ClinVar Miner

List of variants in gene APC studied for Familial adenomatous polyposis 1

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 2624
Download table as spreadsheet
HGVS dbSNP
APC deletion
APC, 5-BP DEL, NT3221
NC_000005.10:g.(?_112707312)_(112707902_?)del
NC_000005.10:g.(?_112707312)_(112707902_?)dup
NC_000005.10:g.(?_112707312)_(112780909_?)del
NC_000005.10:g.(?_112737024)_(112755031_?)dup
NC_000005.10:g.(?_112737024)_(112766416_?)del
NC_000005.10:g.(?_112737024)_(112775743_?)dup
NC_000005.10:g.(?_112737024)_(112844132_?)del
NC_000005.10:g.(?_112737859)_(112815593_?)del
NC_000005.10:g.(?_112754873)_(112821991_?)dup
NC_000005.10:g.(?_112754885)_(112767396_?)dup
NC_000005.10:g.(?_112754885)_(112775743_?)dup
NC_000005.10:g.(?_112775623)_(112844132_?)del
NC_000005.10:g.(?_112780784)_(112844132_?)dup
NC_000005.10:g.(?_112780790)_(112846239_?)del
NC_000005.10:g.(?_112815485)_(112835175_?)del
NC_000005.10:g.(?_112815489)_(112844132_?)dup
NC_000005.10:g.(?_112815495)_(112821991_?)del
NC_000005.10:g.(?_112818966)_(112821991_?)del
NC_000005.10:g.(?_112827102)_(112844132_?)del
NC_000005.10:g.(?_112827108)_(112846239_?)dup
NC_000005.10:g.(?_112827923)_(112844132_?)del
NC_000005.10:g.(?_112828856)_(112828972_?)del
NC_000005.10:g.(?_112834945)_(112835171_?)del
NC_000005.10:g.(?_112837547)_(112844132_?)del
NC_000005.10:g.112835099_112835190del92
NG_008481.4:g.(?_150033)_(158719_?)del
NM_000038.4:c.(?_1)_(8477_?)del
NM_000038.5(APC):c.*248A>G rs186777258
NM_000038.5(APC):c.-18-?_834+?dup
NM_000038.5(APC):c.-30042T>C rs1191699028
NM_000038.5(APC):c.-30043A>G rs1487833679
NM_000038.5(APC):c.-30045G>A rs1057517556
NM_000038.5(APC):c.-30045G>T rs1057517556
NM_000038.5(APC):c.-30046G>C rs1223298182
NM_000038.5(APC):c.-30052G>T rs1296416614
NM_000038.5(APC):c.-30059G>T rs765384591
NM_000038.5(APC):c.-30061G>A rs1239946140
NM_000038.5(APC):c.-30064C>A rs1312050427
NM_000038.5(APC):c.-30070G>C rs888841371
NM_000038.5(APC):c.-30072G>C rs1554060317
NM_000038.5(APC):c.-30073A>G rs1554060315
NM_000038.5(APC):c.-30077G>A rs1163442131
NM_000038.5(APC):c.-30078G>C rs1366978080
NM_000038.5(APC):c.-30079T>C rs1488176769
NM_000038.5(APC):c.-30091A>C rs766151900
NM_000038.5(APC):c.-30093G>A rs1004213568
NM_000038.5(APC):c.-30093G>C rs1004213568
NM_000038.5(APC):c.-30094C>T rs755954869
NM_000038.5(APC):c.-30097G>A rs367773779
NM_000038.5(APC):c.-30097G>C rs367773779
NM_000038.5(APC):c.-30102G>A rs1057517570
NM_000038.5(APC):c.-30103G>A rs1057517582
NM_000038.5(APC):c.-30104G>A rs1189155420
NM_000038.5(APC):c.-30104G>T rs1189155420
NM_000038.5(APC):c.-30105C>T rs1057517584
NM_000038.5(APC):c.-30106C>G rs1248809012
NM_000038.5(APC):c.-30108G>A rs587778028
NM_000038.5(APC):c.-30108G>C rs587778028
NM_000038.5(APC):c.-30113G>A rs761467156
NM_000038.5(APC):c.-30124C>T rs1554060293
NM_000038.5(APC):c.-30127G>A rs1232734822
NM_000038.5(APC):c.-30128C>T rs1312161630
NM_000038.5(APC):c.-30136A>C rs1302045127
NM_000038.5(APC):c.-30141G>A rs1337289014
NM_000038.5(APC):c.-30147C>T rs1400852847
NM_000038.5(APC):c.-30153G>A rs1554060285
NM_000038.5(APC):c.-30156C>T rs770241997
NM_000038.5(APC):c.-30160G>A rs762748481
NM_000038.5(APC):c.-30161C>T rs1422300065
NM_000038.5(APC):c.-30163C>T rs1554060282
NM_000038.5(APC):c.-30179T>C rs980704771
NM_000038.5(APC):c.-30179T>G rs980704771
NM_000038.5(APC):c.-30181T>C rs1554060278
NM_000038.5(APC):c.-30188G>A rs772953367
NM_000038.5(APC):c.-30188G>C rs772953367
NM_000038.5(APC):c.-30197C>A rs917976853
NM_000038.5(APC):c.-30199G>T rs1397116635
NM_000038.5(APC):c.-30202C>A rs1291188034
NM_000038.5(APC):c.-30205G>A rs777188684
NM_000038.5(APC):c.-30210G>A rs1304453341
NM_000038.5(APC):c.-30211G>A rs1043505718
NM_000038.5(APC):c.-30215C>T rs1554060261
NM_000038.5(APC):c.-30224G>A rs1057517567
NM_000038.5(APC):c.-30226A>G rs189807660
NM_000038.5(APC):c.-30226A>T rs189807660
NM_000038.5(APC):c.-30228C>T rs1395970563
NM_000038.5(APC):c.-30231C>T rs972010514
NM_000038.5(APC):c.-30238T>C rs1057517554
NM_000038.5(APC):c.-30240C>T rs1554060248
NM_000038.5(APC):c.-30244C>A
NM_000038.5(APC):c.-30244C>G rs1357561329
NM_000038.5(APC):c.-30258C>T rs1015952631
NM_000038.5(APC):c.-30260C>T rs1376128351
NM_000038.5(APC):c.-30265T>A rs1466692709
NM_000038.5(APC):c.-30267G>T rs748454058
NM_000038.5(APC):c.-30281C>T rs1189950358
NM_000038.5(APC):c.-30285T>C rs1554060243
NM_000038.5(APC):c.-30287T>C rs1554060241
NM_000038.5(APC):c.-30290T>C rs1554060239
NM_000038.5(APC):c.-30291C>T rs1473007055
NM_000038.5(APC):c.-30294G>A rs1163893701
NM_000038.5(APC):c.-30297C>T rs544132569
NM_000038.5(APC):c.-30299C>G rs1415610352
NM_000038.5(APC):c.-30300T>C rs1554060234
NM_000038.5(APC):c.-30304C>T rs953008592
NM_000038.5(APC):c.-30305G>A rs1369181601
NM_000038.5(APC):c.-30309C>A rs1306105402
NM_000038.5(APC):c.-30309C>T rs1306105402
NM_000038.5(APC):c.-30310T>C rs1340630542
NM_000038.5(APC):c.-30312G>C rs926522652
NM_000038.5(APC):c.-30322A>C rs1411710258
NM_000038.5(APC):c.-30324G>A rs997256982
NM_000038.5(APC):c.-30334C>G rs561513597
NM_000038.5(APC):c.-30334C>T rs561513597
NM_000038.5(APC):c.-30335C>G rs761634030
NM_000038.5(APC):c.-30336C>T rs1029692674
NM_000038.5(APC):c.-30339A>G rs1052992527
NM_000038.5(APC):c.-30344G>T rs1372371966
NM_000038.5(APC):c.-30345G>A rs1460028540
NM_000038.5(APC):c.-30346C>T rs904073379
NM_000038.5(APC):c.-30347G>C rs1173776603
NM_000038.5(APC):c.-30349C>T rs185346146
NM_000038.5(APC):c.-30350C>G rs964366695
NM_000038.5(APC):c.-30350C>T rs964366695
NM_000038.5(APC):c.-30351A>T rs1045063324
NM_000038.5(APC):c.-30352G>A rs948080320
NM_000038.5(APC):c.-30352G>C rs948080320
NM_000038.5(APC):c.-30352G>T rs948080320
NM_000038.5(APC):c.-30354G>C rs543098847
NM_000038.5(APC):c.-30356G>C rs1056513509
NM_000038.5(APC):c.-30356G>T rs1056513509
NM_000038.5(APC):c.-30357G>A rs572582235
NM_000038.5(APC):c.-30357G>C rs572582235
NM_000038.5(APC):c.-30357G>T rs572582235
NM_000038.5(APC):c.-30358G>A rs182500056
NM_000038.5(APC):c.-30358G>C rs182500056
NM_000038.5(APC):c.-30358G>T rs182500056
NM_000038.5(APC):c.-30359C>A rs79896135
NM_000038.5(APC):c.-30359C>G rs79896135
NM_000038.5(APC):c.-30359C>T rs79896135
NM_000038.5(APC):c.-30360T>A rs963346102
NM_000038.5(APC):c.-30360T>C rs963346102
NM_000038.5(APC):c.-30361C>G rs1311747020
NM_000038.5(APC):c.-30361C>T rs1311747020
NM_000038.5(APC):c.-30365G>C rs1554060208
NM_000038.5(APC):c.-30366C>A rs775297664
NM_000038.5(APC):c.-30366C>G rs775297664
NM_000038.5(APC):c.-30371C>G rs986030414
NM_000038.5(APC):c.-30372C>T rs1554060206
NM_000038.5(APC):c.-30375A>C rs922676017
NM_000038.5(APC):c.-30376G>A rs1459755551
NM_000038.5(APC):c.-30377G>C rs1029997545
NM_000038.5(APC):c.-30378C>T rs138386816
NM_000038.5(APC):c.-30382C>A rs1031181133
NM_000038.5(APC):c.-30382C>T rs1031181133
NM_000038.5(APC):c.-30383G>A rs1554060197
NM_000038.5(APC):c.-30389G>A rs558562104
NM_000038.5(APC):c.-30392C>A rs904001781
NM_000038.5(APC):c.-30392C>G rs904001781
NM_000038.5(APC):c.-30392C>T rs904001781
NM_000038.5(APC):c.-30393G>A rs1278244063
NM_000038.5(APC):c.-30394G>A rs1554060194
NM_000038.5(APC):c.-30396G>C rs1000470082
NM_000038.5(APC):c.-30397G>C rs968943120
NM_000038.5(APC):c.-30399A>G rs1273775271
NM_000038.5(APC):c.-30403T>A rs1020491376
NM_000038.5(APC):c.-30403T>C rs1020491376
NM_000038.5(APC):c.-30404G>A rs1045323633
NM_000038.5(APC):c.-30407C>T rs115658307
NM_000038.5(APC):c.-30408G>T rs1554060189
NM_000038.5(APC):c.-30410G>C rs575784409
NM_000038.5(APC):c.-30412G>T rs1554060187
NM_000038.5(APC):c.-30413G>A rs1554060186
NM_000038.5(APC):c.-30414C>T rs761454123
NM_000038.5(APC):c.-30416G>A rs879253785
NM_000038.5(APC):c.-30417T>C rs879253783
NM_000038.5(APC):c.-30430A>G rs554351451
NM_000038.5(APC):c.-30438G>A rs930090983
NM_000038.5(APC):c.-30439A>G rs1554060181
NM_000038.5(APC):c.-30444A>G rs1554060180
NM_000038.5(APC):c.-30445C>T rs1178835678
NM_000038.5(APC):c.-30453C>G rs1554060178
NM_000038.5(APC):c.-30458T>C rs1554060175
NM_000038.5(APC):c.-30459C>T rs1333841760
NM_000038.5(APC):c.-30460C>G rs145818737
NM_000038.5(APC):c.-30460C>T rs145818737
NM_000038.5(APC):c.-30466G>C rs59923692
NM_000038.5(APC):c.-30467A>C rs190326008
NM_000038.5(APC):c.-30467A>G rs190326008
NM_000038.5(APC):c.-30471A>C rs75580617
NM_000038.5(APC):c.-30476T>C rs538243333
NM_000038.5(APC):c.-30476T>G rs538243333
NM_000038.5(APC):c.-30478T>C rs931845291
NM_000038.5(APC):c.-30479C>A rs1424887097
NM_000038.5(APC):c.-30482G>C rs1409487828
NM_000038.5(APC):c.-30484C>A rs1554060161
NM_000038.5(APC):c.-30486C>G rs748588164
NM_000038.5(APC):c.-30487T>A rs1312495728
NM_000038.5(APC):c.-30487T>C rs1312495728
NM_000038.5(APC):c.-30490T>C rs1280021363
NM_000038.5(APC):c.-30492T>C rs866427693
NM_000038.5(APC):c.-30493C>T rs942777534
NM_000038.5(APC):c.-30500T>C rs1213502095
NM_000038.5(APC):c.-30501A>G rs911239343
NM_000038.5(APC):c.-30501A>T rs911239343
NM_000038.5(APC):c.-30502C>A rs1313658633
NM_000038.5(APC):c.-30502C>T rs1313658633
NM_000038.5(APC):c.-30503G>A rs979191484
