ClinVar Miner

List of variants in gene ACVRL1 reported as benign

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 32
Download table as spreadsheet
HGVS dbSNP
NM_000020.2(ACVRL1):c.*1246T>C rs706819
NM_000020.2(ACVRL1):c.*560T>C rs706818
NM_000020.2(ACVRL1):c.*58G>A rs182368657
NM_000020.2(ACVRL1):c.-46C>G rs190953189
NM_000020.2(ACVRL1):c.-5-33C>T rs2277382
NM_000020.2(ACVRL1):c.-52G>A rs573048639
NM_000020.2(ACVRL1):c.1122G>T (p.Arg374=) rs187902433
NM_000020.2(ACVRL1):c.1131A>G (p.Ala377=) rs61734313
NM_000020.2(ACVRL1):c.1246+19C>T rs185343653
NM_000020.2(ACVRL1):c.1246+9C>T rs115378744
NM_000020.2(ACVRL1):c.1377+45T>C rs706815
NM_000020.2(ACVRL1):c.1377+65A>G rs706816
NM_000020.2(ACVRL1):c.1378-248T>G
NM_000020.2(ACVRL1):c.1378-30T>C rs142910573
NM_000020.2(ACVRL1):c.1445C>T (p.Ala482Val) rs139142865
NM_000020.2(ACVRL1):c.207C>T (p.Cys69=) rs56080682
NM_000020.2(ACVRL1):c.313+11C>T rs2071218
NM_000020.2(ACVRL1):c.313+40G>C rs376033978
NM_000020.2(ACVRL1):c.314-35A>G rs2071219
NM_000020.2(ACVRL1):c.330G>A (p.Ser110=) rs77341011
NM_000020.2(ACVRL1):c.61+22A>G rs706812
NM_000020.2(ACVRL1):c.625+110_625+125delAATTGGAATTCTGCTG rs1555152839
NM_000020.2(ACVRL1):c.625+110_625+130delAATTGGAATTCTGCTGGGCAG rs67833112
NM_000020.2(ACVRL1):c.625+164T>C rs77709482
NM_000020.2(ACVRL1):c.626-53C>T rs111245531
NM_000020.2(ACVRL1):c.747G>A (p.Val249=) rs1058563
NM_000020.2(ACVRL1):c.772+27G>C rs201378973
NM_000020.2(ACVRL1):c.772+305T>A
NM_000020.2(ACVRL1):c.817C>T (p.Leu273=) rs55802125
NM_000020.2(ACVRL1):c.993C>T (p.Phe331=) rs56379428
NM_000020.2:c.1377+45T>C
NM_000020.2:c.1377+65A>G

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.