ClinVar Miner

List of variants in gene AGRN studied for Myasthenic syndrome, congenital, 8

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 346
Download table as spreadsheet
HGVS dbSNP
NM_198576.3(AGRN):c.4298+6_4298+88delCGGGGAGGGGACGGGGCCGGGGCAGCTCAGGTGGGCGGGGAGGGGACGGGCGGGGGAGGGGGGGCCGGGGCAGCTCAGGTGGG rs1553177542
NM_198576.4(AGRN):c.1009A>G (p.Thr337Ala)
NM_198576.4(AGRN):c.102C>T (p.Arg34=)
NM_198576.4(AGRN):c.1036_1039dup (p.Glu347fs)
NM_198576.4(AGRN):c.1054C>G (p.Arg352Gly) rs149868381
NM_198576.4(AGRN):c.1057C>T (p.Gln353Ter) rs587777299
NM_198576.4(AGRN):c.1058A>G (p.Gln353Arg) rs150359724
NM_198576.4(AGRN):c.1112G>A (p.Gly371Asp)
NM_198576.4(AGRN):c.1122G>A (p.Gly374=) rs563020089
NM_198576.4(AGRN):c.1123G>T (p.Ala375Ser) rs138031468
NM_198576.4(AGRN):c.1130G>A (p.Arg377Gln) rs1553174827
NM_198576.4(AGRN):c.1144C>A (p.Gln382Lys) rs1557701584
NM_198576.4(AGRN):c.1145A>G (p.Gln382Arg) rs1553174830
NM_198576.4(AGRN):c.1178-7_1178-6inv rs1553174921
NM_198576.4(AGRN):c.1188G>A (p.Pro396=) rs138841641
NM_198576.4(AGRN):c.1198C>T (p.Arg400Trp) rs149636063
NM_198576.4(AGRN):c.11G>C (p.Arg4Pro) rs539283387
NM_198576.4(AGRN):c.1209C>T (p.Ala403=) rs368625531
NM_198576.4(AGRN):c.1238G>A (p.Arg413His)
NM_198576.4(AGRN):c.1249G>A (p.Asp417Asn)
NM_198576.4(AGRN):c.1275C>G (p.Tyr425Ter)
NM_198576.4(AGRN):c.1342C>T (p.Arg448Trp)
NM_198576.4(AGRN):c.1395G>A (p.Pro465=) rs367601178
NM_198576.4(AGRN):c.1401A>G (p.Pro467=) rs763998310
NM_198576.4(AGRN):c.1405C>T (p.Leu469Phe)
NM_198576.4(AGRN):c.1411G>A (p.Val471Met)
NM_198576.4(AGRN):c.1427G>C (p.Gly476Ala)
NM_198576.4(AGRN):c.1434G>A (p.Thr478=) rs147346337
NM_198576.4(AGRN):c.1449C>T (p.Asn483=) rs759844691
NM_198576.4(AGRN):c.1512C>T (p.Ser504=) rs527601442
NM_198576.4(AGRN):c.1528G>A (p.Gly510Ser) rs138288952
NM_198576.4(AGRN):c.1539C>T (p.Cys513=) rs370615022
NM_198576.4(AGRN):c.1540G>A (p.Glu514Lys)
NM_198576.4(AGRN):c.1557C>T (p.Ala519=) rs146185843
NM_198576.4(AGRN):c.1566C>T (p.Leu522=) rs375687903
NM_198576.4(AGRN):c.1580A>C (p.Gln527Pro)
NM_198576.4(AGRN):c.1589G>A (p.Arg530His)
NM_198576.4(AGRN):c.1589G>T (p.Arg530Leu)
NM_198576.4(AGRN):c.1603+10G>A rs60074964
NM_198576.4(AGRN):c.1606C>T (p.Arg536Cys)
NM_198576.4(AGRN):c.1612G>A (p.Gly538Arg)
NM_198576.4(AGRN):c.1612G>T (p.Gly538Trp)
NM_198576.4(AGRN):c.1638C>T (p.Cys546=)
NM_198576.4(AGRN):c.1660G>A (p.Val554Met) rs79016973
NM_198576.4(AGRN):c.1696G>A (p.Val566Met)
NM_198576.4(AGRN):c.1721A>T (p.Tyr574Phe) rs749074796