NM_000038.5(APC):c.-30506T>C rs1279143171
NM_000038.5(APC):c.-30526A>C rs372923973
NM_000038.5(APC):c.-30526A>G rs372923973
NM_000038.5(APC):c.-30528G>T rs1373788988
NM_000038.5(APC):c.-30530G>A rs1432662523
NM_000038.5(APC):c.-30530G>T rs1432662523
NM_000038.5(APC):c.-30531A>T rs1345543059
NM_000038.5(APC):c.-30532A>C rs1012461653
NM_000038.5(APC):c.-30532A>T rs1012461653
NM_000038.5(APC):c.-30535G>C rs1020543876
NM_000038.5(APC):c.-30536C>G rs989021062
NM_000038.5(APC):c.-30540T>A rs1248905809
NM_000038.5(APC):c.-30540T>C rs1248905809
NM_000038.5(APC):c.-30541G>C rs1035047381
NM_000038.5(APC):c.-30543C>G rs1554060135
NM_000038.5(APC):c.-30547G>T rs1554060134
NM_000038.5(APC):c.-30550A>G rs571137741
NM_000038.5(APC):c.-30551C>G rs994601309
NM_000038.5(APC):c.-30555A>C rs1257642100
NM_000038.5(APC):c.-30558G>C rs1351477360
NM_000038.5(APC):c.-30559G>C rs1192399402
NM_000038.5(APC):c.-30560G>A rs1554060128
NM_000038.5(APC):c.-30560G>C rs1554060128
NM_000038.5(APC):c.-30568T>C rs1218378018
NM_000038.5(APC):c.-30569A>G rs13180781
NM_000038.5(APC):c.-30573A>G rs1554060123
NM_000038.5(APC):c.-30574C>T rs1273083857
NM_000038.5(APC):c.-30576G>A rs1320184514
NM_000038.5(APC):c.-30577A>G rs1046974767
NM_000038.5(APC):c.-30578T>C rs929883108
NM_000038.5(APC):c.-30579C>T rs1554060114
NM_000038.5(APC):c.-30585G>T rs560366894
NM_000038.5(APC):c.-30586C>T rs1554060110
NM_000038.5(APC):c.-30590G>A rs545524187
NM_000038.5(APC):c.-30593T>C rs1554060105
NM_000038.5(APC):c.-30603G>C rs1554060097
NM_000038.5(APC):c.-30605A>T rs1554060095
NM_000038.5(APC):c.-30608A>G rs1554060092
NM_000038.5(APC):c.-30608A>T rs1554060092
NM_000038.5(APC):c.-30610C>T rs1554060091
NM_000038.5(APC):c.-30611G>T rs1554060090
NM_000038.5(APC):c.-30626C>G rs931897682
NM_000038.5(APC):c.-30632C>T rs185951958
NM_000038.5(APC):c.-43A>C rs879254014
NM_000038.5(APC):c.-633A>T rs75581138
NM_000038.5(APC):c.-85_*2113del
NM_000038.5(APC):c.1002G>C (p.Leu334Phe) rs928733098
NM_000038.5(APC):c.1005A>C (p.Leu335=) rs3797704
NM_000038.5(APC):c.1005A>G (p.Leu335=) rs3797704
NM_000038.5(APC):c.1015A>G (p.Ser339Gly) rs1060503301
NM_000038.5(APC):c.1016G>A (p.Ser339Asn) rs1554079972
NM_000038.5(APC):c.1023A>G (p.Gln341=) rs774764623
NM_000038.5(APC):c.1026C>T (p.Asp342=) rs1168959523
NM_000038.5(APC):c.1031G>C (p.Cys344Ser) rs786201840
NM_000038.5(APC):c.1043G>A (p.Arg348Gln) rs1402950946
NM_000038.5(APC):c.1050T>G (p.Ser350=) rs760345157
NM_000038.5(APC):c.1059_1060insAAGGATGATAT (p.Pro354Lysfs) rs1554079996
NM_000038.5(APC):c.1060C>A (p.Pro354Thr)
NM_000038.5(APC):c.1061C>A (p.Pro354His) rs1060503337
NM_000038.5(APC):c.1061C>T (p.Pro354Leu) rs1060503337
NM_000038.5(APC):c.1072C>T (p.Gln358Ter) rs863224455
NM_000038.5(APC):c.108delA (p.Lys36Asnfs) rs1554067141
NM_000038.5(APC):c.1096G>A (p.Asp366Asn) rs199562537
NM_000038.5(APC):c.1097A>C (p.Asp366Ala) rs1554080010
NM_000038.5(APC):c.10G>C (p.Ala4Pro) rs774219012
NM_000038.5(APC):c.1100_1101delCT (p.Ser367Cysfs) rs387906237
NM_000038.5(APC):c.1102G>T (p.Val368Leu) rs914534364
NM_000038.5(APC):c.1102_1103delGT (p.Val368Ilefs) rs1554080016
NM_000038.5(APC):c.1111G>C (p.Gly371Arg) rs863224535
NM_000038.5(APC):c.1111G>T (p.Gly371Ter)
NM_000038.5(APC):c.1114A>G (p.Asn372Asp) rs201478136
NM_000038.5(APC):c.1120C>T (p.Arg374Trp) rs947634162
NM_000038.5(APC):c.1121G>A (p.Arg374Gln) rs141582813
NM_000038.5(APC):c.1122G>A (p.Arg374=) rs780123034
NM_000038.5(APC):c.1136C>G (p.Ala379Gly) rs1060503308
NM_000038.5(APC):c.1139G>A (p.Arg380Gln) rs587782886
NM_000038.5(APC):c.1155A>C (p.Ala385=) rs1554080041
NM_000038.5(APC):c.1158A>G (p.Ala386=) rs370669642
NM_000038.5(APC):c.1168A>G (p.Ile390Val) rs1060503345
NM_000038.5(APC):c.1177T>C (p.Ser393Pro) rs1060503352
NM_000038.5(APC):c.1188T>C (p.Asp396=) rs1554080056
NM_000038.5(APC):c.1192A>C (p.Lys398Gln) rs765196085
NM_000038.5(APC):c.1192_1193delAA (p.Lys398Glufs) rs387906238
NM_000038.5(APC):c.1193A>G (p.Lys398Arg) rs145912662
NM_000038.5(APC):c.1203G>T (p.Arg401Ser) rs587780589
NM_000038.5(APC):c.1204C>T (p.Arg402Cys) rs876660612
NM_000038.5(APC):c.1205G>A (p.Arg402His) rs878853416
NM_000038.5(APC):c.120G>A (p.Glu40=) rs142720069
NM_000038.5(APC):c.1210delA (p.Ile404Serfs) rs1064794225
NM_000038.5(APC):c.1213C>T (p.Arg405Ter) rs587779780
NM_000038.5(APC):c.121G>A (p.Ala41Thr) rs1554067157
NM_000038.5(APC):c.1229dupT (p.Leu410Phefs) rs863225308
NM_000038.5(APC):c.1234C>T (p.Gln412Ter) rs876660802
NM_000038.5(APC):c.1239dupA (p.Arg414Thrfs) rs879254088
NM_000038.5(APC):c.1240C>A (p.Arg414Ser) rs137854567
NM_000038.5(APC):c.1240C>G (p.Arg414Gly)
NM_000038.5(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.5(APC):c.1241G>A (p.Arg414His) rs730881233
NM_000038.5(APC):c.1242C>T (p.Arg414=) rs751423790
NM_000038.5(APC):c.1243G>A (p.Ala415Thr) rs756336949
NM_000038.5(APC):c.1246dupT (p.Tyr416Leufs) rs1060503366
NM_000038.5(APC):c.1249T>C (p.Cys417Arg) rs1443626644
NM_000038.5(APC):c.1262G>A (p.Trp421Ter) rs559510809
NM_000038.5(APC):c.1264G>A (p.Glu422Lys) rs755069015
NM_000038.5(APC):c.1270C>T (p.Gln424Ter)
NM_000038.5(APC):c.1276G>T (p.Ala426Ser) rs200598389
NM_000038.5(APC):c.1279C>A (p.His427Asn) rs587779781
NM_000038.5(APC):c.1282G>A (p.Glu428Lys) rs1302087242
NM_000038.5(APC):c.1283A>G (p.Glu428Gly) rs750487805
NM_000038.5(APC):c.1286C>T (p.Pro429Leu) rs1003390887
NM_000038.5(APC):c.1289G>A (p.Gly430Asp) rs1060503317
NM_000038.5(APC):c.1291A>G (p.Met431Val) rs730881235
NM_000038.5(APC):c.1292T>C (p.Met431Thr)
NM_000038.5(APC):c.1295A>G (p.Asp432Gly) rs786202283
NM_000038.5(APC):c.1295A>T (p.Asp432Val) rs786202283
NM_000038.5(APC):c.1298A>G (p.Gln433Arg) rs1064793424
NM_000038.5(APC):c.1300G>A (p.Asp434Asn) rs769365014
NM_000038.5(APC):c.1309C>G (p.Pro437Ala) rs1554080176
NM_000038.5(APC):c.1311_1312+1del rs397514030
NM_000038.5(APC):c.1312+16T>A rs376965806
NM_000038.5(APC):c.1312+3A>G rs863225311
NM_000038.5(APC):c.1312+3_1312+4delAT rs730881228
NM_000038.5(APC):c.1312+5G>A rs886039507
NM_000038.5(APC):c.1313-10T>C rs373744889
NM_000038.5(APC):c.1313-2A>G
NM_000038.5(APC):c.1313-8T>A rs1060504892
NM_000038.5(APC):c.1313-9A>G rs368494354
NM_000038.5(APC):c.1317A>G (p.Pro439=) rs761821491
NM_000038.5(APC):c.1321C>A (p.Pro441Thr) rs1444245614
NM_000038.5(APC):c.132dup (p.Lys45Glufs)
NM_000038.5(APC):c.1332T>G (p.His444Gln) rs773087899
NM_000038.5(APC):c.1342C>G (p.Pro448Ala) rs374195067
NM_000038.5(APC):c.1343C>G (p.Pro448Arg)
NM_000038.5(APC):c.1344T>A (p.Pro448=) rs752774532
NM_000038.5(APC):c.1348G>T (p.Val450Leu)
NM_000038.5(APC):c.135+1G>T rs750508765
NM_000038.5(APC):c.135+8G>C rs1554067166
NM_000038.5(APC):c.1350G>A (p.Val450=) rs1554080701
NM_000038.5(APC):c.1354_1355delGT (p.Val452Serfs) rs1554080698
NM_000038.5(APC):c.1357C>G (p.Leu453Val)
NM_000038.5(APC):c.136-1G>A rs1554069481
NM_000038.5(APC):c.136-3C>T rs1060503361
NM_000038.5(APC):c.1366C>G (p.Leu456Val) rs876660195
NM_000038.5(APC):c.1369T>G (p.Ser457Ala) rs1554080710
NM_000038.5(APC):c.1369del (p.Ser457Hisfs) rs387906229
NM_000038.5(APC):c.1370C>A (p.Ser457Ter) rs1060503333
NM_000038.5(APC):c.1370C>G (p.Ser457Ter) rs1060503333
NM_000038.5(APC):c.1385A>G (p.His462Arg)
NM_000038.5(APC):c.1392T>C (p.His464=) rs1057524073
NM_000038.5(APC):c.1393G>T (p.Ala465Ser) rs863224536
NM_000038.5(APC):c.1396A>G (p.Met466Val) rs781364007
NM_000038.5(APC):c.1398G>A (p.Met466Ile) rs878853417
NM_000038.5(APC):c.139G>A (p.Val47Ile) rs969611536
NM_000038.5(APC):c.1402G>A (p.Glu468Lys) rs1060503340
NM_000038.5(APC):c.1402G>T (p.Glu468Ter) rs1060503340
NM_000038.5(APC):c.1405C>T (p.Leu469=) rs746293695
NM_000038.5(APC):c.1408+3A>G rs534358523
NM_000038.5(APC):c.1408+5G>A rs779919032
NM_000038.5(APC):c.1409-17T>G rs764042245
NM_000038.5(APC):c.1409-2A>G rs1064794163
NM_000038.5(APC):c.1409-5A>G rs768109346
NM_000038.5(APC):c.1409-?_*(1_?)del
NM_000038.5(APC):c.1409G>A (p.Gly470Glu)
NM_000038.5(APC):c.1411G>A (p.Gly471Arg) rs1554081633
NM_000038.5(APC):c.1412G>T (p.Gly471Val) rs1191271600
NM_000038.5(APC):c.1415dup (p.Gln473Thrfs)
NM_000038.5(APC):c.1416A>G (p.Leu472=) rs1554081635
NM_000038.5(APC):c.1417C>T (p.Gln473Ter) rs876658868
NM_000038.5(APC):c.1419G>A (p.Gln473=) rs141579422
NM_000038.5(APC):c.1424T>C (p.Ile475Thr) rs1554081639
NM_000038.5(APC):c.1435T>A (p.Leu479Met) rs780577693
NM_000038.5(APC):c.1440A>C (p.Gln480His) rs863224537
NM_000038.5(APC):c.1440A>T (p.Gln480His) rs863224537
NM_000038.5(APC):c.1441G>A (p.Val481Met) rs587780542
NM_000038.5(APC):c.1443G>A (p.Val481=) rs146179851
NM_000038.5(APC):c.1444G>A (p.Asp482Asn) rs1554081666
NM_000038.5(APC):c.1449_1450delTG (p.Cys483Terfs) rs1554081669
NM_000038.5(APC):c.1455G>A (p.Met485Ile) rs747739964
NM_000038.5(APC):c.1458T>C (p.Tyr486=) rs2229992
NM_000038.5(APC):c.1458T>G (p.Tyr486Ter)
NM_000038.5(APC):c.1462C>T (p.Leu488Phe) rs587779782
NM_000038.5(APC):c.146A>C (p.Lys49Thr) rs587781587
NM_000038.5(APC):c.1471G>A (p.Asp491Asn) rs1554081685
NM_000038.5(APC):c.1478A>G (p.Tyr493Cys) rs770649674
