ClinVar Miner

List of variants in gene ACADVL studied for Very long chain acyl-CoA dehydrogenase deficiency

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 292
Download table as spreadsheet
HGVS dbSNP
ACADVL, 105-BP DEL
NM_000018.2(ACADVL):c.1182+1G>A rs113690956
NM_000018.3(ACADVL):c.*32T>G rs886053376
NM_000018.3(ACADVL):c.*53C>T rs535274747
NM_000018.3(ACADVL):c.*8delC rs398123078
NM_000018.3(ACADVL):c.1001T>G (p.Met334Arg) rs398123079
NM_000018.3(ACADVL):c.1005C>A (p.His335Gln) rs753624994
NM_000018.3(ACADVL):c.1007_1026delTCCTCAACAATGGAAGGTTT (p.Ile336Argfs)
NM_000018.3(ACADVL):c.1009C>T (p.Leu337Phe)
NM_000018.3(ACADVL):c.1009_1011delCTC (p.Leu337del) rs1315330884
NM_000018.3(ACADVL):c.1037C>T (p.Ala346Val)
NM_000018.3(ACADVL):c.103_112delCCTGCCCGGC (p.Pro35Glyfs) rs1329022268
NM_000018.3(ACADVL):c.1043_1065dup (p.Ile356Trpfs) rs1555528508
NM_000018.3(ACADVL):c.104delC (p.Pro35Leufs) rs1443151475
NM_000018.3(ACADVL):c.1065_1067delCAT (p.Ile356del) rs754325237
NM_000018.3(ACADVL):c.1066A>G (p.Ile356Val) rs150140386
NM_000018.3(ACADVL):c.1076C>T (p.Ala359Val) rs539029862
NM_000018.3(ACADVL):c.1077+1G>A rs140989450
NM_000018.3(ACADVL):c.1077+2T>C rs1057516370
NM_000018.3(ACADVL):c.1077G>A (p.Ala359=) rs779458466
NM_000018.3(ACADVL):c.1096C>T (p.Arg366Cys) rs771874163
NM_000018.3(ACADVL):c.109C>T (p.Arg37Trp) rs536992268
NM_000018.3(ACADVL):c.1113delG (p.Ile373Phefs) rs1057517416
NM_000018.3(ACADVL):c.1141_1143delGAG (p.Glu381del) rs1057517281
NM_000018.3(ACADVL):c.1144A>C (p.Lys382Gln) rs118204015
NM_000018.3(ACADVL):c.1153C>T (p.Arg385Trp) rs745832866
NM_000018.3(ACADVL):c.1182+2T>C rs1555528635
NM_000018.3(ACADVL):c.1183-1G>A rs1057516818
NM_000018.3(ACADVL):c.1183-2dup rs1555528721
NM_000018.3(ACADVL):c.1183-7A>G
NM_000018.3(ACADVL):c.1198G>A (p.Val400Met) rs149116708
NM_000018.3(ACADVL):c.1217A>C (p.Gln406Pro)
NM_000018.3(ACADVL):c.121G>A (p.Ala41Thr)
NM_000018.3(ACADVL):c.1220G>C (p.Gly407Ala) rs904631654
NM_000018.3(ACADVL):c.1239A>G (p.Ile413Met) rs143172658
NM_000018.3(ACADVL):c.1246G>A (p.Ala416Thr) rs118204018
NM_000018.3(ACADVL):c.1246G>T (p.Ala416Ser) rs118204018
NM_000018.3(ACADVL):c.1253G>A (p.Ser418Asn) rs1555528737
NM_000018.3(ACADVL):c.1268C>T (p.Ser423Leu)
NM_000018.3(ACADVL):c.1269+10C>T rs1555528738
NM_000018.3(ACADVL):c.1269+1G>A rs773401248
NM_000018.3(ACADVL):c.1269G>A (p.Ser423=)
NM_000018.3(ACADVL):c.1270-38A>G rs1555528742
NM_000018.3(ACADVL):c.1273G>A (p.Ala425Thr) rs138834083
NM_000018.3(ACADVL):c.1280G>A (p.Trp427Ter) rs1057516519
NM_000018.3(ACADVL):c.1283delA (p.Lys428Argfs) rs1555528745
