ClinVar Miner

List of variants reported as likely pathogenic for Stargardt disease 1

Minimum submission review status: Collection method:
Minimum conflict level:
ClinVar version:
Total variants: 194
Download table as spreadsheet
NM_000350.2(ABCA4):c.2588G>C rs76157638
NM_000350.2(ABCA4):c.5882G>A rs1800553
NM_000350.3(ABCA4):c.1335C>G (p.Ser445Arg) rs61748552
NM_000350.3(ABCA4):c.1357-2A>G rs886044726
NM_000350.3(ABCA4):c.1532G>A (p.Arg511His) rs140482171
NM_000350.3(ABCA4):c.1609C>T (p.Arg537Cys) rs61748556
NM_000350.3(ABCA4):c.160T>G (p.Cys54Gly) rs886044720
NM_000350.3(ABCA4):c.161G>A (p.Cys54Tyr) rs150774447
NM_000350.3(ABCA4):c.1621_1622del (p.Leu541fs) rs1553192715
NM_000350.3(ABCA4):c.1622T>C (p.Leu541Pro) rs61751392
NM_000350.3(ABCA4):c.1654G>A (p.Val552Ile) rs145525174
NM_000350.3(ABCA4):c.1715G>A (p.Arg572Gln) rs61748559
NM_000350.3(ABCA4):c.1719G>A (p.Met573Ile) rs886044728
NM_000350.3(ABCA4):c.1742C>A (p.Thr581Asn)
NM_000350.3(ABCA4):c.1789C>T (p.Pro597Ser) rs61751393
NM_000350.3(ABCA4):c.179C>T (p.Ala60Val) rs55732384
NM_000350.3(ABCA4):c.1819G>A (p.Gly607Arg) rs61749412
NM_000350.3(ABCA4):c.1822T>A (p.Phe608Ile) rs61752398
NM_000350.3(ABCA4):c.1846G>A (p.Glu616Lys) rs1557787473
NM_000350.3(ABCA4):c.184C>T (p.Pro62Ser)
NM_000350.3(ABCA4):c.1891G>A (p.Gly631Arg) rs886044730
NM_000350.3(ABCA4):c.1903C>T (p.Gln635Ter) rs61749414
NM_000350.3(ABCA4):c.1918C>G (p.Pro640Ala) rs766570903
NM_000350.3(ABCA4):c.1928T>G (p.Val643Gly) rs61754024
NM_000350.3(ABCA4):c.194G>A (p.Gly65Glu) rs62654395
NM_000350.3(ABCA4):c.1957C>T (p.Arg653Cys) rs61749420
NM_000350.3(ABCA4):c.1964T>G (p.Phe655Cys) rs200692438
NM_000350.3(ABCA4):c.1A>G (p.Met1Val) rs201738997
NM_000350.3(ABCA4):c.2005_2006del (p.Met669fs) rs61749422
NM_000350.3(ABCA4):c.2023G>A (p.Val675Ile) rs575453437
NM_000350.3(ABCA4):c.203C>G (p.Pro68Arg) rs62654397
NM_000350.3(ABCA4):c.2041C>T (p.Arg681Ter) rs61749423
NM_000350.3(ABCA4):c.214G>A (p.Gly72Arg) rs61751412
NM_000350.3(ABCA4):c.223T>G (p.Cys75Gly) rs61748526
NM_000350.3(ABCA4):c.2291G>A (p.Cys764Tyr) rs61749428
NM_000350.3(ABCA4):c.2401G>A (p.Ala801Thr) rs374410829
NM_000350.3(ABCA4):c.247_250dup (p.Ser84fs)
NM_000350.3(ABCA4):c.2537A>G (p.Asp846Gly) rs779466403
NM_000350.3(ABCA4):c.2560G>A (p.Ala854Thr) rs61749437
NM_000350.3(ABCA4):c.2609C>T (p.Pro870Leu) rs746566873
NM_000350.3(ABCA4):c.2690C>T (p.Thr897Ile) rs61749440
NM_000350.3(ABCA4):c.2875A>G (p.Thr959Ala) rs368846708