NM_000038.5(APC):c.147_150delACAA (p.Lys49Asnfs) rs587781694
NM_000038.5(APC):c.1480A>G (p.Ser494Gly) rs1554081689
NM_000038.5(APC):c.1481G>A (p.Ser494Asn) rs1554081691
NM_000038.5(APC):c.1481G>C (p.Ser494Thr)
NM_000038.5(APC):c.1483A>G (p.Ile495Val) rs372047677
NM_000038.5(APC):c.1487C>T (p.Thr496Ile) rs1369979539
NM_000038.5(APC):c.1488A>T (p.Thr496=) rs9282599
NM_000038.5(APC):c.1491A>G (p.Leu497=) rs201992951
NM_000038.5(APC):c.1495C>G (p.Arg499Gly) rs137854580
NM_000038.5(APC):c.1495C>T (p.Arg499Ter) rs137854580
NM_000038.5(APC):c.14C>A (p.Ser5Ter) rs373718658
NM_000038.5(APC):c.14C>T (p.Ser5Leu) rs373718658
NM_000038.5(APC):c.14delC (p.Ser5Tyrfs) rs1554067104
NM_000038.5(APC):c.1500T>G (p.Tyr500Ter) rs387906230
NM_000038.5(APC):c.1525A>T (p.Thr509Ser) rs1554081744
NM_000038.5(APC):c.1526delC (p.Thr509Ilefs) rs1064794092
NM_000038.5(APC):c.1530_1548+10delTGGAGATGTAGCCAACAAGGTATGTTTTT rs1554081752
NM_000038.5(APC):c.1538T>C (p.Val513Ala) rs876658167
NM_000038.5(APC):c.1538_1539dup (p.Ala514Terfs) rs1554081762
NM_000038.5(APC):c.1539A>G (p.Val513=) rs766807361
NM_000038.5(APC):c.1548+17T>C rs367690523
NM_000038.5(APC):c.1548+1G>A rs1114167599
NM_000038.5(APC):c.1548+2T>C rs1057517561
NM_000038.5(APC):c.1548G>C (p.Lys516Asn) rs879254090
NM_000038.5(APC):c.1549-9A>C rs1057521553
NM_000038.5(APC):c.1553C>T (p.Thr518Met) rs371453363
NM_000038.5(APC):c.1554G>A (p.Thr518=) rs546568052
NM_000038.5(APC):c.1557A>G (p.Leu519=) rs765537673
NM_000038.5(APC):c.1562C>T (p.Ser521Phe)
NM_000038.5(APC):c.1564A>G (p.Met522Val) rs587781692
NM_000038.5(APC):c.1564dup (p.Met522Asnfs) rs1554081884
NM_000038.5(APC):c.1571G>A (p.Gly524Asp) rs587782868
NM_000038.5(APC):c.1571G>C (p.Gly524Ala) rs587782868
NM_000038.5(APC):c.1580G>C (p.Arg527Thr) rs1554081889
NM_000038.5(APC):c.1587T>C (p.Leu529=) rs1554081894
NM_000038.5(APC):c.1588G>A (p.Val530Met) rs786204178
NM_000038.5(APC):c.1589T>C (p.Val530Ala) rs202199891
NM_000038.5(APC):c.1593C>G (p.Ala531=) rs878853418
NM_000038.5(APC):c.1604C>T (p.Ser535Phe) rs75870842
NM_000038.5(APC):c.1606G>A (p.Glu536Lys) rs138098808
NM_000038.5(APC):c.1610G>A (p.Ser537Asn) rs1001526630
NM_000038.5(APC):c.1616_1623delACTTACAG (p.Asp539Alafs) rs1554081910
NM_000038.5(APC):c.1621C>T (p.Gln541Ter) rs137854572
NM_000038.5(APC):c.1626+2T>C rs876658858
NM_000038.5(APC):c.1626+3A>G rs1060503372
NM_000038.5(APC):c.1626+4C>A rs1202435147
NM_000038.5(APC):c.1627-10T>G rs863224538
NM_000038.5(APC):c.1627-3C>T rs1554082079
NM_000038.5(APC):c.1629T>C (p.Val543=) rs779848042
NM_000038.5(APC):c.1631T>C (p.Ile544Thr) rs144056494
NM_000038.5(APC):c.1632T>C (p.Ile544=) rs758661066
NM_000038.5(APC):c.1633dup (p.Ala545Glyfs) rs1554082082
NM_000038.5(APC):c.1635G>A (p.Ala545=) rs351771
NM_000038.5(APC):c.1639G>A (p.Val547Ile) rs1554082089
NM_000038.5(APC):c.163A>G (p.Ile55Val) rs760158426
NM_000038.5(APC):c.1642T>G (p.Leu548Val) rs1060503373
NM_000038.5(APC):c.1643delT (p.Leu548Terfs) rs1554082091
NM_000038.5(APC):c.1647G>A (p.Arg549=) rs1057521935
NM_000038.5(APC):c.164T>C (p.Ile55Thr) rs1554069530
NM_000038.5(APC):c.1655C>G (p.Ser552Cys)
NM_000038.5(APC):c.1657delT (p.Trp553Glyfs) rs1114167594
NM_000038.5(APC):c.1658G>A (p.Trp553Ter) rs863225318
NM_000038.5(APC):c.1660C>T (p.Arg554Ter) rs137854573
NM_000038.5(APC):c.1673A>G (p.Asn558Ser)
NM_000038.5(APC):c.1680A>G (p.Lys560=) rs1554082120
NM_000038.5(APC):c.1682A>G (p.Lys561Arg)
NM_000038.5(APC):c.1685C>T (p.Thr562Met) rs587783034
NM_000038.5(APC):c.1686G>A (p.Thr562=) rs770256026
NM_000038.5(APC):c.1690C>T (p.Arg564Ter) rs137854574
NM_000038.5(APC):c.1691G>A (p.Arg564Gln) rs747418061
NM_000038.5(APC):c.1695A>G (p.Glu565=) rs77921116
NM_000038.5(APC):c.1705delG (p.Val569Terfs) rs1554082135
NM_000038.5(APC):c.170A>T (p.Asp57Val) rs794729227
NM_000038.5(APC):c.1713A>G (p.Ala571=) rs529306174
NM_000038.5(APC):c.171T>C (p.Asp57=) rs770894012
NM_000038.5(APC):c.1721A>G (p.Glu574Gly)
NM_000038.5(APC):c.1722A>G (p.Glu574=) rs786201277
NM_000038.5(APC):c.1723T>C (p.Cys575Arg) rs1391594497
NM_000038.5(APC):c.1729T>G (p.Leu577Val) rs1060503284
NM_000038.5(APC):c.1739A>G (p.Lys580Arg)
NM_000038.5(APC):c.1742delA (p.Lys581Argfs) rs1060503259
NM_000038.5(APC):c.1743+1G>A rs761458613
NM_000038.5(APC):c.1743+1G>T rs761458613
NM_000038.5(APC):c.1743+6T>A
NM_000038.5(APC):c.1743+6T>C rs766973462
NM_000038.5(APC):c.1744-11_1744-1del rs1064792977
NM_000038.5(APC):c.1744-14C>A rs761403505
NM_000038.5(APC):c.1744-14_1744-13delCT rs1554083086
NM_000038.5(APC):c.1744-2A>G rs587783035
NM_000038.5(APC):c.1746A>G (p.Glu582=) rs876658969
NM_000038.5(APC):c.1747T>G (p.Ser583Ala) rs1060503379
NM_000038.5(APC):c.1759delA (p.Ser587Alafs) rs1554083100
NM_000038.5(APC):c.1759dupA (p.Ser587Lysfs) rs1554083100
NM_000038.5(APC):c.1761C>T (p.Ser587=) rs370783137
NM_000038.5(APC):c.1762G>A (p.Val588Ile) rs372416031
NM_000038.5(APC):c.1762G>C (p.Val588Leu)
NM_000038.5(APC):c.1763T>C (p.Val588Ala) rs1060503374
NM_000038.5(APC):c.1776A>T (p.Leu592Phe) rs1554083127
NM_000038.5(APC):c.1778G>A (p.Trp593Ter) rs1064794226
NM_000038.5(APC):c.1786T>C (p.Ser596Pro)
NM_000038.5(APC):c.1790C>T (p.Ala597Val)
NM_000038.5(APC):c.180G>A (p.Met60Ile) rs980662480
NM_000038.5(APC):c.1811C>G (p.Ala604Gly) rs370955311
NM_000038.5(APC):c.1813G>A (p.Asp605Asn) rs1060503278
NM_000038.5(APC):c.1817T>C (p.Ile606Thr) rs781337455
NM_000038.5(APC):c.181G>A (p.Ala61Thr) rs786201989
NM_000038.5(APC):c.1824T>A (p.Ala608=)
NM_000038.5(APC):c.1825G>A (p.Val609Ile) rs147863331
NM_000038.5(APC):c.1829A>G (p.Asp610Gly) rs756090401
NM_000038.5(APC):c.1829delA (p.Asp610Valfs)
NM_000038.5(APC):c.1854C>T (p.Gly618=) rs780188104
NM_000038.5(APC):c.1857T>C (p.Thr619=) rs1554083170
NM_000038.5(APC):c.1863T>C (p.Thr621=) rs72541808
NM_000038.5(APC):c.1864T>C (p.Tyr622His)
NM_000038.5(APC):c.1865A>T (p.Tyr622Phe) rs1554083183
NM_000038.5(APC):c.1866_1867delCCinsAT (p.Tyr622Ter) rs878853419
NM_000038.5(APC):c.1867C>T (p.Arg623Trp) rs730881238
NM_000038.5(APC):c.1870A>C (p.Ser624Arg)
NM_000038.5(APC):c.1875_1878delGACA (p.Asn627Leufs) rs878853420
NM_000038.5(APC):c.1876A>G (p.Thr626Ala) rs771748555
NM_000038.5(APC):c.1879A>C (p.Asn627His)
NM_000038.5(APC):c.1879_1882delAACA (p.Asn627Leufs) rs1060503360
NM_000038.5(APC):c.187_189delTCT (p.Ser63del) rs876660575
NM_000038.5(APC):c.1880A>G (p.Asn627Ser)
NM_000038.5(APC):c.1885_1886insA (p.Leu629Tyrfs) rs387906233
NM_000038.5(APC):c.1886T>A (p.Leu629Ter)
NM_000038.5(APC):c.1886delT (p.Leu629Terfs) rs863224817
NM_000038.5(APC):c.1886dupT (p.Leu629Phefs) rs863224817
NM_000038.5(APC):c.1892_1904delTTATTGAAAGTGGinsAAT (p.Ile631Lysfs) rs863225319
NM_000038.5(APC):c.18T>C (p.Tyr6=) rs786202301
NM_000038.5(APC):c.1903G>T (p.Gly635Ter) rs1554083205
NM_000038.5(APC):c.1904G>C (p.Gly635Ala) rs730881239
NM_000038.5(APC):c.1914A>G (p.Ile638Met) rs587781405
NM_000038.5(APC):c.1917dupA (p.Arg640Thrfs) rs397515732
NM_000038.5(APC):c.1919G>A (p.Arg640Gln) rs1273594465
NM_000038.5(APC):c.191G>A (p.Gly64Glu) rs878853421
NM_000038.5(APC):c.1925T>C (p.Val642Ala) rs759528091
NM_000038.5(APC):c.1928C>T (p.Ser643Phe) rs1060503291
NM_000038.5(APC):c.1952A>G (p.Asp651Gly) rs1554083260
NM_000038.5(APC):c.1953C>G (p.Asp651Glu) rs765308810
NM_000038.5(APC):c.1956C>T (p.His652=) rs1064793716
NM_000038.5(APC):c.1957A>G (p.Arg653Gly) rs1114167580
NM_000038.5(APC):c.1958+10G>T rs375175370
NM_000038.5(APC):c.1958+1_1958+4dupGTAT rs1060503356
NM_000038.5(APC):c.1958+27delT rs1402242990
NM_000038.5(APC):c.1958+5A>G rs762899641
NM_000038.5(APC):c.1958+6T>C rs368421386
NM_000038.5(APC):c.1958+8T>C rs62626346
NM_000038.5(APC):c.1958G>A (p.Arg653Lys) rs1060503318
NM_000038.5(APC):c.1958G>T (p.Arg653Met) rs1060503318
NM_000038.5(APC):c.1959-1G>A rs863225321
NM_000038.5(APC):c.1959G>A (p.Arg653=) rs72541809
NM_000038.5(APC):c.1960C>G (p.Gln654Glu) rs755105138
NM_000038.5(APC):c.1962A>G (p.Gln654=) rs1057523515
NM_000038.5(APC):c.1965C>T (p.Ile655=) rs765309567
NM_000038.5(APC):c.1966C>G (p.Leu656Val) rs577466163
NM_000038.5(APC):c.1972_1975delGAGA (p.Glu658Thrfs) rs863225322
NM_000038.5(APC):c.1974G>A (p.Glu658=) rs747442953
NM_000038.5(APC):c.1974_1975delGA (p.Asn659Glnfs) rs863225322
NM_000038.5(APC):c.1980C>T (p.Asn660=) rs1554083856
NM_000038.5(APC):c.1983T>A (p.Cys661Ter) rs1554083862
NM_000038.5(APC):c.1984C>A (p.Leu662Ile) rs756859993
NM_000038.5(APC):c.1987C>T (p.Gln663Ter) rs730881240
NM_000038.5(APC):c.1989A>G (p.Gln663=) rs864622539
NM_000038.5(APC):c.1999C>T (p.Gln667Ter) rs876660130
NM_000038.5(APC):c.2002C>T (p.His668Tyr) rs876660307
NM_000038.5(APC):c.2004delC (p.Leu669Terfs) rs587782303
NM_000038.5(APC):c.2021T>A (p.Leu674Ter) rs1554083898
NM_000038.5(APC):c.2026A>G (p.Ile676Val) rs745529713
NM_000038.5(APC):c.2031C>T (p.Val677=) rs769363082
NM_000038.5(APC):c.2031_2034delCAGT (p.Ser678Metfs) rs878853422
NM_000038.5(APC):c.2033G>C (p.Ser678Thr) rs1554083916
NM_000038.5(APC):c.2040A>G (p.Ala680=) rs1276616448
NM_000038.5(APC):c.2047A>G (p.Thr683Ala) rs749130507
NM_000038.5(APC):c.2063C>A (p.Ser688Ter) rs1554083930