NM_198576.4(AGRN):c.172G>A (p.Asp58Asn)
NM_198576.4(AGRN):c.1744G>A (p.Val582Met)
NM_198576.4(AGRN):c.1769G>A (p.Ser590Asn)
NM_198576.4(AGRN):c.183G>C (p.Gln61His)
NM_198576.4(AGRN):c.1864C>T (p.Arg622Trp)
NM_198576.4(AGRN):c.1865G>A (p.Arg622Gln) rs140789461
NM_198576.4(AGRN):c.1879C>T (p.Pro627Ser)
NM_198576.4(AGRN):c.1890C>T (p.Pro630=) rs779308593
NM_198576.4(AGRN):c.1891G>A (p.Val631Met) rs748716996
NM_198576.4(AGRN):c.1918G>A (p.Gly640Ser) rs759762952
NM_198576.4(AGRN):c.1937G>A (p.Arg646Gln)
NM_198576.4(AGRN):c.1969G>A (p.Glu657Lys) rs377567167
NM_198576.4(AGRN):c.1993G>A (p.Glu665Lys) rs143324306
NM_198576.4(AGRN):c.1995G>T (p.Glu665Asp) rs752339788
NM_198576.4(AGRN):c.1999+6C>G
NM_198576.4(AGRN):c.2025C>G (p.Gly675=) rs28484890
NM_198576.4(AGRN):c.2028T>A (p.Ser676=) rs144713799
NM_198576.4(AGRN):c.2038G>A (p.Gly680Ser)
NM_198576.4(AGRN):c.2067G>A (p.Gln689=) rs139886237
NM_198576.4(AGRN):c.2070C>T (p.Arg690=) rs146441147
NM_198576.4(AGRN):c.2105C>T (p.Pro702Leu)
NM_198576.4(AGRN):c.2134G>A (p.Val712Ile)
NM_198576.4(AGRN):c.2182G>A (p.Glu728Lys) rs757879583
NM_198576.4(AGRN):c.2183A>T (p.Glu728Val) rs113288277
NM_198576.4(AGRN):c.2219G>A (p.Arg740Gln)
NM_198576.4(AGRN):c.2241G>C (p.Gln747His) rs144361725
NM_198576.4(AGRN):c.2255-3C>T
NM_198576.4(AGRN):c.2266G>A (p.Ala756Thr) rs140764403
NM_198576.4(AGRN):c.2271G>A (p.Pro757=) rs150123719
NM_198576.4(AGRN):c.2276C>T (p.Pro759Leu) rs1214623286
NM_198576.4(AGRN):c.2277G>A (p.Pro759=) rs199985558
NM_198576.4(AGRN):c.2329A>G (p.Asn777Asp)
NM_198576.4(AGRN):c.232G>A (p.Asp78Asn)
NM_198576.4(AGRN):c.2338G>A (p.Ala780Thr)
NM_198576.4(AGRN):c.2406C>T (p.Gly802=) rs75774767
NM_198576.4(AGRN):c.2424C>T (p.Ala808=) rs1553176121
NM_198576.4(AGRN):c.2457G>C (p.Gly819=) rs112039851
NM_198576.4(AGRN):c.2496C>G (p.Asn832Lys)
NM_198576.4(AGRN):c.2501G>A (p.Arg834Gln) rs146243145
NM_198576.4(AGRN):c.2508C>T (p.Ile836=) rs148864199
NM_198576.4(AGRN):c.2514C>T (p.Thr838=) rs199577370
NM_198576.4(AGRN):c.2536+4A>G
NM_198576.4(AGRN):c.2536C>T (p.Pro846Ser)
NM_198576.4(AGRN):c.2555A>G (p.Gln852Arg) rs9697293
NM_198576.4(AGRN):c.261C>T (p.Asp87=) rs6657048
NM_198576.4(AGRN):c.2647G>A (p.Gly883Ser) rs145162376
NM_198576.4(AGRN):c.2651G>A (p.Arg884His) rs369686860
NM_198576.4(AGRN):c.2667G>A (p.Ala889=) rs144205055
NM_198576.4(AGRN):c.2681-4C>T rs186518388
NM_198576.4(AGRN):c.2682C>T (p.Asp894=) rs118105080
NM_198576.4(AGRN):c.2690C>T (p.Ala897Val) rs116836855
NM_198576.4(AGRN):c.2696C>T (p.Ala899Val)
