List of variants reported as benign for ZTTK syndrome by Genome-Nilou Lab

Minimum submission review status:		Collection method:
Minimum conflict level: Report conflict between different conditions
Show significances as they were submitted (without aggregation into standard terms)
		ClinVar version:

Total variants: 9

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_138927.4(SON):c.7236dup (p.Ala2413fs)	rs34377180	0.99998
NM_138927.4(SON):c.7248del (p.Arg2416fs)	rs34373121	0.99997
NM_138927.4(SON):c.3605C>T (p.Ser1202Leu)	rs13433428	0.99978
NM_138927.4(SON):c.4723C>T (p.Arg1575Cys)	rs13047599	0.70679
NM_138927.4(SON):c.6993T>C (p.Asn2331=)	rs3174808	0.30037
NM_138927.4(SON):c.6161-40T>C	rs2070389	0.22685
NM_138927.4(SON):c.2706T>C (p.Asp902=)	rs16990760	0.21862
NM_138927.4(SON):c.4152G>A (p.Leu1384=)	rs61739710	0.21234
NM_138927.4(SON):c.5868CAGCCGCACCCCCAGCCGCCG[3] (p.1957SRTPSRR[5])	rs1462103775

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.