NM_000038.5(APC):c.2068A>G (p.Arg690Gly)
NM_000038.5(APC):c.2069G>A (p.Arg690Lys) rs878853423
NM_000038.5(APC):c.2073T>C (p.Asn691=) rs768685742
NM_000038.5(APC):c.207A>G (p.Leu69=) rs1554069552
NM_000038.5(APC):c.2090C>T (p.Ala697Val) rs761733547
NM_000038.5(APC):c.2092T>G (p.Leu698Val) rs1060503279
NM_000038.5(APC):c.2094A>G (p.Leu698=) rs1426881729
NM_000038.5(APC):c.2094A>T (p.Leu698Phe)
NM_000038.5(APC):c.2096G>A (p.Trp699Ter) rs1060503336
NM_000038.5(APC):c.2097G>A (p.Trp699Ter) rs1060503282
NM_000038.5(APC):c.2097G>C (p.Trp699Cys) rs1060503282
NM_000038.5(APC):c.2098delG (p.Asp700Thrfs) rs1060503305
NM_000038.5(APC):c.209A>G (p.Glu70Gly) rs863224539
NM_000038.5(APC):c.20A>G (p.Asp7Gly) rs1060503296
NM_000038.5(APC):c.2101A>T (p.Met701Leu)
NM_000038.5(APC):c.2103G>T (p.Met701Ile)
NM_000038.5(APC):c.2105G>A (p.Gly702Glu) rs876658289
NM_000038.5(APC):c.2107delG (p.Ala703Glnfs) rs587783030
NM_000038.5(APC):c.2110G>A (p.Val704Ile) rs367804502
NM_000038.5(APC):c.2111T>G (p.Val704Gly) rs1554083952
NM_000038.5(APC):c.2114G>C (p.Ser705Thr) rs752874220
NM_000038.5(APC):c.211C>A (p.Arg71Ser) rs767741687
NM_000038.5(APC):c.2123A>G (p.Lys708Arg) rs587778030
NM_000038.5(APC):c.212G>A (p.Arg71His) rs750503329
NM_000038.5(APC):c.2133delT (p.His712Ilefs) rs1060503321
NM_000038.5(APC):c.2145C>T (p.His715=) rs1060504877
NM_000038.5(APC):c.2160G>A (p.Met720Ile) rs1283428855
NM_000038.5(APC):c.2180G>A (p.Arg727Lys) rs1215349287
NM_000038.5(APC):c.2185C>G (p.Leu729Val) rs1554083995
NM_000038.5(APC):c.2191G>A (p.Ala731Thr) rs1318557130
NM_000038.5(APC):c.2196T>C (p.Asn732=) rs781693283
NM_000038.5(APC):c.220+10_220+12delAAA rs864622493
NM_000038.5(APC):c.220+2T>A rs587781809
NM_000038.5(APC):c.220+5A>G rs1554069584
NM_000038.5(APC):c.2204C>T (p.Ala735Val) rs147655929
NM_000038.5(APC):c.2205G>A (p.Ala735=) rs141001261
NM_000038.5(APC):c.2209T>C (p.Tyr737His) rs748868815
NM_000038.5(APC):c.220G>C (p.Glu74Gln) rs876658941
NM_000038.5(APC):c.220G>T (p.Glu74Ter) rs876658941
NM_000038.5(APC):c.221-16T>C rs1046591128
NM_000038.5(APC):c.221-1G>C rs863225327
NM_000038.5(APC):c.221-2A>G rs786201291
NM_000038.5(APC):c.221-5T>G rs1057524155
NM_000038.5(APC):c.2213A>G (p.Lys738Arg)
NM_000038.5(APC):c.2218G>A (p.Ala740Thr) rs587781394
NM_000038.5(APC):c.2218G>C (p.Ala740Pro) rs587781394
NM_000038.5(APC):c.221A>C (p.Glu74Ala) rs773347338
NM_000038.5(APC):c.2220C>A (p.Ala740=) rs878853424
NM_000038.5(APC):c.2221A>G (p.Asn741Asp) rs1554084021
NM_000038.5(APC):c.2222A>G (p.Asn741Ser) rs150209825
NM_000038.5(APC):c.2228T>C (p.Met743Thr)
NM_000038.5(APC):c.2228T>G (p.Met743Arg) rs878853425
NM_000038.5(APC):c.222G>C (p.Glu74Asp)
NM_000038.5(APC):c.2232T>G (p.Ser744=) rs145751759
NM_000038.5(APC):c.2235T>C (p.Pro745=) rs1554084034
NM_000038.5(APC):c.2240C>G (p.Ser747Ter) rs773020689
NM_000038.5(APC):c.2240C>T (p.Ser747Leu) rs773020689
NM_000038.5(APC):c.2245T>A (p.Leu749Met) rs976000214
NM_000038.5(APC):c.2249C>T (p.Pro750Leu) rs759703170
NM_000038.5(APC):c.224T>C (p.Leu75Pro) rs995081817
NM_000038.5(APC):c.2250A>T (p.Pro750=) rs376526724
NM_000038.5(APC):c.2254C>G (p.Leu752Val)
NM_000038.5(APC):c.2259T>G (p.His753Gln) rs763155470
NM_000038.5(APC):c.2260G>A (p.Val754Ile) rs764099150
NM_000038.5(APC):c.2260G>T (p.Val754Phe) rs764099150
NM_000038.5(APC):c.2262T>C (p.Val754=) rs148987776
NM_000038.5(APC):c.2262T>G (p.Val754=) rs148987776
NM_000038.5(APC):c.2277C>T (p.Ala759=) rs762441650
NM_000038.5(APC):c.2280A>G (p.Leu760=) rs767947015
NM_000038.5(APC):c.228C>T (p.Asn76=) rs766325173
NM_000038.5(APC):c.2295T>C (p.Asp765=) rs1060504869
NM_000038.5(APC):c.2297C>T (p.Ala766Val) rs200339830
NM_000038.5(APC):c.2299C>T (p.Gln767Ter)
NM_000038.5(APC):c.2300A>G (p.Gln767Arg) rs1554084064
NM_000038.5(APC):c.2303A>C (p.His768Pro) rs1060503322
NM_000038.5(APC):c.2307A>T (p.Leu769Phe)
NM_000038.5(APC):c.2308T>C (p.Ser770Pro) rs587781419
NM_000038.5(APC):c.2309C>G (p.Ser770Ter) rs1060503310
NM_000038.5(APC):c.2314delA (p.Thr772Leufs) rs878853426
NM_000038.5(APC):c.2320G>C (p.Asp774His)
NM_000038.5(APC):c.2322C>T (p.Asp774=) rs145792879
NM_000038.5(APC):c.2323A>G (p.Asn775Asp) rs1554084074
NM_000038.5(APC):c.2325T>C (p.Asn775=) rs779918968
NM_000038.5(APC):c.2335T>C (p.Leu779=) rs369138788
NM_000038.5(APC):c.2336T>G (p.Leu779Ter)
NM_000038.5(APC):c.2338delA (p.Ser780Valfs)
NM_000038.5(APC):c.233A>C (p.Asp78Ala) rs562833260
NM_000038.5(APC):c.233_236delATAG (p.Asp78Alafs) rs1064793020
NM_000038.5(APC):c.2341C>T (p.Pro781Ser) rs1060503302
NM_000038.5(APC):c.2346G>A (p.Lys782=) rs1554084084
NM_000038.5(APC):c.2347G>T (p.Ala783Ser) rs587780590
NM_000038.5(APC):c.2356C>T (p.Arg786Cys) rs1165139414
NM_000038.5(APC):c.2357G>A (p.Arg786His) rs1554084088
NM_000038.5(APC):c.2359A>G (p.Ser787Gly) rs748075979
NM_000038.5(APC):c.2360G>A (p.Ser787Asn) rs910898245
NM_000038.5(APC):c.2361T>C (p.Ser787=) rs1339834096
NM_000038.5(APC):c.2365C>T (p.Gln789Ter) rs398123117
NM_000038.5(APC):c.2369_2370dup (p.His791Aspfs) rs1554084100
NM_000038.5(APC):c.236G>A (p.Ser79Asn) rs1554069689
NM_000038.5(APC):c.2371C>G (p.His791Asp) rs1060503309
NM_000038.5(APC):c.2378A>G (p.Gln793Arg) rs1356210683
NM_000038.5(APC):c.2379A>C (p.Gln793His)
NM_000038.5(APC):c.2379A>G (p.Gln793=) rs1554084111
NM_000038.5(APC):c.2382_2383del (p.Tyr796Trpfs)
NM_000038.5(APC):c.2383C>A (p.Leu795Ile)
NM_000038.5(APC):c.2385C>T (p.Leu795=) rs80188155
NM_000038.5(APC):c.2408C>T (p.Thr803Ile) rs587780591
NM_000038.5(APC):c.2410A>T (p.Asn804Tyr) rs1382294216
NM_000038.5(APC):c.2411A>G (p.Asn804Ser) rs775727621
NM_000038.5(APC):c.2413C>G (p.Arg805Gly) rs587779783
NM_000038.5(APC):c.2413C>T (p.Arg805Ter) rs587779783
NM_000038.5(APC):c.2414G>A (p.Arg805Gln) rs200593940
NM_000038.5(APC):c.2417A>G (p.His806Arg)
NM_000038.5(APC):c.2418T>A (p.His806Gln) rs372917037
NM_000038.5(APC):c.2420A>G (p.Asp807Gly) rs1060503347
NM_000038.5(APC):c.2422_2424delGAT (p.Asp808del) rs587781469
NM_000038.5(APC):c.2433A>G (p.Ser811=) rs768177978
NM_000038.5(APC):c.2438A>G (p.Asn813Ser) rs201522866
NM_000038.5(APC):c.2438A>T (p.Asn813Ile) rs201522866
NM_000038.5(APC):c.2441T>G (p.Phe814Cys) rs864622282
NM_000038.5(APC):c.2444A>C (p.Asn815Thr) rs762990578
NM_000038.5(APC):c.2453A>C (p.Asn818Thr)
NM_000038.5(APC):c.245T>C (p.Phe82Ser) rs1179254201
NM_000038.5(APC):c.2461G>A (p.Val821Ile) rs138498551
NM_000038.5(APC):c.2465T>C (p.Leu822Pro) rs777748272
NM_000038.5(APC):c.2466_2467insA (p.Ser823Ilefs)
NM_000038.5(APC):c.2472A>G (p.Pro824=) rs746965994
NM_000038.5(APC):c.2472A>T (p.Pro824=) rs746965994
NM_000038.5(APC):c.2474A>G (p.Tyr825Cys) rs186641437
NM_000038.5(APC):c.2476T>G (p.Leu826Val) rs145245264
NM_000038.5(APC):c.2481T>C (p.Asn827=) rs749477816
NM_000038.5(APC):c.2483C>T (p.Thr828Ile) rs786203696
NM_000038.5(APC):c.2483delC (p.Thr828Ilefs) rs886042600
NM_000038.5(APC):c.2485A>G (p.Thr829Ala) rs768810807
NM_000038.5(APC):c.2485delA (p.Thr829Glnfs)
NM_000038.5(APC):c.2488G>C (p.Val830Leu) rs1554084209
NM_000038.5(APC):c.2492T>C (p.Leu831Ser) rs878853427
NM_000038.5(APC):c.2494C>G (p.Pro832Ala) rs1554084213
NM_000038.5(APC):c.2497A>C (p.Ser833Arg) rs1331549900
NM_000038.5(APC):c.2499C>G (p.Ser833Arg) rs1554084221
NM_000038.5(APC):c.249delT (p.Gly84Glufs) rs878853428
NM_000038.5(APC):c.2500T>C (p.Ser834Pro) rs786203408
NM_000038.5(APC):c.2503T>C (p.Ser835Pro) rs748302469
NM_000038.5(APC):c.2527A>G (p.Ser843Gly) rs536223189
NM_000038.5(APC):c.2531C>A (p.Ser844Tyr) rs1554084247
NM_000038.5(APC):c.2534G>A (p.Arg845His) rs776878597
NM_000038.5(APC):c.2538T>A (p.Ser846=) rs759201675
NM_000038.5(APC):c.2544A>G (p.Lys848=)
NM_000038.5(APC):c.2545G>A (p.Asp849Asn) rs752193945
NM_000038.5(APC):c.2546A>G (p.Asp849Gly) rs876660629
NM_000038.5(APC):c.2547T>G (p.Asp849Glu) rs766086010
NM_000038.5(APC):c.2552G>A (p.Ser851Asn) rs1554084260
NM_000038.5(APC):c.2559G>A (p.Glu853=) rs1554084265
NM_000038.5(APC):c.2566C>T (p.Arg856Cys) rs566005215
NM_000038.5(APC):c.2568C>T (p.Arg856=) rs751433216
NM_000038.5(APC):c.2569G>A (p.Gly857Arg) rs745692178
NM_000038.5(APC):c.2570G>T (p.Gly857Val) rs1554084270
NM_000038.5(APC):c.2575G>C (p.Gly859Arg) rs919202692
NM_000038.5(APC):c.2584A>G (p.Asn862Asp) rs755221428
NM_000038.5(APC):c.2585A>G (p.Asn862Ser) rs779334785
NM_000038.5(APC):c.2586C>G (p.Asn862Lys) rs147972247
NM_000038.5(APC):c.2587T>A (p.Tyr863Asn) rs1554084288
NM_000038.5(APC):c.2588A>G (p.Tyr863Cys)
NM_000038.5(APC):c.2593C>G (p.Pro865Ala) rs192620988
NM_000038.5(APC):c.2593C>T (p.Pro865Ser) rs192620988
NM_000038.5(APC):c.259C>T (p.Leu87=) rs569640184
NM_000038.5(APC):c.2608C>T (p.Pro870Ser) rs33974176
NM_000038.5(APC):c.260T>C (p.Leu87Pro) rs777456713
NM_000038.5(APC):c.2611G>A (p.Gly871Arg) rs1554084297
NM_000038.5(APC):c.2612G>A (p.Gly871Glu) rs948419955
NM_000038.5(APC):c.2613A>C (p.Gly871=) rs36046448
NM_000038.5(APC):c.2614A>C (p.Thr872Pro) rs1060503294
NM_000038.5(APC):c.2614A>G (p.Thr872Ala)
NM_000038.5(APC):c.2615C>G (p.Thr872Ser) rs1554084311
NM_000038.5(APC):c.2616T>C (p.Thr872=) rs555061955