NM_198576.4(AGRN):c.2705C>T (p.Ala902Val)
NM_198576.4(AGRN):c.2713C>T (p.Arg905Cys) rs199593375
NM_198576.4(AGRN):c.2732G>A (p.Arg911Gln) rs773144997
NM_198576.4(AGRN):c.2737G>A (p.Val913Met) rs140120617
NM_198576.4(AGRN):c.2798C>T (p.Ala933Val)
NM_198576.4(AGRN):c.2805+7G>A rs190000918
NM_198576.4(AGRN):c.2806-5C>T rs200385841
NM_198576.4(AGRN):c.2866C>T (p.Arg956Cys)
NM_198576.4(AGRN):c.2903C>T (p.Pro968Leu)
NM_198576.4(AGRN):c.2950G>A (p.Val984Met) rs371483148
NM_198576.4(AGRN):c.2971C>T (p.Leu991Phe)
NM_198576.4(AGRN):c.2987C>A (p.Ala996Glu) rs148475305
NM_198576.4(AGRN):c.298C>T (p.Pro100Ser)
NM_198576.4(AGRN):c.3001C>A (p.Pro1001Thr)
NM_198576.4(AGRN):c.3003C>T (p.Pro1001=) rs375208869
NM_198576.4(AGRN):c.3034G>A (p.Ala1012Thr)
NM_198576.4(AGRN):c.3039C>T (p.His1013=) rs549843700
NM_198576.4(AGRN):c.3046A>G (p.Thr1016Ala) rs1553176512
NM_198576.4(AGRN):c.3056C>T (p.Pro1019Leu)
NM_198576.4(AGRN):c.3077C>A (p.Thr1026Asn) rs3813188
NM_198576.4(AGRN):c.3119C>T (p.Thr1040Met) rs751987634
NM_198576.4(AGRN):c.3153C>T (p.Ser1051=) rs1367992401
NM_198576.4(AGRN):c.3264G>C (p.Leu1088Phe) rs150132566
NM_198576.4(AGRN):c.3264G>T (p.Leu1088Phe)
NM_198576.4(AGRN):c.3276C>T (p.Ser1092=) rs201166586
NM_198576.4(AGRN):c.3325G>A (p.Ala1109Thr)
NM_198576.4(AGRN):c.3353C>A (p.Thr1118Lys) rs149159118
NM_198576.4(AGRN):c.3353C>T (p.Thr1118Met)
NM_198576.4(AGRN):c.3387C>T (p.Pro1129=) rs758046832
NM_198576.4(AGRN):c.3404A>G (p.Gln1135Arg) rs142416636
NM_198576.4(AGRN):c.3409G>A (p.Val1137Ile)
NM_198576.4(AGRN):c.3456C>T (p.Pro1152=) rs368015466
NM_198576.4(AGRN):c.3465T>C (p.Ala1155=) rs146358566
NM_198576.4(AGRN):c.3515C>A (p.Thr1172Asn)
NM_198576.4(AGRN):c.3532C>T (p.Arg1178Trp)
NM_198576.4(AGRN):c.3533G>A (p.Arg1178Gln) rs148430436
NM_198576.4(AGRN):c.3543C>T (p.Asp1181=) rs775453668
NM_198576.4(AGRN):c.3560G>A (p.Arg1187Gln)
NM_198576.4(AGRN):c.3569G>A (p.Arg1190His) rs149762107
NM_198576.4(AGRN):c.3570C>T (p.Arg1190=) rs75361935
NM_198576.4(AGRN):c.3575G>A (p.Arg1192Gln) rs200339732
NM_198576.4(AGRN):c.3579C>G (p.Asp1193Glu)
NM_198576.4(AGRN):c.362C>A (p.Pro121His) rs533320704
NM_198576.4(AGRN):c.3662G>A (p.Arg1221Gln) rs764139323
NM_198576.4(AGRN):c.3670C>T (p.Leu1224Phe) rs753681540
NM_198576.4(AGRN):c.3694C>A (p.Arg1232Ser) rs777331097
NM_198576.4(AGRN):c.3695G>A (p.Arg1232His)
NM_198576.4(AGRN):c.3697C>T (p.Arg1233Trp) rs147673996
NM_198576.4(AGRN):c.3698G>A (p.Arg1233Gln) rs746259185
NM_198576.4(AGRN):c.3719C>T (p.Pro1240Leu) rs142620337
