ClinVar Miner

List of variants in gene AGRN reported as benign

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 120
Download table as spreadsheet
HGVS dbSNP
GRCh37/hg19 1p36.33(chr1:957640-964438)x0
GRCh37/hg19 1p36.33(chr1:963864-964438)x1
GRCh37/hg19 1p36.33(chr1:963864-986737)x0
GRCh37/hg19 1p36.33(chr1:963938-964438)x1
GRCh37/hg19 1p36.33(chr1:963938-985900)x1
NC_000001.11:g.1019833T>C
NC_000001.11:g.1042190G>A
NC_000001.11:g.1045707A>G
NM_198576.3(AGRN):c.4298+6_4298+88delCGGGGAGGGGACGGGGCCGGGGCAGCTCAGGTGGGCGGGGAGGGGACGGGCGGGGGAGGGGGGGCCGGGGCAGCTCAGGTGGG rs1553177542
NM_198576.4(AGRN):c.*19C>T rs3121561
NM_198576.4(AGRN):c.1058A>G (p.Gln353Arg) rs150359724
NM_198576.4(AGRN):c.1123G>T (p.Ala375Ser) rs138031468
NM_198576.4(AGRN):c.1177+109_1178-99del
NM_198576.4(AGRN):c.1177+121G>C
NM_198576.4(AGRN):c.1178-6T>C rs2799066
NM_198576.4(AGRN):c.11G>C (p.Arg4Pro) rs539283387
NM_198576.4(AGRN):c.1384+238C>T
NM_198576.4(AGRN):c.1384+28G>A rs2710876
NM_198576.4(AGRN):c.1385-15_1385-14del rs35881187
NM_198576.4(AGRN):c.1434G>A (p.Thr478=) rs147346337
NM_198576.4(AGRN):c.1528G>A (p.Gly510Ser) rs138288952
NM_198576.4(AGRN):c.1603+10G>A rs60074964
NM_198576.4(AGRN):c.1603+19G>A rs115191992
NM_198576.4(AGRN):c.1660G>A (p.Val554Met) rs79016973
NM_198576.4(AGRN):c.1993G>A (p.Glu665Lys) rs143324306
NM_198576.4(AGRN):c.202-13A>G rs115704555
NM_198576.4(AGRN):c.2025C>G (p.Gly675=) rs28484890
NM_198576.4(AGRN):c.2067G>A (p.Gln689=) rs139886237
NM_198576.4(AGRN):c.2183A>T (p.Glu728Val) rs113288277
NM_198576.4(AGRN):c.2254+16G>A rs114389542
NM_198576.4(AGRN):c.2255-81G>A
NM_198576.4(AGRN):c.2406C>T (p.Gly802=) rs75774767
NM_198576.4(AGRN):c.2457G>C (p.Gly819=) rs112039851
NM_198576.4(AGRN):c.2508C>T (p.Ile836=) rs148864199
NM_198576.4(AGRN):c.2537-26A>G rs3128098
NM_198576.4(AGRN):c.2555A>G (p.Gln852Arg) rs9697293
NM_198576.4(AGRN):c.261C>T (p.Asp87=) rs6657048
NM_198576.4(AGRN):c.2682C>T (p.Asp894=) rs118105080
NM_198576.4(AGRN):c.2805+7G>A rs190000918
NM_198576.4(AGRN):c.3039C>T (p.His1013=) rs549843700
NM_198576.4(AGRN):c.3066A>G (p.Ser1022=) rs2465128
NM_198576.4(AGRN):c.3077C>A (p.Thr1026Asn) rs3813188
NM_198576.4(AGRN):c.3264G>C (p.Leu1088Phe) rs150132566
NM_198576.4(AGRN):c.3276C>T (p.Ser1092=) rs201166586
NM_198576.4(AGRN):c.3353C>A (p.Thr1118Lys) rs149159118
NM_198576.4(AGRN):c.3388+107A>G
NM_198576.4(AGRN):c.3388+125T>C
NM_198576.4(AGRN):c.3388+176T>C
NM_198576.4(AGRN):c.3404A>G (p.Gln1135Arg) rs142416636
NM_198576.4(AGRN):c.3465T>C (p.Ala1155=) rs146358566
NM_198576.4(AGRN):c.3516+10G>C rs76264143
NM_198576.4(AGRN):c.3517-12T>C rs3128102
NM_198576.4(AGRN):c.3558T>C (p.Phe1186=) rs10267
NM_198576.4(AGRN):c.3570C>T (p.Arg1190=) rs75361935
NM_198576.4(AGRN):c.3765G>A (p.Ala1255=)
NM_198576.4(AGRN):c.3866C>T (p.Pro1289Leu) rs139294803
NM_198576.4(AGRN):c.3964C>T (p.Arg1322Trp) rs184970403
NM_198576.4(AGRN):c.3972G>A (p.Pro1324=) rs201483077