NM_000350.3(ABCA4):c.2932G>A (p.Gly978Ser)
NM_000350.3(ABCA4):c.2947A>G (p.Thr983Ala)
NM_000350.3(ABCA4):c.2966T>C (p.Val989Ala) rs61749454
NM_000350.3(ABCA4):c.3016G>C (p.Gly1006Arg)
NM_000350.3(ABCA4):c.3064G>A (p.Glu1022Lys) rs61749459
NM_000350.3(ABCA4):c.3113C>T (p.Ala1038Val) rs61751374
NM_000350.3(ABCA4):c.3179A>C (p.Gln1060Pro)
NM_000350.3(ABCA4):c.3210_3211dup (p.Ser1071fs) rs387906385
NM_000350.3(ABCA4):c.3261A>C (p.Glu1087Asp) rs61752416
NM_000350.3(ABCA4):c.3272G>A (p.Gly1091Glu) rs61752417
NM_000350.3(ABCA4):c.3292C>T (p.Arg1098Cys) rs756840095
NM_000350.3(ABCA4):c.3322C>T (p.Arg1108Cys) rs61750120
NM_000350.3(ABCA4):c.3323G>T (p.Arg1108Leu) rs61750121
NM_000350.3(ABCA4):c.3323del (p.Arg1108fs)
NM_000350.3(ABCA4):c.3364G>A (p.Glu1122Lys) rs61751399
NM_000350.3(ABCA4):c.3377T>C (p.Leu1126Pro) rs1047376
NM_000350.3(ABCA4):c.3385C>G (p.Arg1129Gly) rs779426136
NM_000350.3(ABCA4):c.3386G>T (p.Arg1129Leu) rs1801269
NM_000350.3(ABCA4):c.3482G>A (p.Arg1161His) rs768278935
NM_000350.3(ABCA4):c.3602T>G (p.Leu1201Arg) rs61750126
NM_000350.3(ABCA4):c.3758C>T (p.Thr1253Met) rs61752424
NM_000350.3(ABCA4):c.3815T>C (p.Ile1272Thr) rs886044738
NM_000350.3(ABCA4):c.4129-1G>A rs1553189507
NM_000350.3(ABCA4):c.4139C>T (p.Pro1380Leu) rs61750130
NM_000350.3(ABCA4):c.4195G>A (p.Glu1399Lys) rs62642573
NM_000350.3(ABCA4):c.4253+43G>A rs104894321
NM_000350.3(ABCA4):c.4253+5G>T rs61750138
NM_000350.3(ABCA4):c.428del (p.Pro143fs)
NM_000350.3(ABCA4):c.4297G>A (p.Val1433Ile) rs56357060
NM_000350.3(ABCA4):c.4319T>C (p.Phe1440Ser) rs61750141
NM_000350.3(ABCA4):c.4328G>A (p.Arg1443His) rs61750142
NM_000350.3(ABCA4):c.4347G>T (p.Trp1449Cys) rs886044741
NM_000350.3(ABCA4):c.4352+1G>A rs200967229
NM_000350.3(ABCA4):c.4363T>C (p.Cys1455Arg) rs758835368
NM_000350.3(ABCA4):c.4383G>C (p.Trp1461Cys)
NM_000350.3(ABCA4):c.4457C>T (p.Pro1486Leu) rs61750145
NM_000350.3(ABCA4):c.4462T>C (p.Cys1488Arg) rs61750146
NM_000350.3(ABCA4):c.4463G>A (p.Cys1488Tyr) rs61750147
NM_000350.3(ABCA4):c.4469G>A (p.Cys1490Tyr) rs61751402
NM_000350.3(ABCA4):c.4519G>A (p.Gly1507Arg) rs568792949
NM_000350.3(ABCA4):c.4537dup (p.Gln1513fs) rs281865377
NM_000350.3(ABCA4):c.4538A>G (p.Gln1513Arg) rs281865402
NM_000350.3(ABCA4):c.4539+2001G>A rs1457937638
NM_000350.3(ABCA4):c.4539+2064C>T rs1553189179
NM_000350.3(ABCA4):c.454C>T (p.Arg152Ter) rs62646861
NM_000350.3(ABCA4):c.455G>A (p.Arg152Gln) rs62646862