NM_198576.4(AGRN):c.3726G>C (p.Gln1242His) rs1396984760
NM_198576.4(AGRN):c.3727G>A (p.Glu1243Lys)
NM_198576.4(AGRN):c.3737G>A (p.Arg1246Gln)
NM_198576.4(AGRN):c.3752-5G>A rs201733530
NM_198576.4(AGRN):c.3764C>T (p.Ala1255Val)
NM_198576.4(AGRN):c.3773C>T (p.Thr1258Met) rs141842070
NM_198576.4(AGRN):c.3783G>A (p.Thr1261=) rs376408361
NM_198576.4(AGRN):c.3803G>A (p.Gly1268Glu)
NM_198576.4(AGRN):c.3809C>T (p.Thr1270Met)
NM_198576.4(AGRN):c.3815G>A (p.Arg1272Lys)
NM_198576.4(AGRN):c.3830C>T (p.Ser1277Leu)
NM_198576.4(AGRN):c.3839C>T (p.Pro1280Leu) rs774023993
NM_198576.4(AGRN):c.3844T>C (p.Ser1282Pro) rs1557714258
NM_198576.4(AGRN):c.384C>G (p.His128Gln) rs768527925
NM_198576.4(AGRN):c.3859C>T (p.Arg1287Trp) rs776411371
NM_198576.4(AGRN):c.3866C>T (p.Pro1289Leu) rs139294803
NM_198576.4(AGRN):c.3867G>A (p.Pro1289=) rs372005493
NM_198576.4(AGRN):c.3910G>A (p.Ala1304Thr)
NM_198576.4(AGRN):c.391G>A (p.Glu131Lys)
NM_198576.4(AGRN):c.3923G>A (p.Arg1308His)
NM_198576.4(AGRN):c.3923G>T (p.Arg1308Leu)
NM_198576.4(AGRN):c.3926G>A (p.Arg1309Gln) rs199680125
NM_198576.4(AGRN):c.3958G>A (p.Gly1320Arg)
NM_198576.4(AGRN):c.3964C>T (p.Arg1322Trp) rs184970403
NM_198576.4(AGRN):c.3971C>T (p.Pro1324Leu)
NM_198576.4(AGRN):c.3972G>A (p.Pro1324=) rs201483077
NM_198576.4(AGRN):c.3974C>G (p.Ala1325Gly) rs745406424
NM_198576.4(AGRN):c.39_47dup (p.12_14PLL[3]) rs1196847979
NM_198576.4(AGRN):c.4073C>T (p.Pro1358Leu)
NM_198576.4(AGRN):c.4090G>A (p.Ala1364Thr)
NM_198576.4(AGRN):c.4131C>T (p.Phe1377=) rs368555478
NM_198576.4(AGRN):c.4183C>T (p.Arg1395Cys) rs1015396973
NM_198576.4(AGRN):c.419G>A (p.Arg140Gln)
NM_198576.4(AGRN):c.4200C>G (p.Phe1400Leu)
NM_198576.4(AGRN):c.4225C>T (p.Leu1409=) rs1181560428
NM_198576.4(AGRN):c.4272G>A (p.Ala1424=) rs201470321
NM_198576.4(AGRN):c.4285C>A (p.Arg1429Ser)
NM_198576.4(AGRN):c.4285C>T (p.Arg1429Cys) rs201346452
NM_198576.4(AGRN):c.4298+6C>T rs199977575
NM_198576.4(AGRN):c.4320G>A (p.Pro1440=) rs767200294
NM_198576.4(AGRN):c.4323G>A (p.Ala1441=) rs373287346
NM_198576.4(AGRN):c.4339G>A (p.Val1447Met)
NM_198576.4(AGRN):c.4343C>T (p.Pro1448Leu) rs200232485
NM_198576.4(AGRN):c.4352C>T (p.Pro1451Leu) rs144620006
NM_198576.4(AGRN):c.4353G>A (p.Pro1451=) rs181981987
NM_198576.4(AGRN):c.4366C>T (p.Arg1456Cys)
NM_198576.4(AGRN):c.4379C>A (p.Ser1460Tyr) rs1553177633
NM_198576.4(AGRN):c.4393C>T (p.Arg1465Trp)
NM_198576.4(AGRN):c.4394G>A (p.Arg1465Gln)
NM_198576.4(AGRN):c.4406C>T (p.Ser1469Leu) rs200646795
NM_198576.4(AGRN):c.4435G>A (p.Glu1479Lys)
