):c.498T>C (p.Leu166=)
NM_001322934.2(NFKB2):c.502+11A>G
NM_001322934.2(NFKB2):c.502+15G>A
NM_001322934.2(NFKB2):c.502+20G>A
NM_001322934.2(NFKB2):c.503-15G>A
NM_001322934.2(NFKB2):c.503-5C>T
NM_001322934.2(NFKB2):c.507C>T (p.Ala169=) rs769444840
NM_001322934.2(NFKB2):c.541C>T (p.Leu181=) rs1362312596
NM_001322934.2(NFKB2):c.573G>C (p.Arg191=)
NM_001322934.2(NFKB2):c.576G>A (p.Leu192=) rs2135431070
NM_001322934.2(NFKB2):c.588C>T (p.Ala196=) rs2061140684
NM_001322934.2(NFKB2):c.609C>T (p.Gly203=)
NM_001322934.2(NFKB2):c.633A>G (p.Pro211=)
NM_001322934.2(NFKB2):c.645G>A (p.Gln215=)
NM_001322934.2(NFKB2):c.766+10G>A rs2135431906
NM_001322934.2(NFKB2):c.766+12G>A
NM_001322934.2(NFKB2):c.766+15C>T
NM_001322934.2(NFKB2):c.766+20T>C
NM_001322934.2(NFKB2):c.766+8T>G
NM_001322934.2(NFKB2):c.767-14C>T
NM_001322934.2(NFKB2):c.767-6T>C
NM_001322934.2(NFKB2):c.767-7C>G rs1001922617
NM_001322934.2(NFKB2):c.767-7C>T rs1001922617
NM_001322934.2(NFKB2):c.767-8C>T
NM_001322934.2(NFKB2):c.852+12T>C
NM_001322934.2(NFKB2):c.852+13A>C
NM_001322934.2(NFKB2):c.852+18C>G
NM_001322934.2(NFKB2):c.852+19C>A rs769240579
NM_001322934.2(NFKB2):c.852+19C>G
NM_001322934.2(NFKB2):c.852+19C>T rs769240579
NM_001322934.2(NFKB2):c.852+20G>A
NM_001322934.2(NFKB2):c.852+24_852+29del
NM_001322934.2(NFKB2):c.852+9G>A
NM_001322934.2(NFKB2):c.853-11G>A
NM_001322934.2(NFKB2):c.853-14C>T
NM_001322934.2(NFKB2):c.853-15C>A rs1298584675
NM_001322934.2(NFKB2):c.853-19G>A
NM_001322934.2(NFKB2):c.853-8C>T
NM_001322934.2(NFKB2):c.885C>T (p.His295=) rs1458951523
NM_001322934.2(NFKB2):c.991+14G>A
NM_001322934.2(NFKB2):c.992-12C>G
NM_001322934.2(NFKB2):c.992-5C>T rs1589863248

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.