NM_000038.5(APC):c.2621C>G (p.Ser874Ter) rs1554084318
NM_000038.5(APC):c.2621C>T (p.Ser874Leu)
NM_000038.5(APC):c.2626C>A (p.Arg876=) rs121913333
NM_000038.5(APC):c.2626C>T (p.Arg876Ter) rs121913333
NM_000038.5(APC):c.2627G>A (p.Arg876Gln) rs373428732
NM_000038.5(APC):c.262C>T (p.Arg88Trp) rs746592911
NM_000038.5(APC):c.2631T>A (p.Gly877=) rs762629631
NM_000038.5(APC):c.2635C>T (p.Gln879Ter) rs1060503287
NM_000038.5(APC):c.263G>A (p.Arg88Gln) rs587780592
NM_000038.5(APC):c.2640C>T (p.Ile880=) rs200184105
NM_000038.5(APC):c.2642C>T (p.Ser881Phe) rs535344579
NM_000038.5(APC):c.2644A>G (p.Thr882Ala)
NM_000038.5(APC):c.2645C>T (p.Thr882Ile) rs786203243
NM_000038.5(APC):c.264G>A (p.Arg88=) rs1554069706
NM_000038.5(APC):c.2650G>A (p.Ala884Thr) rs863224540
NM_000038.5(APC):c.2652dup (p.Ala885Serfs)
NM_000038.5(APC):c.2653G>A (p.Ala885Thr) rs1344158460
NM_000038.5(APC):c.2658G>T (p.Gln886His) rs587780593
NM_000038.5(APC):c.2659A>G (p.Ile887Val) rs730881241
NM_000038.5(APC):c.2666A>G (p.Lys889Arg) rs1350986347
NM_000038.5(APC):c.2669T>G (p.Val890Gly) rs878853429
NM_000038.5(APC):c.266C>A (p.Ser89Ter)
NM_000038.5(APC):c.266C>G (p.Ser89Ter) rs876658846
NM_000038.5(APC):c.2670C>A (p.Val890=) rs1554084362
NM_000038.5(APC):c.2672T>C (p.Met891Thr) rs876660004
NM_000038.5(APC):c.2674G>T (p.Glu892Ter)
NM_000038.5(APC):c.2677G>A (p.Glu893Lys) rs199740875
NM_000038.5(APC):c.2677G>T (p.Glu893Ter) rs199740875
NM_000038.5(APC):c.2686_2689dup (p.Ile897Serfs) rs1554084375
NM_000038.5(APC):c.2687C>T (p.Ala896Val) rs864622255
NM_000038.5(APC):c.268A>G (p.Lys90Glu) rs763184444
NM_000038.5(APC):c.2692C>T (p.His898Tyr) rs758712508
NM_000038.5(APC):c.2696C>G (p.Thr899Ser) rs864622670
NM_000038.5(APC):c.2698T>G (p.Ser900Ala)
NM_000038.5(APC):c.2700T>C (p.Ser900=) rs1554084399
NM_000038.5(APC):c.2702A>C (p.Gln901Pro) rs747095991
NM_000038.5(APC):c.2711_2712delGA (p.Arg904Lysfs) rs1554084403
NM_000038.5(APC):c.2716T>G (p.Ser906Ala) rs786204146
NM_000038.5(APC):c.2719G>A (p.Gly907Arg) rs771458366
NM_000038.5(APC):c.2723C>G (p.Ser908Cys) rs746393911
NM_000038.5(APC):c.2725A>G (p.Thr909Ala) rs878853430
NM_000038.5(APC):c.2731G>C (p.Glu911Gln) rs398123119
NM_000038.5(APC):c.2733A>T (p.Glu911Asp) rs770018276
NM_000038.5(APC):c.2739T>C (p.His913=) rs553363502
NM_000038.5(APC):c.2743G>A (p.Val915Met) rs1446823177
NM_000038.5(APC):c.2744T>C (p.Val915Ala)
NM_000038.5(APC):c.2749G>A (p.Asp917Asn)
NM_000038.5(APC):c.274T>G (p.Ser92Ala) rs1554069716
NM_000038.5(APC):c.2754G>A (p.Glu918=) rs767066195
NM_000038.5(APC):c.2758A>G (p.Asn920Asp)
NM_000038.5(APC):c.275C>G (p.Ser92Cys)
NM_000038.5(APC):c.2763A>G (p.Ala921=) rs750259615
NM_000038.5(APC):c.2764C>T (p.Leu922Phe) rs150543576
NM_000038.5(APC):c.2765T>G (p.Leu922Arg) rs878853431
NM_000038.5(APC):c.276C>T (p.Ser92=) rs369238363
NM_000038.5(APC):c.2772_2774delAAG (p.Arg924del) rs1554084439
NM_000038.5(APC):c.2775C>G (p.Ser925Arg) rs864622701
NM_000038.5(APC):c.2778T>C (p.Ser926=) rs371526966
NM_000038.5(APC):c.277C>G (p.Leu93Val) rs201567345
NM_000038.5(APC):c.2780C>G (p.Ala927Gly) rs587781500
NM_000038.5(APC):c.2785C>T (p.His929Tyr) rs1183098771
NM_000038.5(APC):c.278T>A (p.Leu93His) rs876658977
NM_000038.5(APC):c.2790_2791delACinsGTGT (p.His931Cysfs) rs1554084454
NM_000038.5(APC):c.2792A>G (p.His931Arg) rs1554084461
NM_000038.5(APC):c.2795C>A (p.Ser932Ter) rs878853432
NM_000038.5(APC):c.2795C>G (p.Ser932Ter) rs878853432
NM_000038.5(APC):c.2797A>G (p.Asn933Asp) rs1060503270
NM_000038.5(APC):c.2801C>T (p.Thr934Ile)
NM_000038.5(APC):c.2802_2805delTTAC (p.Tyr935Ilefs) rs1131691143
NM_000038.5(APC):c.2804dupA (p.Tyr935Terfs) rs863225332
NM_000038.5(APC):c.2805C>A (p.Tyr935Ter) rs137854575
NM_000038.5(APC):c.2805C>T (p.Tyr935=) rs137854575
NM_000038.5(APC):c.2807A>G (p.Asn936Ser) rs878853433
NM_000038.5(APC):c.280C>A (p.Arg94Ser) rs550945533
NM_000038.5(APC):c.280C>G (p.Arg94Gly) rs550945533
NM_000038.5(APC):c.2812A>G (p.Thr938Ala) rs965844436
NM_000038.5(APC):c.2819C>G (p.Ser940Trp) rs544709767
NM_000038.5(APC):c.2819C>T (p.Ser940Leu) rs544709767
NM_000038.5(APC):c.281G>A (p.Arg94His) rs774229223
NM_000038.5(APC):c.2820G>A (p.Ser940=) rs780366551
NM_000038.5(APC):c.2830A>G (p.Asn944Asp) rs749720558
NM_000038.5(APC):c.2834_2835delGGinsTT (p.Arg945Ile) rs786204162
NM_000038.5(APC):c.2837delC (p.Thr946Asnfs) rs1554084529
NM_000038.5(APC):c.2838A>G (p.Thr946=) rs142835322
NM_000038.5(APC):c.2840G>T (p.Cys947Phe) rs997271472
NM_000038.5(APC):c.2842T>C (p.Ser948Pro) rs1554084533
NM_000038.5(APC):c.2845A>G (p.Met949Val) rs587781348
NM_000038.5(APC):c.2845A>T (p.Met949Leu) rs587781348
NM_000038.5(APC):c.2847G>T (p.Met949Ile) rs147394539
NM_000038.5(APC):c.2855C>A (p.Ala952Asp) rs776560257
NM_000038.5(APC):c.2855C>T (p.Ala952Val) rs776560257
NM_000038.5(APC):c.2860T>C (p.Leu954=) rs863224278
NM_000038.5(APC):c.2863delG (p.Glu955Asnfs) rs1554084553
NM_000038.5(APC):c.2870A>G (p.Lys957Arg) rs777881096
NM_000038.5(APC):c.2876C>T (p.Ser959Phe) rs757526267
NM_000038.5(APC):c.287A>T (p.Tyr96Phe)
NM_000038.5(APC):c.2883T>G (p.Asn961Lys) rs1060503367
NM_000038.5(APC):c.2884delG (p.Asp962Ilefs)
NM_000038.5(APC):c.288T>A (p.Tyr96Ter) rs376213437
NM_000038.5(APC):c.288T>C (p.Tyr96=) rs376213437
NM_000038.5(APC):c.288T>G (p.Tyr96Ter) rs376213437
NM_000038.5(APC):c.2892A>C (p.Leu964Phe) rs1554084570
NM_000038.5(APC):c.2894delA (p.Asn965Ilefs) rs1554084575
NM_000038.5(APC):c.2898T>A (p.Ser966Arg) rs876660579
NM_000038.5(APC):c.2901C>A (p.Val967=) rs1060504876
NM_000038.5(APC):c.2904T>A (p.Ser968Arg) rs1554084582
NM_000038.5(APC):c.2909G>A (p.Ser970Asn) rs767473403
NM_000038.5(APC):c.2910_2911delTG (p.Ser970Argfs) rs1060503307
NM_000038.5(APC):c.2914G>A (p.Gly972Ser)
NM_000038.5(APC):c.2919T>C (p.Tyr973=) rs756609845
NM_000038.5(APC):c.2926A>G (p.Arg976Gly) rs587782846
NM_000038.5(APC):c.2931T>G (p.Gly977=) rs1554084590
NM_000038.5(APC):c.2939_2941delAAC (p.Lys980_Pro981delinsThr) rs772573597
NM_000038.5(APC):c.2942C>G (p.Pro981Arg) rs587779784
NM_000038.5(APC):c.2945C>T (p.Ser982Leu) rs139773221
NM_000038.5(APC):c.2946G>A (p.Ser982=) rs377384463
NM_000038.5(APC):c.2948T>A (p.Ile983Asn) rs113674464
NM_000038.5(APC):c.2948T>C (p.Ile983Thr) rs113674464
NM_000038.5(APC):c.2952A>G (p.Glu984=) rs772562489
NM_000038.5(APC):c.2957A>G (p.Tyr986Cys) rs730881243
NM_000038.5(APC):c.2958T>C (p.Tyr986=) rs746581330
NM_000038.5(APC):c.295C>A (p.Arg99=) rs139196838
NM_000038.5(APC):c.295C>T (p.Arg99Trp) rs139196838
NM_000038.5(APC):c.2963A>C (p.Glu988Ala) rs1554084609
NM_000038.5(APC):c.2966A>G (p.Asp989Gly) rs770976457
NM_000038.5(APC):c.296G>A (p.Arg99Gln) rs199842850
NM_000038.5(APC):c.2975G>C (p.Ser992Thr) rs864622328
NM_000038.5(APC):c.2976T>C (p.Ser992=) rs776646018
NM_000038.5(APC):c.298G>A (p.Glu100Lys)
NM_000038.5(APC):c.298delG (p.Glu100Lysfs) rs1064794224
NM_000038.5(APC):c.2991T>C (p.Tyr997=) rs864622629
NM_000038.5(APC):c.2991T>G (p.Tyr997Ter) rs864622629
NM_000038.5(APC):c.2999_3005delACCCAGC (p.Tyr1000Serfs)
NM_000038.5(APC):c.3006C>T (p.Ala1002=) rs72541810
NM_000038.5(APC):c.3007G>A (p.Asp1003Asn) rs564314108
NM_000038.5(APC):c.300A>G (p.Glu100=) rs1060504888
NM_000038.5(APC):c.3013_3019del7 (p.Ala1005Lysfs) rs1057517553
NM_000038.5(APC):c.3016C>T (p.His1006Tyr) rs879253876
NM_000038.5(APC):c.3022A>G (p.Ile1008Val)
NM_000038.5(APC):c.3025C>T (p.His1009Tyr) rs750459690
NM_000038.5(APC):c.3027T>C (p.His1009=) rs938418357
NM_000038.5(APC):c.3028A>G (p.Ser1010Gly)
NM_000038.5(APC):c.3029G>A (p.Ser1010Asn) rs864622584
NM_000038.5(APC):c.302G>A (p.Gly101Glu)
NM_000038.5(APC):c.3040A>G (p.Met1014Val) rs1554084654
NM_000038.5(APC):c.3045T>C (p.Asp1015=) rs1554084657
NM_000038.5(APC):c.3047A>T (p.Asp1016Val) rs1554084658
NM_000038.5(APC):c.3049_3051delAAT (p.Asn1017del) rs730881229
NM_000038.5(APC):c.3060A>G (p.Glu1020=) rs1057522595
NM_000038.5(APC):c.3068C>T (p.Thr1023Ile)
NM_000038.5(APC):c.3073A>G (p.Ile1025Val) rs370591349
NM_000038.5(APC):c.307G>C (p.Val103Leu) rs758995578
NM_000038.5(APC):c.3080A>G (p.Tyr1027Cys) rs869312784
NM_000038.5(APC):c.3081T>C (p.Tyr1027=) rs878853434
NM_000038.5(APC):c.3083G>T (p.Ser1028Ile) rs1114167617
NM_000038.5(APC):c.3084T>A (p.Ser1028Arg) rs876660265
NM_000038.5(APC):c.3088A>C (p.Lys1030Gln) rs587779786
NM_000038.5(APC):c.3088A>T (p.Lys1030Ter) rs587779786
NM_000038.5(APC):c.3090dup (p.Tyr1031Ilefs) rs1554084685
NM_000038.5(APC):c.309A>G (p.Val103=) rs863224279
NM_000038.5(APC):c.3101A>T (p.Glu1034Val) rs1554084689
NM_000038.5(APC):c.3104A>C (p.Gln1035Pro) rs1060503303
NM_000038.5(APC):c.3105G>T (p.Gln1035His) rs878853435
NM_000038.5(APC):c.3115_3116delGGinsCT (p.Gly1039Leu) rs1554084704
NM_000038.5(APC):c.311C>T (p.Ser104Leu)
NM_000038.5(APC):c.3122A>G (p.Gln1041Arg) rs1554084709
NM_000038.5(APC):c.3123A>G (p.Gln1041=) rs537501804
NM_000038.5(APC):c.3127C>T (p.Pro1043Ser)
NM_000038.5(APC):c.3128C>T (p.Pro1043Leu) rs1030285956
NM_000038.5(APC):c.3131C>T (p.Ser1044Leu) rs1554084719
NM_000038.5(APC):c.3134A>G (p.Gln1045Arg) rs1554084722