NM_198576.4(AGRN):c.4452C>T (p.Thr1484=) rs75767981
NM_198576.4(AGRN):c.4470C>T (p.Asp1490=) rs547462192
NM_198576.4(AGRN):c.44_45delinsGT (p.Pro15Arg) rs1553170743
NM_198576.4(AGRN):c.4503C>G (p.Asp1501Glu)
NM_198576.4(AGRN):c.4507G>A (p.Ala1503Thr)
NM_198576.4(AGRN):c.4513G>A (p.Val1505Met)
NM_198576.4(AGRN):c.4517C>T (p.Ala1506Val) rs373657385
NM_198576.4(AGRN):c.4540G>A (p.Ala1514Thr) rs111818381
NM_198576.4(AGRN):c.4562G>A (p.Arg1521His)
NM_198576.4(AGRN):c.4586G>A (p.Arg1529His)
NM_198576.4(AGRN):c.4612G>T (p.Ala1538Ser) rs775550619
NM_198576.4(AGRN):c.4622G>A (p.Arg1541Gln) rs760702396
NM_198576.4(AGRN):c.4639G>A (p.Glu1547Lys) rs2799068
NM_198576.4(AGRN):c.4651C>T (p.His1551Tyr) rs771455197
NM_198576.4(AGRN):c.4695G>C (p.Gln1565His) rs199876002
NM_198576.4(AGRN):c.4740C>T (p.Arg1580=) rs115019873
NM_198576.4(AGRN):c.4741G>A (p.Val1581Ile)
NM_198576.4(AGRN):c.4743C>T (p.Val1581=)
NM_198576.4(AGRN):c.4786C>T (p.Pro1596Ser) rs777910926
NM_198576.4(AGRN):c.4799C>T (p.Ala1600Val) rs370833536
NM_198576.4(AGRN):c.4800G>A (p.Ala1600=) rs369164916
NM_198576.4(AGRN):c.4821C>T (p.Pro1607=) rs149543827
NM_198576.4(AGRN):c.4834C>G (p.Gln1612Glu) rs1276554627
NM_198576.4(AGRN):c.4839C>T (p.Cys1613=) rs113020870
NM_198576.4(AGRN):c.4840G>A (p.Glu1614Lys) rs147259096
NM_198576.4(AGRN):c.4847C>T (p.Pro1616Leu)
NM_198576.4(AGRN):c.4856G>A (p.Arg1619His)
NM_198576.4(AGRN):c.4869C>A (p.Phe1623Leu) rs748076659
NM_198576.4(AGRN):c.4879+8G>A rs1410342207
NM_198576.4(AGRN):c.4893C>T (p.Asp1631=) rs139400715
NM_198576.4(AGRN):c.4894G>A (p.Gly1632Ser)
NM_198576.4(AGRN):c.4924G>A (p.Gly1642Ser)
NM_198576.4(AGRN):c.494C>T (p.Pro165Leu) rs140954236
NM_198576.4(AGRN):c.4966C>A (p.Arg1656=) rs145111679
NM_198576.4(AGRN):c.4966C>T (p.Arg1656Trp) rs145111679
NM_198576.4(AGRN):c.4967G>A (p.Arg1656Gln) rs374905300
NM_198576.4(AGRN):c.4976+3C>T
NM_198576.4(AGRN):c.4976+5G>C rs1553177963
NM_198576.4(AGRN):c.4977-10A>G rs142286944
NM_198576.4(AGRN):c.4996G>A (p.Val1666Ile) rs17160775
NM_198576.4(AGRN):c.500C>T (p.Thr167Met)
NM_198576.4(AGRN):c.5015G>A (p.Gly1672Asp)
NM_198576.4(AGRN):c.5025C>T (p.Gly1675=) rs147990356
NM_198576.4(AGRN):c.5038A>G (p.Asn1680Asp) rs1557719897
NM_198576.4(AGRN):c.5040C>T (p.Asn1680=) rs368498050
NM_198576.4(AGRN):c.5055C>T (p.Asp1685=) rs766955342
NM_198576.4(AGRN):c.5070C>T (p.Phe1690=) rs17160776
NM_198576.4(AGRN):c.5071G>A (p.Val1691Met) rs752964147
NM_198576.4(AGRN):c.5093G>A (p.Arg1698His) rs551658645