NM_000018.3(ACADVL):c.1284G>A (p.Lys428=) rs35501596
NM_000018.3(ACADVL):c.128G>A (p.Gly43Asp) rs2230178
NM_000018.3(ACADVL):c.1291G>C (p.Asp431His)
NM_000018.3(ACADVL):c.1297T>C (p.Cys433Arg) rs886053374
NM_000018.3(ACADVL):c.1313G>A (p.Gly438Glu) rs748450834
NM_000018.3(ACADVL):c.1322G>A (p.Gly441Asp) rs2309689
NM_000018.3(ACADVL):c.1332+27C>T rs200161683
NM_000018.3(ACADVL):c.1333-25T>C rs770876053
NM_000018.3(ACADVL):c.1333-2A>T rs1057517280
NM_000018.3(ACADVL):c.1333-7G>T rs1228196483
NM_000018.3(ACADVL):c.1340G>A (p.Gly447Glu) rs1555528779
NM_000018.3(ACADVL):c.1355dupT (p.Arg453Profs) rs1057517331
NM_000018.3(ACADVL):c.1357C>T (p.Arg453Ter) rs794727113
NM_000018.3(ACADVL):c.1360G>A (p.Asp454Asn) rs1419606204
NM_000018.3(ACADVL):c.1366C>T (p.Arg456Cys) rs794727111
NM_000018.3(ACADVL):c.1367G>A (p.Arg456His) rs794727112
NM_000018.3(ACADVL):c.1372T>C (p.Phe458Leu) rs118204017
NM_000018.3(ACADVL):c.1375dup rs796051916
NM_000018.3(ACADVL):c.1376G>C (p.Arg459Pro) rs751995154
NM_000018.3(ACADVL):c.138+1G>A rs747351687
NM_000018.3(ACADVL):c.138+2T>C rs1057516817
NM_000018.3(ACADVL):c.138+2dup rs1555527548
NM_000018.3(ACADVL):c.139-3C>T rs1555527630
NM_000018.3(ACADVL):c.1391C>T (p.Thr464Ile) rs1555528796
NM_000018.3(ACADVL):c.1406G>A (p.Arg469Gln) rs398123083
NM_000018.3(ACADVL):c.1430G>A (p.Cys477Tyr) rs1555528803
NM_000018.3(ACADVL):c.1434+14T>A rs202217537
NM_000018.3(ACADVL):c.1434+23G>A rs759991740
NM_000018.3(ACADVL):c.1434+24G>A rs1555528806
NM_000018.3(ACADVL):c.1434+27G>A rs1271483942
NM_000018.3(ACADVL):c.1434+2T>G rs1555528804
NM_000018.3(ACADVL):c.1434+38G>C rs763704056
NM_000018.3(ACADVL):c.1452C>T (p.Leu484=) rs1555528820
NM_000018.3(ACADVL):c.1468G>C (p.Ala490Pro) rs759775666
NM_000018.3(ACADVL):c.1473A>G (p.Leu491=) rs150518187
NM_000018.3(ACADVL):c.1496G>C (p.Gly499Ala)
NM_000018.3(ACADVL):c.1504C>G (p.Leu502Val) rs779901247
NM_000018.3(ACADVL):c.1532+10G>A rs775913504
NM_000018.3(ACADVL):c.1532+11G>A rs372900326
NM_000018.3(ACADVL):c.1532+2T>C rs111851815
NM_000018.3(ACADVL):c.1532+7T>A rs534469222
NM_000018.3(ACADVL):c.1532+7T>C rs534469222
NM_000018.3(ACADVL):c.1532G>A (p.Arg511Gln) rs200771970
NM_000018.3(ACADVL):c.1532G>C (p.Arg511Pro) rs200771970
NM_000018.3(ACADVL):c.1533-4T>A rs369986567
NM_000018.3(ACADVL):c.1567G>A (p.Gly523Arg) rs139425622
NM_000018.3(ACADVL):c.1581G>A (p.Pro527=) rs149436747
NM_000018.3(ACADVL):c.1591_1592insG (p.Ser532Glufs) rs1060499596
NM_000018.3(ACADVL):c.1600G>A (p.Glu534Lys) rs2230180
NM_000018.3(ACADVL):c.1605+22A>G rs1052646012
NM_000018.3(ACADVL):c.1605+6T>C rs17671352
