ClinVar Miner

List of variants in gene ANO5 reported as benign by Illumina Laboratory Services, Illumina

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 24
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_213599.3(ANO5):c.267T>C (p.Asp89=) rs4312063 0.83210
NM_213599.3(ANO5):c.-136G>C rs12792259 0.83191
NM_213599.3(ANO5):c.*3178C>G rs6483841 0.72187
NM_213599.3(ANO5):c.*1286G>T rs7925081 0.65457
NM_213599.3(ANO5):c.*496A>G rs10766930 0.53080
NM_213599.3(ANO5):c.*1521T>C rs73483433 0.09970
NM_213599.3(ANO5):c.*1313A>G rs73483432 0.09785
NM_213599.3(ANO5):c.*3152G>A rs79486036 0.04921
NM_213599.3(ANO5):c.*3121A>G rs35827261 0.04156
NM_213599.3(ANO5):c.2521-13A>G rs76850415 0.02660
NM_213599.3(ANO5):c.*554C>T rs117180492 0.02476
NM_213599.3(ANO5):c.*279G>A rs72982058 0.02298
NM_213599.3(ANO5):c.2259A>G (p.Ser753=) rs61746201 0.01772
NM_213599.3(ANO5):c.*1328C>T rs78089375 0.01250
NM_213599.3(ANO5):c.-261A>C rs114897158 0.01250
NM_213599.3(ANO5):c.*1661C>T rs12284506 0.01249
NM_213599.3(ANO5):c.1029C>T (p.Asp343=) rs78899595 0.00992
NM_213599.3(ANO5):c.604G>A (p.Glu202Lys) rs115750596 0.00971
NM_213599.3(ANO5):c.616A>G (p.Thr206Ala) rs78266558 0.00922
NM_213599.3(ANO5):c.*1429A>G rs78143145 0.00911
NM_213599.3(ANO5):c.800C>G (p.Thr267Ser) rs138144479 0.00727
NM_213599.3(ANO5):c.-161_-156AGG[3]GGAATGAGGAGGAGGAGGAGG[1] rs71034576
NM_213599.3(ANO5):c.-217G>T rs73479393
NM_213599.3(ANO5):c.966A>T (p.Leu322Phe) rs7481951

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.