NM_198576.4(AGRN):c.5095C>T (p.Arg1699Cys) rs148518738
NM_198576.4(AGRN):c.5106C>T (p.Phe1702=) rs563420866
NM_198576.4(AGRN):c.5113G>A (p.Asp1705Asn)
NM_198576.4(AGRN):c.5125G>C (p.Gly1709Arg) rs199476396
NM_198576.4(AGRN):c.5133G>A (p.Ala1711=) rs376535149
NM_198576.4(AGRN):c.5142-9C>G
NM_198576.4(AGRN):c.5179G>T (p.Val1727Phe) rs587777298
NM_198576.4(AGRN):c.519G>C (p.Arg173=) rs756710837
NM_198576.4(AGRN):c.5201G>A (p.Arg1734His) rs145444272
NM_198576.4(AGRN):c.5216G>A (p.Arg1739His)
NM_198576.4(AGRN):c.5223C>T (p.Gly1741=) rs147681220
NM_198576.4(AGRN):c.5226C>T (p.Asp1742=) rs759448658
NM_198576.4(AGRN):c.523A>G (p.Met175Val)
NM_198576.4(AGRN):c.5247G>A (p.Glu1749=) rs367587156
NM_198576.4(AGRN):c.5254-5C>T rs34708466
NM_198576.4(AGRN):c.5258C>T (p.Pro1753Leu) rs748126752
NM_198576.4(AGRN):c.5276T>C (p.Leu1759Pro) rs1557721600
NM_198576.4(AGRN):c.5280G>A (p.Lys1760=)
NM_198576.4(AGRN):c.5299G>T (p.Gly1767Cys) rs1426112549
NM_198576.4(AGRN):c.5305C>T (p.Pro1769Ser) rs1446898012
NM_198576.4(AGRN):c.5308G>A (p.Asp1770Asn) rs141464249
NM_198576.4(AGRN):c.5327G>A (p.Arg1776His) rs757621899
NM_198576.4(AGRN):c.5332G>A (p.Ala1778Thr) rs538792693
NM_198576.4(AGRN):c.5334T>C (p.Ala1778=) rs1553178299
NM_198576.4(AGRN):c.5352C>T (p.Phe1784=) rs112073270
NM_198576.4(AGRN):c.5353G>A (p.Asp1785Asn) rs144245019
NM_198576.4(AGRN):c.5409C>A (p.His1803Gln)
NM_198576.4(AGRN):c.5410G>A (p.Val1804Met)
NM_198576.4(AGRN):c.5422G>A (p.Val1808Met) rs1356478300
NM_198576.4(AGRN):c.5456C>T (p.Thr1819Ile)
NM_198576.4(AGRN):c.5458C>A (p.Arg1820=)
NM_198576.4(AGRN):c.5466A>G (p.Ser1822=) rs149659540
NM_198576.4(AGRN):c.5483A>G (p.Asn1828Ser) rs753473191
NM_198576.4(AGRN):c.5516A>G (p.Tyr1839Cys) rs1553178384
NM_198576.4(AGRN):c.5550G>A (p.Pro1850=) rs74045090
NM_198576.4(AGRN):c.5557G>A (p.Glu1853Lys) rs754858398
NM_198576.4(AGRN):c.5572G>A (p.Glu1858Lys) rs1060499677
NM_198576.4(AGRN):c.5598C>T (p.Thr1866=) rs17778478
NM_198576.4(AGRN):c.5626G>A (p.Glu1876Lys)
NM_198576.4(AGRN):c.5645C>T (p.Thr1882Ile) rs540580770
NM_198576.4(AGRN):c.5653G>A (p.Glu1885Lys)
NM_198576.4(AGRN):c.5667G>A (p.Gln1889=) rs115061121
NM_198576.4(AGRN):c.5705C>T (p.Thr1902Met)
NM_198576.4(AGRN):c.5722T>C (p.Trp1908Arg)
NM_198576.4(AGRN):c.5725A>C (p.Ser1909Arg) rs1553178845
NM_198576.4(AGRN):c.5726G>C (p.Ser1909Thr) rs74685771
NM_198576.4(AGRN):c.5735C>T (p.Ala1912Val) rs141178720
NM_198576.4(AGRN):c.5738C>T (p.Thr1913Met) rs201604787
NM_198576.4(AGRN):c.5744G>A (p.Arg1915Gln) rs150134229