NM_000038.5(APC):c.3136A>G (p.Asn1046Asp) rs755493779
NM_000038.5(APC):c.313A>G (p.Ser105Gly) rs776242276
NM_000038.5(APC):c.3140A>G (p.Glu1047Gly) rs1292530466
NM_000038.5(APC):c.3145T>C (p.Trp1049Arg) rs587779787
NM_000038.5(APC):c.3145T>G (p.Trp1049Gly)
NM_000038.5(APC):c.3146G>A (p.Trp1049Ter) rs876658667
NM_000038.5(APC):c.3149delC (p.Ala1050Glufs) rs730882135
NM_000038.5(APC):c.3150A>G (p.Ala1050=) rs1554084742
NM_000038.5(APC):c.3154C>G (p.Pro1052Ala) rs1060503258
NM_000038.5(APC):c.3155C>T (p.Pro1052Leu) rs1060503371
NM_000038.5(APC):c.3157A>G (p.Lys1053Glu) rs1554084758
NM_000038.5(APC):c.3161A>C (p.His1054Pro) rs777538550
NM_000038.5(APC):c.3162del (p.His1054Glnfs) rs397515733
NM_000038.5(APC):c.3164_3168delTAATA (p.Ile1055Argfs) rs1554084772
NM_000038.5(APC):c.3165A>T (p.Ile1055=) rs61734287
NM_000038.5(APC):c.3167T>C (p.Ile1056Thr) rs1554084790
NM_000038.5(APC):c.316C>T (p.Arg106Cys) rs1554069763
NM_000038.5(APC):c.3173A>G (p.Asp1058Gly) rs148725540
NM_000038.5(APC):c.3179_3183delTAAAA (p.Ile1060Thrfs) rs1554084794
NM_000038.5(APC):c.3179_3184del6 (p.Ile1060_Gln1062delinsLys) rs1057517624
NM_000038.5(APC):c.317G>A (p.Arg106His) rs201764637
NM_000038.5(APC):c.3182A>G (p.Lys1061Arg) rs769814905
NM_000038.5(APC):c.3183_3187delACAAA (p.Gln1062Terfs) rs587779352
NM_000038.5(APC):c.3184C>T (p.Gln1062Ter) rs1554084818
NM_000038.5(APC):c.3186A>C (p.Gln1062His) rs1554084821
NM_000038.5(APC):c.3186_3187delAA (p.Ser1063Terfs) rs1060503362
NM_000038.5(APC):c.3189T>C (p.Ser1063=) rs1554084833
NM_000038.5(APC):c.3193C>A (p.Gln1065Lys) rs1330361513
NM_000038.5(APC):c.3196delA (p.Arg1066Aspfs) rs878853436
NM_000038.5(APC):c.3202_3205delTCAA (p.Ser1068Glyfs) rs587779353
NM_000038.5(APC):c.3203C>A (p.Ser1068Ter)
NM_000038.5(APC):c.3205A>G (p.Arg1069Gly) rs375408871
NM_000038.5(APC):c.3207G>T (p.Arg1069Ser)
NM_000038.5(APC):c.3218C>T (p.Thr1073Ile) rs773354366
NM_000038.5(APC):c.3220A>G (p.Thr1074Ala) rs962456431
NM_000038.5(APC):c.3225T>C (p.Tyr1075=) rs768123840
NM_000038.5(APC):c.3227C>G (p.Pro1076Arg) rs766394131
NM_000038.5(APC):c.3229G>C (p.Val1077Leu) rs1332655563
NM_000038.5(APC):c.3241_3242delAG (p.Ser1081Hisfs) rs1060503327
NM_000038.5(APC):c.3242G>A (p.Ser1081Asn) rs374380039
NM_000038.5(APC):c.3245C>G (p.Thr1082Ser) rs730881244
NM_000038.5(APC):c.3245C>T (p.Thr1082Ile) rs730881244
NM_000038.5(APC):c.3249T>G (p.Asp1083Glu) rs201629780
NM_000038.5(APC):c.3254A>C (p.Lys1085Thr)
NM_000038.5(APC):c.3258C>T (p.His1086=) rs778031876
NM_000038.5(APC):c.3264G>A (p.Lys1088=) rs114774495
NM_000038.5(APC):c.3270A>C (p.Gln1090His)
NM_000038.5(APC):c.3270A>G (p.Gln1090=) rs780818655
NM_000038.5(APC):c.3275A>C (p.His1092Pro) rs587779788
NM_000038.5(APC):c.3279T>G (p.Phe1093Leu) rs199539973
NM_000038.5(APC):c.3281G>T (p.Gly1094Val) rs1554084898
NM_000038.5(APC):c.3282A>T (p.Gly1094=) rs1060503290
NM_000038.5(APC):c.3286C>T (p.Gln1096Ter) rs587783029
NM_000038.5(APC):c.3289G>A (p.Glu1097Lys) rs1060503312
NM_000038.5(APC):c.3289G>C (p.Glu1097Gln) rs1060503312
NM_000038.5(APC):c.328T>C (p.Cys110Arg)
NM_000038.5(APC):c.3293G>A (p.Cys1098Tyr)
NM_000038.5(APC):c.3295G>A (p.Val1099Ile) rs730881245
NM_000038.5(APC):c.3298_3301delTCTC (p.Ser1100Hisfs) rs863225341
NM_000038.5(APC):c.3299C>T (p.Ser1100Phe) rs863224541
NM_000038.5(APC):c.3301C>T (p.Pro1101Ser) rs878853437
NM_000038.5(APC):c.3303A>G (p.Pro1101=) rs587780594
NM_000038.5(APC):c.3306C>G (p.Tyr1102Ter) rs879254092
NM_000038.5(APC):c.3308G>A (p.Arg1103Lys)
NM_000038.5(APC):c.330C>T (p.Cys110=) rs1060504887
NM_000038.5(APC):c.3313C>T (p.Arg1105Trp) rs768454793
NM_000038.5(APC):c.3314G>A (p.Arg1105Gln) rs548176472
NM_000038.5(APC):c.3314G>C (p.Arg1105Pro) rs548176472
NM_000038.5(APC):c.3316G>T (p.Gly1106Ter) rs1554084921
NM_000038.5(APC):c.3317G>A (p.Gly1106Glu)
NM_000038.5(APC):c.3319G>T (p.Ala1107Ser) rs1060503283
NM_000038.5(APC):c.3323A>G (p.Asn1108Ser) rs151286353
NM_000038.5(APC):c.332G>A (p.Ser111Asn) rs786202322
NM_000038.5(APC):c.3340C>T (p.Arg1114Ter) rs121913331
NM_000038.5(APC):c.3341G>A (p.Arg1114Gln) rs753209586
NM_000038.5(APC):c.3342A>G (p.Arg1114=) rs786201145
NM_000038.5(APC):c.3343G>A (p.Val1115Met) rs763392909
NM_000038.5(APC):c.3343delG (p.Val1115Trpfs) rs1554084945
NM_000038.5(APC):c.3352A>G (p.Asn1118Asp) rs140493115
NM_000038.5(APC):c.3353A>G (p.Asn1118Ser) rs752011683
NM_000038.5(APC):c.3355C>G (p.His1119Asp) rs1266515539
NM_000038.5(APC):c.3356A>T (p.His1119Leu) rs1554084962
NM_000038.5(APC):c.335C>G (p.Pro112Arg) rs1060503357
NM_000038.5(APC):c.3364A>C (p.Asn1122His) rs1554084967
NM_000038.5(APC):c.3365A>G (p.Asn1122Ser) rs372855304
NM_000038.5(APC):c.3368A>C (p.Gln1123Pro) rs587779789
NM_000038.5(APC):c.3371A>G (p.Asn1124Ser) rs1554084970
NM_000038.5(APC):c.3374T>C (p.Val1125Ala) rs377278397
NM_000038.5(APC):c.3374dup (p.Ser1126Lysfs)
NM_000038.5(APC):c.3378C>G (p.Ser1126Arg) rs149353082
NM_000038.5(APC):c.3381G>T (p.Gln1127His)
NM_000038.5(APC):c.3383C>G (p.Ser1128Cys) rs755586334
NM_000038.5(APC):c.3386T>C (p.Leu1129Ser) rs143638171
NM_000038.5(APC):c.3387G>T (p.Leu1129Phe) rs730881225
NM_000038.5(APC):c.338T>C (p.Val113Ala) rs863224542
NM_000038.5(APC):c.3391C>T (p.Gln1131Ter) rs878853438
NM_000038.5(APC):c.3393A>G (p.Gln1131=) rs545574962
NM_000038.5(APC):c.3396A>T (p.Glu1132Asp)
NM_000038.5(APC):c.3396_3398delAGA (p.Glu1132del) rs1554084984
NM_000038.5(APC):c.3397G>A (p.Asp1133Asn)
NM_000038.5(APC):c.3403T>C (p.Tyr1135His) rs876660502
NM_000038.5(APC):c.3404_3405delAT (p.Tyr1135Terfs) rs864622086
NM_000038.5(APC):c.3407A>C (p.Glu1136Ala) rs878853439
NM_000038.5(APC):c.3415A>C (p.Lys1139Gln) rs201550951
NM_000038.5(APC):c.3419C>G (p.Pro1140Arg) rs1060503351
NM_000038.5(APC):c.3425A>C (p.Asn1142Thr) rs138410865
NM_000038.5(APC):c.3425A>G (p.Asn1142Ser) rs138410865
NM_000038.5(APC):c.3428A>G (p.Tyr1143Cys) rs1419180532
NM_000038.5(APC):c.3433G>C (p.Glu1145Gln) rs1060503375
NM_000038.5(APC):c.3436C>T (p.Arg1146Cys) rs202168805
NM_000038.5(APC):c.3437G>A (p.Arg1146His) rs763486328
NM_000038.5(APC):c.343A>G (p.Met115Val) rs1060503276
NM_000038.5(APC):c.3451_3453delGAA (p.Glu1151del) rs761327787
NM_000038.5(APC):c.3463G>A (p.Glu1155Lys) rs774847322
NM_000038.5(APC):c.3468A>G (p.Glu1156=) rs878853440
NM_000038.5(APC):c.3468_3470delAGA (p.Glu1157del) rs386833391
NM_000038.5(APC):c.3468_3470dupAGA (p.Glu1157_Arg1158insGlu) rs386833391
NM_000038.5(APC):c.3469G>C (p.Glu1157Gln) rs1554085038
NM_000038.5(APC):c.3471G>A (p.Glu1157=) rs143927847
NM_000038.5(APC):c.3471_3474delGAGA (p.Glu1157Aspfs) rs786203020
NM_000038.5(APC):c.3473_3474delGA (p.Arg1158Thrfs) rs786203020
NM_000038.5(APC):c.3473_3474dup (p.Pro1159Aspfs) rs786203020
NM_000038.5(APC):c.3479C>A (p.Thr1160Lys) rs201004111
NM_000038.5(APC):c.347G>A (p.Gly116Asp) rs369999291
NM_000038.5(APC):c.3484T>G (p.Tyr1162Asp) rs1210397302
NM_000038.5(APC):c.3488_3492delGCATA (p.Ser1163Lysfs)
NM_000038.5(APC):c.3506A>G (p.Glu1169Gly) rs1554085069
NM_000038.5(APC):c.350C>A (p.Ser117Ter) rs1064793535
NM_000038.5(APC):c.3511C>T (p.Arg1171Cys) rs201830995
NM_000038.5(APC):c.3512G>A (p.Arg1171His) rs372481703
NM_000038.5(APC):c.3523C>T (p.Gln1175Ter) rs1554085081
NM_000038.5(APC):c.3529A>G (p.Ile1177Val) rs369834416
NM_000038.5(APC):c.3535T>A (p.Tyr1179Asn) rs751249843
NM_000038.5(APC):c.3535T>C (p.Tyr1179His) rs751249843
NM_000038.5(APC):c.3536A>G (p.Tyr1179Cys) rs777568434
NM_000038.5(APC):c.3543A>G (p.Leu1181=) rs746082418
NM_000038.5(APC):c.3548A>G (p.Tyr1183Cys) rs587782689
NM_000038.5(APC):c.3549T>G (p.Tyr1183Ter)
NM_000038.5(APC):c.3552C>T (p.Ala1184=) rs759407858
NM_000038.5(APC):c.3554C>T (p.Thr1185Ile) rs587780595
NM_000038.5(APC):c.3555A>G (p.Thr1185=) rs786201125
NM_000038.5(APC):c.3557A>G (p.Asp1186Gly) rs1060503280
NM_000038.5(APC):c.3557A>T (p.Asp1186Val) rs1060503280
NM_000038.5(APC):c.3559A>G (p.Ile1187Val) rs1554085107
NM_000038.5(APC):c.3560T>C (p.Ile1187Thr) rs730881246
NM_000038.5(APC):c.3562C>A (p.Pro1188Thr) rs1554085113
NM_000038.5(APC):c.3563C>T (p.Pro1188Leu) rs786203540
NM_000038.5(APC):c.3577_3578delCA (p.Gln1193Valfs) rs1060503326
NM_000038.5(APC):c.3578A>G (p.Gln1193Arg) rs1060503260
NM_000038.5(APC):c.3587C>T (p.Ser1196Leu) rs1554085141
NM_000038.5(APC):c.3595A>G (p.Lys1199Glu)
NM_000038.5(APC):c.3595_3596delAA (p.Lys1199Glufs) rs864622106
NM_000038.5(APC):c.3604_3607delTCTG (p.Ser1202Aspfs) rs1408646734
NM_000038.5(APC):c.3605C>G (p.Ser1202Cys)
NM_000038.5(APC):c.3606T>C (p.Ser1202=) rs864622117
NM_000038.5(APC):c.3607G>C (p.Gly1203Arg) rs1057518472
NM_000038.5(APC):c.3611A>G (p.Gln1204Arg)
NM_000038.5(APC):c.3612A>G (p.Gln1204=) rs864622196
NM_000038.5(APC):c.3616A>G (p.Ser1206Gly) rs901866497
NM_000038.5(APC):c.3623C>T (p.Thr1208Ile) rs752590375
NM_000038.5(APC):c.3624C>T (p.Thr1208=) rs730882125
NM_000038.5(APC):c.3625G>A (p.Glu1209Lys) rs201185479
NM_000038.5(APC):c.3628C>T (p.His1210Tyr) rs145181563
NM_000038.5(APC):c.3629A>G (p.His1210Arg) rs756346998
NM_000038.5(APC):c.3629A>T (p.His1210Leu) rs756346998
NM_000038.5(APC):c.362G>T (p.Arg121Ile) rs193049694