NM_000350.3(ABCA4):c.4577C>T (p.Thr1526Met) rs61750152
NM_000350.3(ABCA4):c.4594G>A (p.Asp1532Asn) rs62642574
NM_000350.3(ABCA4):c.4609del (p.Thr1537fs)
NM_000350.3(ABCA4):c.4727T>G (p.Leu1576Arg) rs1553188682
NM_000350.3(ABCA4):c.4739T>C (p.Leu1580Ser) rs777415466
NM_000350.3(ABCA4):c.4748T>C (p.Leu1583Pro) rs61750153
NM_000350.3(ABCA4):c.4771G>A (p.Gly1591Arg) rs113106943
NM_000350.3(ABCA4):c.4793C>A (p.Ala1598Asp) rs61750155
NM_000350.3(ABCA4):c.4918C>T (p.Arg1640Trp) rs61751404
NM_000350.3(ABCA4):c.4919G>A (p.Arg1640Gln) rs61751403
NM_000350.3(ABCA4):c.4926C>G (p.Ser1642Arg) rs61753017
NM_000350.3(ABCA4):c.4958G>A (p.Gly1653Glu)
NM_000350.3(ABCA4):c.4978C>T (p.Pro1660Ser)
NM_000350.3(ABCA4):c.4979C>T (p.Pro1660Leu) rs886044746
NM_000350.3(ABCA4):c.5018+2T>C rs61750562
NM_000350.3(ABCA4):c.5065T>C (p.Ser1689Pro) rs61753020
NM_000350.3(ABCA4):c.5087G>A (p.Ser1696Asn) rs61750564
NM_000350.3(ABCA4):c.5088C>G (p.Ser1696Arg) rs1435203678
NM_000350.3(ABCA4):c.5114G>T (p.Arg1705Leu) rs61753021
NM_000350.3(ABCA4):c.5137C>A (p.Gln1713Lys) rs374343397
NM_000350.3(ABCA4):c.514G>A (p.Gly172Ser) rs61748532
NM_000350.3(ABCA4):c.5172G>A (p.Trp1724Ter) rs1557767754
NM_000350.3(ABCA4):c.5196+1056A>G rs886044749
NM_000350.3(ABCA4):c.5196+1137G>A rs778234759
NM_000350.3(ABCA4):c.5196+2T>C rs61751405
NM_000350.3(ABCA4):c.5288T>C (p.Leu1763Pro) rs61753028
NM_000350.3(ABCA4):c.52C>T (p.Arg18Trp) rs121909205
NM_000350.3(ABCA4):c.5311G>A (p.Gly1771Arg)
NM_000350.3(ABCA4):c.5316G>A (p.Trp1772Ter) rs61750571
NM_000350.3(ABCA4):c.5318C>T (p.Ala1773Val) rs760549861
NM_000350.3(ABCA4):c.5329A>T (p.Met1777Leu)
NM_000350.3(ABCA4):c.5363C>T (p.Pro1788Leu) rs886044751
NM_000350.3(ABCA4):c.5377G>A (p.Val1793Met)
NM_000350.3(ABCA4):c.5381C>A (p.Ala1794Asp) rs61751406
NM_000350.3(ABCA4):c.5413A>G (p.Asn1805Asp) rs61753029
NM_000350.3(ABCA4):c.5461-10T>C rs1800728
NM_000350.3(ABCA4):c.5463G>A (p.Thr1821=) rs367857935
NM_000350.3(ABCA4):c.5512C>A (p.His1838Asn) rs62642562
NM_000350.3(ABCA4):c.5512C>G (p.His1838Asp) rs62642562
NM_000350.3(ABCA4):c.5513A>G (p.His1838Arg) rs886044752
NM_000350.3(ABCA4):c.5516T>C (p.Phe1839Ser) rs1297857869
NM_000350.3(ABCA4):c.5549T>C (p.Leu1850Pro) rs377311148
NM_000350.3(ABCA4):c.5558C>A (p.Ala1853Asp) rs886044753
NM_000350.3(ABCA4):c.5603A>T (p.Asn1868Ile) rs1801466
NM_000350.3(ABCA4):c.5606C>T (p.Pro1869Leu) rs376925793
NM_000350.3(ABCA4):c.5656G>A (p.Gly1886Arg) rs886044754