NM_000018.3(ACADVL):c.1606-1G>A rs1057517386
NM_000018.3(ACADVL):c.1606-28G>A rs773931227
NM_000018.3(ACADVL):c.1606-2A>C rs113467582
NM_000018.3(ACADVL):c.1606-36G>A rs890862631
NM_000018.3(ACADVL):c.1606-42C>G rs372357967
NM_000018.3(ACADVL):c.1606-42C>T rs372357967
NM_000018.3(ACADVL):c.1613G>A (p.Arg538Gln) rs201350598
NM_000018.3(ACADVL):c.1617T>C (p.Ala539=) rs1555528948
NM_000018.3(ACADVL):c.1657A>C (p.Lys553Gln) rs1555528957
NM_000018.3(ACADVL):c.1678+15C>T rs371402802
NM_000018.3(ACADVL):c.1678+22C>T rs761650394
NM_000018.3(ACADVL):c.1678+23C>T rs147546456
NM_000018.3(ACADVL):c.1678+24G>A rs751665756
NM_000018.3(ACADVL):c.1678+27C>A rs759729168
NM_000018.3(ACADVL):c.1678+39C>G rs377062362
NM_000018.3(ACADVL):c.1679-34C>T rs779439503
NM_000018.3(ACADVL):c.1679-5delG rs1555528999
NM_000018.3(ACADVL):c.1679-6G>A rs113994171
NM_000018.3(ACADVL):c.1714dup (p.Ala572Glyfs) rs1555529004
NM_000018.3(ACADVL):c.1748C>G (p.Ser583Trp) rs1085307648
NM_000018.3(ACADVL):c.1748C>T (p.Ser583Leu) rs1085307648
NM_000018.3(ACADVL):c.1751+18G>A rs528002997
NM_000018.3(ACADVL):c.1751+30C>T rs757837505
NM_000018.3(ACADVL):c.1751+46C>G rs375203448
NM_000018.3(ACADVL):c.1752-23T>C rs368009800
NM_000018.3(ACADVL):c.1752-2delA rs1555529044
NM_000018.3(ACADVL):c.1752-32_1752-31delCA rs758750087
NM_000018.3(ACADVL):c.1752-33C>T rs760851448
NM_000018.3(ACADVL):c.1752-36G>A rs200709964
NM_000018.3(ACADVL):c.1754C>T (p.Ala585Val) rs374729641
NM_000018.3(ACADVL):c.1765delC (p.Leu589Terfs) rs1057516226
NM_000018.3(ACADVL):c.1766T>C (p.Leu589Pro)
NM_000018.3(ACADVL):c.1770_1773delTGAG (p.Ser590Argfs) rs1555529048
NM_000018.3(ACADVL):c.1806_1807delCT (p.Cys603Terfs) rs796051917
NM_000018.3(ACADVL):c.180G>C (p.Leu60=) rs886053372
NM_000018.3(ACADVL):c.1820G>C (p.Cys607Ser) rs200117742
NM_000018.3(ACADVL):c.1824C>T (p.Ile608=) rs146115467
NM_000018.3(ACADVL):c.1825G>A (p.Glu609Lys) rs398123086
NM_000018.3(ACADVL):c.1828-4C>G rs184559206
NM_000018.3(ACADVL):c.1835C>G (p.Ala612Gly) rs374898424
NM_000018.3(ACADVL):c.1837C>T (p.Arg613Trp) rs118204014
NM_000018.3(ACADVL):c.1839G>A (p.Arg613=) rs79125791
NM_000018.3(ACADVL):c.1843C>T (p.Arg615Ter) rs1057520507
NM_000018.3(ACADVL):c.1844G>A (p.Arg615Gln) rs148584617
NM_000018.3(ACADVL):c.1864C>T (p.Gln622Ter) rs1555529172
NM_000018.3(ACADVL):c.1894C>T (p.Arg632Cys) rs151254520
NM_000018.3(ACADVL):c.1908dup (p.Ile637Hisfs) rs1555529204
NM_000018.3(ACADVL):c.1923G>C (p.Leu641Phe) rs1452402269
NM_000018.3(ACADVL):c.1929G>C (p.Glu643Asp) rs1208010882
NM_000018.3(ACADVL):c.192delA (p.Lys64Asnfs) rs771055189
NM_000018.3(ACADVL):c.192dup (p.Pro65Thrfs)
