List of variants in gene ANO5 reported by Mendelics

Minimum submission review status:		Collection method:
Minimum conflict level: Report conflict between different conditions
Gene type: Distinguish antisense genes from sense genes
		ClinVar version:

Total variants: 14

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_213599.3(ANO5):c.616A>G (p.Thr206Ala)	rs78266558	0.00922
NM_213599.3(ANO5):c.2387C>T (p.Ser796Leu)	rs61910685	0.00804
NM_213599.3(ANO5):c.680G>C (p.Gly227Ala)	rs140903276	0.00320
NM_213599.3(ANO5):c.259G>A (p.Val87Ile)	rs34994927	0.00293
NM_213599.3(ANO5):c.155A>G (p.Asn52Ser)	rs143777403	0.00238
NM_213599.3(ANO5):c.692G>T (p.Gly231Val)	rs137854523	0.00098
NM_213599.3(ANO5):c.2141C>G (p.Thr714Ser)	rs200631556	0.00090
NM_213599.3(ANO5):c.*113del	rs5790246
NM_213599.3(ANO5):c.-161_-156AGG[3]GGAATGAGGAGGAGGAGGAGG[1]	rs71034576
NM_213599.3(ANO5):c.1013+1G>A	rs1335126943
NM_213599.3(ANO5):c.1494T>G (p.Asp498Glu)	rs2133738349
NM_213599.3(ANO5):c.1721A>G (p.Tyr574Cys)	rs2133747827
NM_213599.3(ANO5):c.191dup (p.Asn64fs)	rs137854521
NM_213599.3(ANO5):c.2646C>G (p.Asn882Lys)	rs34969327

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.