NM_000350.3(ABCA4):c.5690_5704del (p.Gln1897_Phe1901del)
NM_000350.3(ABCA4):c.5691G>T (p.Gln1897His)
NM_000350.3(ABCA4):c.5693G>A (p.Arg1898His) rs1800552
NM_000350.3(ABCA4):c.5714+1G>T rs1232476760
NM_000350.3(ABCA4):c.5714+5G>A rs61751407
NM_000350.3(ABCA4):c.5762_5763del (p.Val1921fs)
NM_000350.3(ABCA4):c.5828T>C (p.Leu1943Pro) rs886044755
NM_000350.3(ABCA4):c.5881G>A (p.Gly1961Arg) rs142253670
NM_000350.3(ABCA4):c.5908C>T (p.Leu1970Phe) rs28938473
NM_000350.3(ABCA4):c.5909T>C (p.Leu1970Pro) rs886044756
NM_000350.3(ABCA4):c.5924G>T (p.Gly1975Val)
NM_000350.3(ABCA4):c.5936C>T (p.Thr1979Ile) rs61753037
NM_000350.3(ABCA4):c.5942C>G (p.Thr1981Arg) rs752147871
NM_000350.3(ABCA4):c.6077T>C (p.Leu2026Pro) rs886044758
NM_000350.3(ABCA4):c.6079C>T (p.Leu2027Phe) rs61751408
NM_000350.3(ABCA4):c.6088C>T (p.Arg2030Ter) rs61751383
NM_000350.3(ABCA4):c.6089G>A (p.Arg2030Gln) rs61750641
NM_000350.3(ABCA4):c.6098T>C (p.Leu2033Pro) rs1553186896
NM_000350.3(ABCA4):c.6113G>C (p.Arg2038Pro) rs767729255
NM_000350.3(ABCA4):c.6119G>A (p.Arg2040Gln) rs148460146
NM_000350.3(ABCA4):c.6122G>A (p.Gly2041Asp)
NM_000350.3(ABCA4):c.6148G>C (p.Val2050Leu) rs41292677
NM_000350.3(ABCA4):c.61C>T (p.Gln21Ter)
NM_000350.3(ABCA4):c.6229C>T (p.Arg2077Trp) rs61750645
NM_000350.3(ABCA4):c.6230G>A (p.Arg2077Gln) rs886044759
NM_000350.3(ABCA4):c.6238_6239del (p.Ser2080fs) rs281865382
NM_000350.3(ABCA4):c.6308C>A (p.Pro2103His)
NM_000350.3(ABCA4):c.6316C>T (p.Arg2106Cys) rs61750648
NM_000350.3(ABCA4):c.6320G>A (p.Arg2107His) rs62642564
NM_000350.3(ABCA4):c.6323_6331delinsGGC (p.Met2108_Asn2111delinsArgHis)
NM_000350.3(ABCA4):c.6326T>C (p.Leu2109Pro) rs886044761
NM_000350.3(ABCA4):c.6342G>A (p.Val2114=) rs61748520
NM_000350.3(ABCA4):c.634C>T (p.Arg212Cys) rs61750200
NM_000350.3(ABCA4):c.6428T>A (p.Met2143Lys)
NM_000350.3(ABCA4):c.6449G>A (p.Cys2150Tyr) rs61751384
NM_000350.3(ABCA4):c.6515A>G (p.Lys2172Arg) rs886044762
NM_000350.3(ABCA4):c.656G>C (p.Arg219Thr) rs61748537
NM_000350.3(ABCA4):c.6713A>G (p.Gln2238Arg) rs886044764
NM_000350.3(ABCA4):c.6731T>A (p.Val2244Glu)
NM_000350.3(ABCA4):c.676C>A (p.Arg226Ser)
NM_000350.3(ABCA4):c.768G>T (p.Val256=) rs62645944
NM_000350.3(ABCA4):c.86T>G (p.Leu29Arg) rs886044719
NM_019098.5(CNGB3):c.2158CAAAAAGAAAATGAAGATAAA[1] (p.720QKENEDK[1]) rs746549330
NM_152778.3(MFSD8):c.1361T>C (p.Met454Thr) rs559155109
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.