NM_000018.3(ACADVL):c.1932G>A (p.Arg644=) rs886053375
NM_000018.3(ACADVL):c.194C>T (p.Pro65Leu) rs28934585
NM_000018.3(ACADVL):c.1965C>T (p.Phe655=) rs9674
NM_000018.3(ACADVL):c.204+15G>A rs1404625751
NM_000018.3(ACADVL):c.204+31dup rs1555527700
NM_000018.3(ACADVL):c.204+5G>A rs958328801
NM_000018.3(ACADVL):c.205-5C>G rs768537914
NM_000018.3(ACADVL):c.205-7T>C rs760625298
NM_000018.3(ACADVL):c.205-8C>G rs774353448
NM_000018.3(ACADVL):c.227G>A (p.Gly76Glu) rs750043368
NM_000018.3(ACADVL):c.230T>C (p.Met77Thr) rs1555527718
NM_000018.3(ACADVL):c.251_252delCA (p.Thr84Argfs) rs1452339268
NM_000018.3(ACADVL):c.256C>T (p.Gln86Ter) rs1555527732
NM_000018.3(ACADVL):c.266delC (p.Pro89Hisfs) rs771808680
NM_000018.3(ACADVL):c.277+1G>T rs1057517012
NM_000018.3(ACADVL):c.277+1delG rs1555527741
NM_000018.3(ACADVL):c.277+24T>C rs199945418
NM_000018.3(ACADVL):c.277+27delG rs775298132
NM_000018.3(ACADVL):c.277+2T>G rs1555527745
NM_000018.3(ACADVL):c.277+6G>T rs776422793
NM_000018.3(ACADVL):c.278-39C>T rs202244937
NM_000018.3(ACADVL):c.278-8C>T rs1178133251
NM_000018.3(ACADVL):c.278T>C (p.Val93Ala) rs886053373
NM_000018.3(ACADVL):c.286G>A (p.Glu96Lys)
NM_000018.3(ACADVL):c.298_299delCA (p.Gln100Valfs) rs786204713
NM_000018.3(ACADVL):c.299_305del7 (p.Gln100Leufs) rs1555527806
NM_000018.3(ACADVL):c.308A>G (p.Lys103Arg) rs140566084
NM_000018.3(ACADVL):c.308_309delAA (p.Lys103Argfs) rs1057516979
NM_000018.3(ACADVL):c.331_339del9 (p.Arg111_Phe113del) rs1555527820
NM_000018.3(ACADVL):c.339C>A (p.Phe113Leu) rs750653177
NM_000018.3(ACADVL):c.340G>A (p.Glu114Lys) rs557260142
NM_000018.3(ACADVL):c.342+14C>T rs567468883
NM_000018.3(ACADVL):c.342+15G>A rs777751102
NM_000018.3(ACADVL):c.342+16G>C rs536497611
NM_000018.3(ACADVL):c.342+1G>C rs780020193
NM_000018.3(ACADVL):c.342+25C>T rs771711857
NM_000018.3(ACADVL):c.343-23G>A rs781064781
NM_000018.3(ACADVL):c.343-41C>A rs368107662
NM_000018.3(ACADVL):c.343delG (p.Glu115Lysfs) rs387906249
NM_000018.3(ACADVL):c.374T>C (p.Leu125Pro)
NM_000018.3(ACADVL):c.388_390delGAG (p.Glu130del) rs387906251
NM_000018.3(ACADVL):c.393C>G (p.Thr131=) rs754931255
NM_000018.3(ACADVL):c.398G>A (p.Trp133Ter) rs1555527907
NM_000018.3(ACADVL):c.428_467del40 (p.Gly143Alafs) rs758144859
NM_000018.3(ACADVL):c.431T>C (p.Leu144Pro) rs1555527925
NM_000018.3(ACADVL):c.433C>T (p.Gln145Ter) rs786204738
NM_000018.3(ACADVL):c.439C>T (p.Pro147Ser) rs1032857886
NM_000018.3(ACADVL):c.478-1G>C rs1057517130
NM_000018.3(ACADVL):c.481G>A (p.Ala161Thr) rs375284481
NM_000018.3(ACADVL):c.482C>T (p.Ala161Val) rs796051908