NM_198576.4(AGRN):c.5753A>G (p.Tyr1918Cys)
NM_198576.4(AGRN):c.5767A>G (p.Ile1923Val) rs759500435
NM_198576.4(AGRN):c.5799C>T (p.Asn1933=) rs755986768
NM_198576.4(AGRN):c.579G>A (p.Ala193=) rs201301445
NM_198576.4(AGRN):c.5811G>A (p.Gln1937=) rs1212454305
NM_198576.4(AGRN):c.5814C>T (p.Pro1938=) rs369308183
NM_198576.4(AGRN):c.5837C>T (p.Pro1946Leu) rs771364268
NM_198576.4(AGRN):c.5861G>A (p.Arg1954Gln)
NM_198576.4(AGRN):c.5883G>A (p.Gln1961=) rs1210257970
NM_198576.4(AGRN):c.5896C>T (p.Leu1966=) rs115828965
NM_198576.4(AGRN):c.5908A>G (p.Asn1970Asp) rs1473312060
NM_198576.4(AGRN):c.593_595AGA[1] (p.Lys199del) rs749209897
NM_198576.4(AGRN):c.5944G>A (p.Ala1982Thr)
NM_198576.4(AGRN):c.5948C>T (p.Thr1983Met) rs147569326
NM_198576.4(AGRN):c.5990C>T (p.Pro1997Leu) rs144091542
NM_198576.4(AGRN):c.5995C>A (p.Leu1999Met) rs868724036
NM_198576.4(AGRN):c.5998C>T (p.Pro2000Ser)
NM_198576.4(AGRN):c.5C>A (p.Ala2Asp) rs776698665
NM_198576.4(AGRN):c.6001G>A (p.Val2001Met) rs775422356
NM_198576.4(AGRN):c.6022G>A (p.Ala2008Thr)
NM_198576.4(AGRN):c.602C>T (p.Pro201Leu)
NM_198576.4(AGRN):c.6068G>T (p.Gly2023Val) rs374160610
NM_198576.4(AGRN):c.6077C>T (p.Pro2026Leu)
NM_198576.4(AGRN):c.6091G>A (p.Glu2031Lys)
NM_198576.4(AGRN):c.6100G>A (p.Val2034Ile)
NM_198576.4(AGRN):c.6119G>A (p.Arg2040Gln) rs527639453
NM_198576.4(AGRN):c.651C>T (p.Tyr217=) rs1235929400
NM_198576.4(AGRN):c.67G>C (p.Val23Leu) rs201073369
NM_198576.4(AGRN):c.686G>A (p.Ser229Asn) rs1284515586
NM_198576.4(AGRN):c.698G>T (p.Arg233Leu)
NM_198576.4(AGRN):c.718G>A (p.Gly240Arg)
NM_198576.4(AGRN):c.726C>T (p.Cys242=)
NM_198576.4(AGRN):c.729C>G (p.Gly243=) rs191270495
NM_198576.4(AGRN):c.738C>T (p.Asp246=) rs536085218
NM_198576.4(AGRN):c.752T>C (p.Val251Ala) rs779170859
NM_198576.4(AGRN):c.773C>T (p.Thr258Ile) rs200607541
NM_198576.4(AGRN):c.804C>T (p.Ala268=) rs113789806
NM_198576.4(AGRN):c.807G>A (p.Ser269=) rs746098476
NM_198576.4(AGRN):c.829C>T (p.Arg277Cys) rs1256837701
NM_198576.4(AGRN):c.836C>T (p.Ala279Val)
NM_198576.4(AGRN):c.840C>G (p.Pro280=) rs956784907
NM_198576.4(AGRN):c.880G>A (p.Gly294Ser)
NM_198576.4(AGRN):c.885G>A (p.Glu295=) rs765834882
NM_198576.4(AGRN):c.902_912del (p.Arg301fs)
NM_198576.4(AGRN):c.904G>A (p.Ala302Thr) rs1318084676
NM_198576.4(AGRN):c.914_947del (p.Arg305fs) rs1557700705
NM_198576.4(AGRN):c.94C>T (p.Pro32Ser)
NM_198576.4(AGRN):c.956C>T (p.Pro319Leu)
NM_198576.4(AGRN):c.980C>G (p.Pro327Arg)

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.