NM_198576.4(AGRN):c.4105+180C>A
NM_198576.4(AGRN):c.4106-145G>A
NM_198576.4(AGRN):c.4106-186C>T
NM_198576.4(AGRN):c.4106-214C>T
NM_198576.4(AGRN):c.4106-231G>A
NM_198576.4(AGRN):c.4106-45A>G
NM_198576.4(AGRN):c.4106-75_4106-74del
NM_198576.4(AGRN):c.4131C>T (p.Phe1377=) rs368555478
NM_198576.4(AGRN):c.4161T>C (p.Thr1387=) rs9442391
NM_198576.4(AGRN):c.4285C>T (p.Arg1429Cys) rs201346452
NM_198576.4(AGRN):c.4298+11A>T rs369279324
NM_198576.4(AGRN):c.4298+17C>T rs188005130
NM_198576.4(AGRN):c.4298+6C>T rs199977575
NM_198576.4(AGRN):c.4323G>A (p.Ala1441=) rs373287346
NM_198576.4(AGRN):c.4452C>T (p.Thr1484=) rs75767981
NM_198576.4(AGRN):c.4514+16G>C rs112917612
NM_198576.4(AGRN):c.4514+57A>G
NM_198576.4(AGRN):c.4540G>A (p.Ala1514Thr) rs111818381
NM_198576.4(AGRN):c.45G>T (p.Pro15=) rs115173026
NM_198576.4(AGRN):c.463+56G>T
NM_198576.4(AGRN):c.464-240A>C
NM_198576.4(AGRN):c.4695G>C (p.Gln1565His) rs199876002
NM_198576.4(AGRN):c.4740C>T (p.Arg1580=) rs115019873
NM_198576.4(AGRN):c.4745-17C>T rs2275813
NM_198576.4(AGRN):c.4745-44C>T
NM_198576.4(AGRN):c.4821C>T (p.Pro1607=) rs149543827
NM_198576.4(AGRN):c.4839C>T (p.Cys1613=) rs113020870
NM_198576.4(AGRN):c.4879+29G>T rs2275812
NM_198576.4(AGRN):c.4879+32G>A rs2799067
NM_198576.4(AGRN):c.4879+43T>C
NM_198576.4(AGRN):c.4893C>T (p.Asp1631=) rs139400715
NM_198576.4(AGRN):c.4977-10A>G rs142286944
NM_198576.4(AGRN):c.4996G>A (p.Val1666Ile) rs17160775
NM_198576.4(AGRN):c.5025C>T (p.Gly1675=) rs147990356
NM_198576.4(AGRN):c.5070C>T (p.Phe1690=) rs17160776
NM_198576.4(AGRN):c.511+132G>A
NM_198576.4(AGRN):c.5141+28G>T
NM_198576.4(AGRN):c.5201G>A (p.Arg1734His) rs145444272
NM_198576.4(AGRN):c.5223C>T (p.Gly1741=) rs147681220
NM_198576.4(AGRN):c.5253+68C>T
NM_198576.4(AGRN):c.5254-190C>T
NM_198576.4(AGRN):c.5254-5C>T rs34708466
NM_198576.4(AGRN):c.5352C>T (p.Phe1784=) rs112073270
NM_198576.4(AGRN):c.5353G>A (p.Asp1785Asn) rs144245019
NM_198576.4(AGRN):c.5358T>C (p.Gly1786=) rs17160781
NM_198576.4(AGRN):c.5466A>G (p.Ser1822=) rs149659540
NM_198576.4(AGRN):c.5550G>A (p.Pro1850=) rs74045090
NM_198576.4(AGRN):c.5598C>T (p.Thr1866=) rs17778478
NM_198576.4(AGRN):c.5647G>A (p.Glu1883Lys) rs139415524
NM_198576.4(AGRN):c.5651+5C>T rs9803031
NM_198576.4(AGRN):c.5652-201G>C
NM_198576.4(AGRN):c.5667G>A (p.Gln1889=) rs115061121
NM_198576.4(AGRN):c.5726G>C (p.Ser1909Thr) rs74685771
NM_198576.4(AGRN):c.579G>A (p.Ala193=) rs201301445
NM_198576.4(AGRN):c.5814C>T (p.Pro1938=) rs369308183
NM_198576.4(AGRN):c.5896C>T (p.Leu1966=) rs115828965
NM_198576.4(AGRN):c.6057C>T (p.Asp2019=) rs4275402
NM_198576.4(AGRN):c.67G>C (p.Val23Leu) rs201073369
NM_198576.4(AGRN):c.729C>G (p.Gly243=) rs191270495
NM_198576.4(AGRN):c.738C>T (p.Asp246=) rs536085218
NM_198576.4(AGRN):c.773C>T (p.Thr258Ile) rs200607541
NM_198576.4(AGRN):c.804C>T (p.Ala268=) rs113789806

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.