NM_000018.3(ACADVL):c.497_498delTC (p.Ile166Serfs) rs1057516369
NM_000018.3(ACADVL):c.535G>T (p.Gly179Trp) rs796051909
NM_000018.3(ACADVL):c.538G>A (p.Ala180Thr) rs727503791
NM_000018.3(ACADVL):c.542A>G (p.His181Arg) rs1425862331
NM_000018.3(ACADVL):c.578G>A (p.Gly193Asp) rs1220348903
NM_000018.3(ACADVL):c.603C>G (p.Tyr201Ter) rs371407903
NM_000018.3(ACADVL):c.619T>C (p.Ser207Pro) rs768975918
NM_000018.3(ACADVL):c.62+10delT rs1251002707
NM_000018.3(ACADVL):c.62+18G>A rs780776419
NM_000018.3(ACADVL):c.62+6T>C rs1555527495
NM_000018.3(ACADVL):c.62+9G>A rs369512281
NM_000018.3(ACADVL):c.623-2_623-1delAG rs1555528265
NM_000018.3(ACADVL):c.623-8C>T rs144996066
NM_000018.3(ACADVL):c.63-18A>G rs1481782237
NM_000018.3(ACADVL):c.63-2A>C rs1555527513
NM_000018.3(ACADVL):c.636C>T (p.Ala212=) rs76547988
NM_000018.3(ACADVL):c.637G>A (p.Ala213Thr) rs140629318
NM_000018.3(ACADVL):c.637G>C (p.Ala213Pro) rs140629318
NM_000018.3(ACADVL):c.640T>G (p.Phe214Val) rs1192969297
NM_000018.3(ACADVL):c.644_647delGTCT (p.Cys215Terfs) rs1057516714
NM_000018.3(ACADVL):c.652G>A (p.Glu218Lys) rs1432183079
NM_000018.3(ACADVL):c.652_682dup (p.Ile228Argfs)
NM_000018.3(ACADVL):c.664G>A (p.Gly222Arg) rs398123091
NM_000018.3(ACADVL):c.685C>T (p.Arg229Ter) rs786204536
NM_000018.3(ACADVL):c.68G>A (p.Arg23Gln) rs34153370
NM_000018.3(ACADVL):c.693T>A (p.Ser231=) rs77763289
NM_000018.3(ACADVL):c.708_709delCT (p.Cys237Trpfs) rs1555528304
NM_000018.3(ACADVL):c.736A>G (p.Ser246Gly) rs1555528320
NM_000018.3(ACADVL):c.739A>G (p.Lys247Glu) rs387906253
NM_000018.3(ACADVL):c.751A>G (p.Ser251Gly) rs749159573
NM_000018.3(ACADVL):c.752+24C>T rs201030339
NM_000018.3(ACADVL):c.753-27C>T rs374911841
NM_000018.3(ACADVL):c.753-2A>C rs398123092
NM_000018.3(ACADVL):c.756T>C (p.Asn252=) rs143233413
NM_000018.3(ACADVL):c.757G>A (p.Gly253Arg) rs1555528345
NM_000018.3(ACADVL):c.759_761delGGG (p.Gly254del) rs1555528346
NM_000018.3(ACADVL):c.779C>T (p.Thr260Met) rs113994168
NM_000018.3(ACADVL):c.799_802delGTTA (p.Val267Glnfs) rs761204548
NM_000018.3(ACADVL):c.809delC (p.Pro270Glnfs)
NM_000018.3(ACADVL):c.818G>C (p.Gly273Ala) rs150149784
NM_000018.3(ACADVL):c.826_849delAAGGAGAAGATCACAGCTTTTGTG (p.Lys276_Val283del) rs1555528367
NM_000018.3(ACADVL):c.829_831delGAG (p.Glu277del) rs796051913
NM_000018.3(ACADVL):c.833_835delAGA (p.Lys278del) rs769280599
NM_000018.3(ACADVL):c.848T>C (p.Val283Ala) rs113994167
NM_000018.3(ACADVL):c.864C>T (p.Phe288=) rs753748672
NM_000018.3(ACADVL):c.864delC (p.Phe288Leufs) rs1555528386
NM_000018.3(ACADVL):c.865G>A (p.Gly289Arg) rs200788251
NM_000018.3(ACADVL):c.86G>A (p.Gly29Glu) rs1247979958