NM_000038.5(APC):c.3631A>G (p.Met1211Val) rs780084585
NM_000038.5(APC):c.3631_3632delAT (p.Met1211Valfs) rs1554085190
NM_000038.5(APC):c.3632T>C (p.Met1211Thr) rs575268622
NM_000038.5(APC):c.3632T>G (p.Met1211Arg) rs575268622
NM_000038.5(APC):c.3638C>T (p.Ser1213Leu) rs1554085199
NM_000038.5(APC):c.3639A>G (p.Ser1213=) rs1060504882
NM_000038.5(APC):c.3650A>C (p.Asn1217Thr) rs138933660
NM_000038.5(APC):c.3653C>T (p.Thr1218Met) rs377640390
NM_000038.5(APC):c.3654G>A (p.Thr1218=) rs772743023
NM_000038.5(APC):c.3661C>T (p.Pro1221Ser)
NM_000038.5(APC):c.3662C>G (p.Pro1221Arg)
NM_000038.5(APC):c.3663T>C (p.Pro1221=) rs587780541
NM_000038.5(APC):c.3670_3671dup (p.Asn1224Lysfs)
NM_000038.5(APC):c.3674C>A (p.Ala1225Asp) rs1554085218
NM_000038.5(APC):c.3674C>G (p.Ala1225Gly) rs1554085218
NM_000038.5(APC):c.3689A>G (p.Gln1230Arg) rs764706774
NM_000038.5(APC):c.3693C>T (p.Leu1231=) rs1554085234
NM_000038.5(APC):c.3696T>C (p.His1232=) rs1060504897
NM_000038.5(APC):c.3698C>T (p.Pro1233Leu) rs1060503331
NM_000038.5(APC):c.36A>G (p.Gln12=) rs864622288
NM_000038.5(APC):c.3701G>C (p.Ser1234Thr) rs751533193
NM_000038.5(APC):c.3704C>T (p.Ser1235Phe) rs1554085244
NM_000038.5(APC):c.3708A>G (p.Ala1236=) rs864622694
NM_000038.5(APC):c.370G>A (p.Val124Ile) rs779945112
NM_000038.5(APC):c.3711G>A (p.Gln1237=) rs756939805
NM_000038.5(APC):c.3718A>G (p.Ser1240Gly) rs1554085252
NM_000038.5(APC):c.3722G>A (p.Gly1241Asp) rs1554085255
NM_000038.5(APC):c.372A>G (p.Val124=) rs749179034
NM_000038.5(APC):c.3730C>G (p.Gln1244Glu) rs79122263
NM_000038.5(APC):c.3732A>G (p.Gln1244=) rs74380081
NM_000038.5(APC):c.3739G>A (p.Ala1247Thr) rs148223181
NM_000038.5(APC):c.3743C>T (p.Thr1248Ile) rs878853441
NM_000038.5(APC):c.3745T>A (p.Cys1249Ser)
NM_000038.5(APC):c.3749A>G (p.Lys1250Arg) rs771159136
NM_000038.5(APC):c.3750A>G (p.Lys1250=) rs142728143
NM_000038.5(APC):c.3755C>T (p.Ser1252Phe) rs1554085281
NM_000038.5(APC):c.3760A>G (p.Ile1254Val) rs769504783
NM_000038.5(APC):c.3772A>T (p.Thr1258Ser)
NM_000038.5(APC):c.3774A>G (p.Thr1258=) rs542928573
NM_000038.5(APC):c.3775A>G (p.Ile1259Val)
NM_000038.5(APC):c.3780G>C (p.Gln1260His) rs763668164
NM_000038.5(APC):c.3782C>T (p.Thr1261Ile) rs1064794636
NM_000038.5(APC):c.3782delC (p.Thr1261Ilefs)
NM_000038.5(APC):c.3783_3784delTT (p.Tyr1262Leufs) rs1554085303
NM_000038.5(APC):c.3785dupA (p.Tyr1262Terfs) rs863225345
NM_000038.5(APC):c.3786T>C (p.Tyr1262=) rs147411334
NM_000038.5(APC):c.3786T>G (p.Tyr1262Ter) rs147411334
NM_000038.5(APC):c.3788G>A (p.Cys1263Tyr) rs1554085309
NM_000038.5(APC):c.3795A>G (p.Glu1265=) rs1554085311
NM_000038.5(APC):c.379A>G (p.Ser127Gly) rs200089324
NM_000038.5(APC):c.3804A>G (p.Pro1268=) rs878853442
NM_000038.5(APC):c.3807A>G (p.Ile1269Met) rs876658536
NM_000038.5(APC):c.3807_3808delAT (p.Ile1269Metfs) rs786203760
NM_000038.5(APC):c.380G>A (p.Ser127Asn)
NM_000038.5(APC):c.3814delT (p.Ser1272Glnfs) rs587783033
NM_000038.5(APC):c.3824G>C (p.Ser1275Thr) rs587781637
NM_000038.5(APC):c.3827C>A (p.Ser1276Ter) rs1060503299
NM_000038.5(APC):c.3827C>G (p.Ser1276Ter) rs1060503299
NM_000038.5(APC):c.3830T>G (p.Leu1277Ter) rs786204169
NM_000038.5(APC):c.3837T>G (p.Ser1279=) rs1057522493
NM_000038.5(APC):c.3838T>G (p.Leu1280Val) rs1554085343
NM_000038.5(APC):c.3847G>A (p.Ala1283Thr) rs1428789824
NM_000038.5(APC):c.3853G>A (p.Asp1285Asn) rs1554085350
NM_000038.5(APC):c.385G>C (p.Glu129Gln) rs376628500
NM_000038.5(APC):c.3871C>T (p.Gln1291Ter)
NM_000038.5(APC):c.3875C>T (p.Thr1292Met) rs371113837
NM_000038.5(APC):c.3876G>A (p.Thr1292=) rs377494451
NM_000038.5(APC):c.3876_3878delGAC (p.Thr1293del) rs1554085362
NM_000038.5(APC):c.3880C>T (p.Gln1294Ter) rs1554085373
NM_000038.5(APC):c.3881A>C (p.Gln1294Pro)
NM_000038.5(APC):c.3882G>T (p.Gln1294His) rs1457219504
NM_000038.5(APC):c.388A>G (p.Ser130Gly) rs150973053
NM_000038.5(APC):c.388delA (p.Ser130Valfs) rs1554069828
NM_000038.5(APC):c.3892T>A (p.Ser1298Thr) rs1060503316
NM_000038.5(APC):c.3901A>G (p.Thr1301Ala) rs587780596
NM_000038.5(APC):c.3906G>A (p.Leu1302=) rs756366532
NM_000038.5(APC):c.3909A>G (p.Gln1303=) rs746289994
NM_000038.5(APC):c.3910A>G (p.Ile1304Val) rs770157475
NM_000038.5(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.5(APC):c.3921_3924delAAAA (p.Ile1307Metfs) rs863224457
NM_000038.5(APC):c.3925G>A (p.Glu1309Lys)
NM_000038.5(APC):c.3925_3928delGAAA (p.Glu1309Argfs) rs876659647
NM_000038.5(APC):c.3926A>G (p.Glu1309Gly) rs775060363
NM_000038.5(APC):c.3927_3931delAAAGA (p.Glu1309Aspfs) rs121913224
NM_000038.5(APC):c.392C>G (p.Thr131Ser) rs1387998721
NM_000038.5(APC):c.3935G>C (p.Gly1312Ala) rs587779791
NM_000038.5(APC):c.3937A>G (p.Thr1313Ala) rs863225349
NM_000038.5(APC):c.393T>C (p.Thr131=) rs775742850
NM_000038.5(APC):c.3943T>A (p.Ser1315Thr)
NM_000038.5(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.5(APC):c.3956delC (p.Pro1319Leufs) rs1057517558
NM_000038.5(APC):c.3959T>A (p.Val1320Glu) rs760485028
NM_000038.5(APC):c.3963C>T (p.Ser1321=) rs150595875
NM_000038.5(APC):c.3964G>A (p.Glu1322Lys) rs752926571
NM_000038.5(APC):c.396A>C (p.Gly132=) rs1060504884
NM_000038.5(APC):c.3970C>G (p.Pro1324Ala) rs587779792
NM_000038.5(APC):c.397T>G (p.Tyr133Asp) rs763487503
NM_000038.5(APC):c.3980C>G (p.Ser1327Ter) rs1554085429
NM_000038.5(APC):c.3981A>T (p.Ser1327=) rs1554085433
NM_000038.5(APC):c.3982C>T (p.Gln1328Ter) rs398123121
NM_000038.5(APC):c.4005C>T (p.Ser1335=) rs751729992
NM_000038.5(APC):c.4009C>A (p.Leu1337Met) rs1554085448
NM_000038.5(APC):c.4009_4010dup (p.Gln1338Cysfs) rs1554085450
NM_000038.5(APC):c.4012C>T (p.Gln1338Ter) rs121913327
NM_000038.5(APC):c.4013A>G (p.Gln1338Arg) rs757693603
NM_000038.5(APC):c.4015G>A (p.Gly1339Ser) rs876658310
NM_000038.5(APC):c.4015G>C (p.Gly1339Arg) rs876658310
NM_000038.5(APC):c.4015G>T (p.Gly1339Cys)
NM_000038.5(APC):c.4016G>A (p.Gly1339Asp) rs781621926
NM_000038.5(APC):c.4017T>C (p.Gly1339=) rs1554085461
NM_000038.5(APC):c.4019C>G (p.Ser1340Cys) rs1280622194
NM_000038.5(APC):c.4020T>C (p.Ser1340=) rs746379898
NM_000038.5(APC):c.4035A>G (p.Glu1345=) rs1060504886
NM_000038.5(APC):c.4038A>C (p.Ser1346=) rs1554085473
NM_000038.5(APC):c.4039G>C (p.Ala1347Pro)
NM_000038.5(APC):c.4055T>C (p.Val1352Ala) rs528724202
NM_000038.5(APC):c.405A>G (p.Glu135=) rs1554069842
NM_000038.5(APC):c.4069G>A (p.Gly1357Arg) rs771718185
NM_000038.5(APC):c.4072G>A (p.Ala1358Thr) rs139618756
NM_000038.5(APC):c.4073C>T (p.Ala1358Val) rs730881249
NM_000038.5(APC):c.4074G>A (p.Ala1358=) rs149782464
NM_000038.5(APC):c.4082C>T (p.Pro1361Leu) rs1060503264
NM_000038.5(APC):c.4086C>G (p.Ser1362=) rs763053012
NM_000038.5(APC):c.4088A>G (p.Lys1363Arg) rs373607243
NM_000038.5(APC):c.4088A>T (p.Lys1363Ile) rs373607243
NM_000038.5(APC):c.4094G>A (p.Gly1365Asp) rs1554085511
NM_000038.5(APC):c.4100A>G (p.Gln1367Arg) rs1399790840
NM_000038.5(APC):c.4101G>C (p.Gln1367His) rs761886683
NM_000038.5(APC):c.4119T>A (p.Pro1373=) rs1248565162
NM_000038.5(APC):c.4124A>C (p.His1375Pro)
NM_000038.5(APC):c.4124A>G (p.His1375Arg) rs750884499
NM_000038.5(APC):c.4125C>G (p.His1375Gln)
NM_000038.5(APC):c.4125C>T (p.His1375=) rs1060504880
NM_000038.5(APC):c.4127A>G (p.Tyr1376Cys) rs756664931
NM_000038.5(APC):c.4127_4128delAT (p.Tyr1376Cysfs) rs1554085533
NM_000038.5(APC):c.4128T>C (p.Tyr1376=) rs1554085539
NM_000038.5(APC):c.4134G>A (p.Gln1378=) rs780368623
NM_000038.5(APC):c.4139C>T (p.Thr1380Ile) rs876660713
NM_000038.5(APC):c.4143A>C (p.Pro1381=) rs778565823
NM_000038.5(APC):c.4146C>G (p.Leu1382=) rs876658384
NM_000038.5(APC):c.4155C>T (p.Ser1385=) rs1554085568
NM_000038.5(APC):c.4160G>A (p.Cys1387Tyr) rs786201834
NM_000038.5(APC):c.4164T>G (p.Thr1388=) rs878853443
NM_000038.5(APC):c.4167delT (p.Val1390Serfs)
NM_000038.5(APC):c.4170C>T (p.Val1390=) rs876659338
NM_000038.5(APC):c.4175C>A (p.Ser1392Ter) rs786204170
NM_000038.5(APC):c.4193G>A (p.Ser1398Asn)
NM_000038.5(APC):c.4198T>C (p.Ser1400Pro)
NM_000038.5(APC):c.4200G>A (p.Ser1400=) rs367782881
NM_000038.5(APC):c.4200G>C (p.Ser1400=) rs367782881
NM_000038.5(APC):c.4201A>G (p.Ile1401Val) rs1554085612
NM_000038.5(APC):c.4207A>G (p.Ser1403Gly) rs759317924
NM_000038.5(APC):c.4209C>T (p.Ser1403=) rs1554085619
NM_000038.5(APC):c.420G>C (p.Glu140Asp) rs202161017
NM_000038.5(APC):c.4212C>A (p.Ser1404=) rs144655979
NM_000038.5(APC):c.4212C>T (p.Ser1404=) rs144655979
NM_000038.5(APC):c.4213G>A (p.Val1405Ile) rs761966904
NM_000038.5(APC):c.4216C>T (p.Gln1406Ter) rs587782518
NM_000038.5(APC):c.4217A>G (p.Gln1406Arg) rs372241082
NM_000038.5(APC):c.421_422delAG (p.Arg141Valfs) rs1554069850
NM_000038.5(APC):c.422+19G>C rs767046355
NM_000038.5(APC):c.422+2T>C rs879254169
NM_000038.5(APC):c.422+6T>C rs864622442
NM_000038.5(APC):c.4228T>G (p.Cys1410Gly)
NM_000038.5(APC):c.423-1G>A rs397514031
NM_000038.5(APC):c.423-28G>T rs570467572
NM_000038.5(APC):c.423-3T>A rs587782293
NM_000038.5(APC):c.423-3_423-2delTA rs863225354
NM_000038.5(APC):c.423-4A>G
NM_000038.5(APC):c.423-9A>G rs1554071494
NM_000038.5(APC):c.423-?_531+?del (p.(?))
