ClinVar Miner

List of variants in gene USH1C reported as not provided for Usher syndrome type 1

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 3
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_153676.4(USH1C):c.216G>A (p.Val72=) rs151045328 0.00002
NM_153676.4(USH1C):c.238dup (p.Arg80fs) rs397515359
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] rs55983148

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.