NM_000018.3(ACADVL):c.881_884dupGGCC (p.Pro296Alafs) rs766192888
NM_000018.3(ACADVL):c.887_888delCT (p.Pro296Argfs) rs753108198
NM_000018.3(ACADVL):c.891delG (p.Lys298Argfs) rs1057517180
NM_000018.3(ACADVL):c.896_898delAGA (p.Lys299del) rs387906252
NM_000018.3(ACADVL):c.898A>G (p.Met300Val) rs1026112888
NM_000018.3(ACADVL):c.932delT (p.Phe311Serfs) rs764488310
NM_000018.3(ACADVL):c.944T>G (p.Val315Gly) rs1555528469
NM_000018.3(ACADVL):c.947G>A (p.Arg316Gln) rs147366714
NM_000018.3(ACADVL):c.956C>A (p.Ser319Ter) rs149467828
NM_000018.3(ACADVL):c.95G>A (p.Arg32Gln)
NM_000018.3(ACADVL):c.969G>A (p.Leu323=) rs749734276
NM_000018.3(ACADVL):c.992A>C (p.Lys331Thr) rs727503792
NM_000018.3(ACADVL):c.994G>A (p.Val332Ile) rs775761275
NM_000018.3(ACADVL):c.996delT (p.Ala333Profs) rs1057516843
NM_000018.3(ACADVL):c.996dupT (p.Ala333Cysfs) rs1057516843
NM_000018.3(ACADVL):c.[194C>T;739A>C]
NM_000018.4(ACADVL):c.1019G>T (p.Gly340Val) rs934797393
NM_000018.4(ACADVL):c.1038G>A (p.Ala346=) rs8064573
NM_000018.4(ACADVL):c.105_109dup (p.Arg37Leufs) rs1555527532
NM_000018.4(ACADVL):c.1077+1G>T rs140989450
NM_000018.4(ACADVL):c.1077_1077+1delinsCAC rs1057516686
NM_000018.4(ACADVL):c.1097G>A (p.Arg366His) rs112406105
NM_000018.4(ACADVL):c.1226C>T (p.Thr409Met) rs113994169
NM_000018.4(ACADVL):c.1316G>A (p.Gly439Asp) rs533055438
NM_000018.4(ACADVL):c.1328T>G (p.Met443Arg) rs886043236
NM_000018.4(ACADVL):c.1349G>A (p.Arg450His) rs118204016
NM_000018.4(ACADVL):c.1376G>A (p.Arg459Gln) rs751995154
NM_000018.4(ACADVL):c.1405C>T (p.Arg469Trp) rs113994170
NM_000018.4(ACADVL):c.1591C>T (p.Arg531Trp) rs146379816
NM_000018.4(ACADVL):c.1733T>C (p.Met578Thr) rs375806217
NM_000018.4(ACADVL):c.1751+1G>A
NM_000018.4(ACADVL):c.1878G>A (p.Trp626Ter) rs1555529186
NM_000018.4(ACADVL):c.364A>G (p.Asn122Asp) rs1057520088
NM_000018.4(ACADVL):c.520G>A (p.Val174Met) rs369560930
NM_000018.4(ACADVL):c.553G>A (p.Gly185Ser) rs545215807
NM_000018.4(ACADVL):c.881G>A (p.Gly294Glu) rs200573371
NM_001270447.1(ACADVL):c.1768C>T (p.Arg590Trp) rs864321651
NM_001270448.1(ACADVL):c.-197C>T rs372982295
NM_001270448.1(ACADVL):c.1147C>T (p.Arg383Trp) rs766742117
NM_001270448.1(ACADVL):c.1378-22C>T rs370303265
NM_001270448.1(ACADVL):c.679A>G (p.Lys227Glu) rs369149696
NM_001270448.1(ACADVL):c.722T>C (p.Val241Ala) rs398123095
NM_001270448.1(ACADVL):c.725C>T (p.Pro242Leu) rs201676770
NM_001270448.1(ACADVL):c.875A>C (p.Gln292Pro) rs776063244
NM_001270448.1(ACADVL):c.899T>C (p.Phe300Ser) rs758928307
NM_001270448.1(ACADVL):c.955-15A>G rs765390290

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.