NM_000038.5(APC):c.4233T>C (p.Ser1411=) rs761170573
NM_000038.5(APC):c.4237A>G (p.Met1413Val) rs141519952
NM_000038.5(APC):c.423G>T (p.Arg141Ser) rs863224458
NM_000038.5(APC):c.4243A>T (p.Ser1415Cys) rs876660677
NM_000038.5(APC):c.4248C>T (p.Gly1416=)
NM_000038.5(APC):c.4249A>C (p.Ile1417Leu) rs200166878
NM_000038.5(APC):c.424T>A (p.Ser142Thr)
NM_000038.5(APC):c.424_531+69dup
NM_000038.5(APC):c.4251T>C (p.Ile1417=) rs758171294
NM_000038.5(APC):c.4252A>G (p.Ile1418Val) rs777386397
NM_000038.5(APC):c.4255del (p.Ser1419Alafs) rs727504420
NM_000038.5(APC):c.4261A>G (p.Ser1421Gly) rs1303200783
NM_000038.5(APC):c.4264_4269delGATCTT (p.Asp1422_Leu1423del) rs1554085690
NM_000038.5(APC):c.426_427delAT (p.Leu143Alafs) rs587782557
NM_000038.5(APC):c.4279C>G (p.Pro1427Ala) rs876658499
NM_000038.5(APC):c.4286A>G (p.Gln1429Arg) rs1554085710
NM_000038.5(APC):c.4290delC (p.Met1431Cysfs) rs1554085714
NM_000038.5(APC):c.4306A>G (p.Ser1436Gly) rs1554085743
NM_000038.5(APC):c.4310A>G (p.Lys1437Arg) rs745825088
NM_000038.5(APC):c.4311A>G (p.Lys1437=) rs371784771
NM_000038.5(APC):c.4319C>A (p.Pro1440Gln)
NM_000038.5(APC):c.4321C>G (p.Pro1441Ala) rs1238782537
NM_000038.5(APC):c.4325C>T (p.Pro1442Leu)
NM_000038.5(APC):c.4326T>A (p.Pro1442=) rs67622085
NM_000038.5(APC):c.4328_4330delCTC (p.Pro1443del) rs1064793557
NM_000038.5(APC):c.4330C>G (p.Gln1444Glu) rs1287444666
NM_000038.5(APC):c.4332A>G (p.Gln1444=) rs748342378
NM_000038.5(APC):c.4332A>T (p.Gln1444His) rs748342378
NM_000038.5(APC):c.4333A>G (p.Thr1445Ala) rs587780597
NM_000038.5(APC):c.4334C>T (p.Thr1445Ile) rs760686348
NM_000038.5(APC):c.4336G>A (p.Ala1446Thr) rs146572883
NM_000038.5(APC):c.4339C>G (p.Gln1447Glu)
NM_000038.5(APC):c.4341A>C (p.Gln1447His) rs777153373
NM_000038.5(APC):c.4341A>G (p.Gln1447=) rs777153373
NM_000038.5(APC):c.4343C>T (p.Thr1448Ile) rs907886109
NM_000038.5(APC):c.4344C>T (p.Thr1448=) rs864622562
NM_000038.5(APC):c.4348C>T (p.Arg1450Ter) rs121913332
NM_000038.5(APC):c.4349G>A (p.Arg1450Gln) rs587782678
NM_000038.5(APC):c.4349G>T (p.Arg1450Leu) rs587782678
NM_000038.5(APC):c.4351G>A (p.Glu1451Lys)
NM_000038.5(APC):c.4354G>T (p.Val1452Leu) rs1172454959
NM_000038.5(APC):c.4357_4363delCCTAAAAinsAAT (p.Pro1453Asnfs) rs1064792979
NM_000038.5(APC):c.4360A>G (p.Lys1454Glu) rs111866410
NM_000038.5(APC):c.4364A>G (p.Asn1455Ser) rs751262428
NM_000038.5(APC):c.4372C>T (p.Pro1458Ser) rs143796828
NM_000038.5(APC):c.4376C>G (p.Thr1459Ser) rs756048549
NM_000038.5(APC):c.4378G>T (p.Ala1460Ser) rs1353405049
NM_000038.5(APC):c.437C>T (p.Ala146Val) rs1305794169
NM_000038.5(APC):c.4386G>A (p.Lys1462=) rs1057522179
NM_000038.5(APC):c.4391_4394delAGAG (p.Glu1464Valfs) rs387906234
NM_000038.5(APC):c.4393_4394delAG (p.Ser1465Trpfs) rs387906234
NM_000038.5(APC):c.4395T>A (p.Ser1465Arg) rs779898882
NM_000038.5(APC):c.4399C>T (p.Pro1467Ser) rs749142480
NM_000038.5(APC):c.4404_4418delGCAAGCTGCAGTAAAinsC (p.Lys1468Asnfs) rs1064792980
NM_000038.5(APC):c.4405C>G (p.Gln1469Glu) rs1060503288
NM_000038.5(APC):c.4407A>T (p.Gln1469His)
NM_000038.5(APC):c.4408G>C (p.Ala1470Pro) rs1064795575
NM_000038.5(APC):c.4413A>G (p.Ala1471=) rs964029262
NM_000038.5(APC):c.4414G>A (p.Val1472Ile) rs878853445
NM_000038.5(APC):c.4416A>C (p.Val1472=) rs773352404
NM_000038.5(APC):c.4416A>T (p.Val1472=) rs773352404
NM_000038.5(APC):c.4416_4427dup (p.Val1476_Gln1477insAsnAlaAlaVal)
NM_000038.5(APC):c.4420G>A (p.Ala1474Thr) rs139387758
NM_000038.5(APC):c.4424C>T (p.Ala1475Val) rs375380414
NM_000038.5(APC):c.4435G>A (p.Val1479Ile) rs1060503271
NM_000038.5(APC):c.4437C>T (p.Val1479=) rs776622357
NM_000038.5(APC):c.443T>A (p.Leu148His) rs762062860
NM_000038.5(APC):c.4440G>A (p.Gln1480=) rs876659881
NM_000038.5(APC):c.4440G>C (p.Gln1480His) rs876659881
NM_000038.5(APC):c.4441G>A (p.Val1481Ile) rs587782349
NM_000038.5(APC):c.4441G>T (p.Val1481Phe) rs587782349
NM_000038.5(APC):c.4442T>C (p.Val1481Ala)
NM_000038.5(APC):c.4450G>C (p.Asp1484His)
NM_000038.5(APC):c.4451A>C (p.Asp1484Ala)
NM_000038.5(APC):c.4451A>T (p.Asp1484Val)
NM_000038.5(APC):c.4452T>C (p.Asp1484=) rs1554085886
NM_000038.5(APC):c.4456_4458delGAT (p.Asp1486del) rs761504791
NM_000038.5(APC):c.4462T>G (p.Leu1488Val) rs765730576
NM_000038.5(APC):c.4463dup (p.Leu1488Phefs)
NM_000038.5(APC):c.4464A>G (p.Leu1488=) rs1312207257
NM_000038.5(APC):c.4469A>G (p.His1490Arg) rs1408228956
NM_000038.5(APC):c.4473dupT (p.Ala1492Cysfs) rs398123122
NM_000038.5(APC):c.4478C>T (p.Thr1493Met) rs374892194
NM_000038.5(APC):c.4478_4479delCGinsGA (p.Thr1493Arg)
NM_000038.5(APC):c.4479G>A (p.Thr1493=) rs41115
NM_000038.5(APC):c.4479_4480delGGinsAA (p.Glu1494Lys) rs1554085913
NM_000038.5(APC):c.447C>A (p.Asp149Glu) rs750821213
NM_000038.5(APC):c.448A>T (p.Lys150Ter) rs878853444
NM_000038.5(APC):c.4491A>G (p.Pro1497=) rs904213754
NM_000038.5(APC):c.4492G>A (p.Asp1498Asn) rs1060503298
NM_000038.5(APC):c.4493A>G (p.Asp1498Gly) rs587779793
NM_000038.5(APC):c.4496G>A (p.Gly1499Glu) rs1278829075
NM_000038.5(APC):c.4496G>T (p.Gly1499Val) rs1278829075
NM_000038.5(APC):c.449A>G (p.Lys150Arg) rs371085910
NM_000038.5(APC):c.4505G>T (p.Cys1502Phe) rs878853446
NM_000038.5(APC):c.450A>G (p.Lys150=) rs116020626
NM_000038.5(APC):c.4511C>T (p.Ser1504Phe)
NM_000038.5(APC):c.4512C>G (p.Ser1504=) rs999881274
NM_000038.5(APC):c.4518G>T (p.Leu1506=) rs1554085932
NM_000038.5(APC):c.4521T>C (p.Ser1507=) rs1060504885
NM_000038.5(APC):c.4525C>T (p.Leu1509=) rs572839648
NM_000038.5(APC):c.4533C>T (p.Leu1511=) rs150089434
NM_000038.5(APC):c.4534G>A (p.Asp1512Asn) rs778699501
NM_000038.5(APC):c.453delA (p.Glu152Lysfs) rs863224820
NM_000038.5(APC):c.4540C>A (p.Pro1514Thr) rs1060503266
NM_000038.5(APC):c.4545T>C (p.Phe1515=) rs1554085950
NM_000038.5(APC):c.4552A>G (p.Lys1518Glu) rs1554085958
NM_000038.5(APC):c.4556A>G (p.Asp1519Gly)
NM_000038.5(APC):c.4558G>A (p.Val1520Met) rs964842635
NM_000038.5(APC):c.4571T>G (p.Ile1524Arg) rs200803739
NM_000038.5(APC):c.4577C>T (p.Pro1526Leu) rs1325776789
NM_000038.5(APC):c.457A>G (p.Lys153Glu)
NM_000038.5(APC):c.4583T>C (p.Val1528Ala)
NM_000038.5(APC):c.458A>G (p.Lys153Arg) rs754553913
NM_000038.5(APC):c.4595A>G (p.Asp1532Gly) rs904971132
NM_000038.5(APC):c.4599T>C (p.Asn1533=) rs876658897
NM_000038.5(APC):c.459G>A (p.Lys153=) rs864622482
NM_000038.5(APC):c.4608A>T (p.Glu1536Asp) rs1554086002
NM_000038.5(APC):c.460G>A (p.Glu154Lys) rs786202822
NM_000038.5(APC):c.4611_4612delAG (p.Glu1538Ilefs) rs387906236
NM_000038.5(APC):c.4612G>C (p.Glu1538Gln) rs1554086003
NM_000038.5(APC):c.4617A>G (p.Ser1539=) rs1554086014
NM_000038.5(APC):c.4618G>C (p.Glu1540Gln) rs73220015
NM_000038.5(APC):c.4619_4620delAG (p.Glu1540Alafs) rs1554086015
NM_000038.5(APC):c.461A>G (p.Glu154Gly)
NM_000038.5(APC):c.4627A>G (p.Lys1543Glu) rs876658995
NM_000038.5(APC):c.4638T>C (p.Asn1546=) rs1554086032
NM_000038.5(APC):c.4638_4642delTGAAA (p.Asn1546Lysfs) rs1554086030
NM_000038.5(APC):c.4645C>T (p.Gln1549Ter) rs863225357
NM_000038.5(APC):c.4650G>T (p.Glu1550Asp) rs878853447
NM_000038.5(APC):c.4657G>A (p.Ala1553Thr) rs1554086047
NM_000038.5(APC):c.465A>G (p.Lys155=) rs778691867
NM_000038.5(APC):c.4666A>G (p.Thr1556Ala)
NM_000038.5(APC):c.4666delA (p.Thr1556Leufs) rs587783031
NM_000038.5(APC):c.4666dup (p.Thr1556Asnfs) rs587783031
NM_000038.5(APC):c.4667C>T (p.Thr1556Ile)
NM_000038.5(APC):c.4669A>G (p.Ile1557Val) rs763578917
NM_000038.5(APC):c.4670T>G (p.Ile1557Ser)
NM_000038.5(APC):c.4670_4671delTT (p.Ile1557Argfs)
NM_000038.5(APC):c.4676C>T (p.Ser1559Phe) rs878853448
NM_000038.5(APC):c.4683G>T (p.Lys1561Asn) rs774900184
NM_000038.5(APC):c.4686C>T (p.Asp1562=) rs72541812
NM_000038.5(APC):c.468C>G (p.Asp156Glu) rs752627126
NM_000038.5(APC):c.468C>T (p.Asp156=) rs752627126
NM_000038.5(APC):c.4690T>C (p.Leu1564=) rs1009904304
NM_000038.5(APC):c.4692A>C (p.Leu1564Phe) rs1060503364
NM_000038.5(APC):c.4694A>G (p.Asp1565Gly)
NM_000038.5(APC):c.4701delA (p.Asp1568Metfs) rs878853449
NM_000038.5(APC):c.4702G>C (p.Asp1568His) rs1554086115
NM_000038.5(APC):c.4709A>G (p.Asp1570Gly) rs373419559
NM_000038.5(APC):c.470G>A (p.Trp157Ter) rs137854576
NM_000038.5(APC):c.4711_4713delGAT (p.Asp1571del) rs587782888
NM_000038.5(APC):c.4715T>C (p.Ile1572Thr) rs863224543
NM_000038.5(APC):c.4717delG (p.Glu1573Lysfs) rs878853217
NM_000038.5(APC):c.471G>A (p.Trp157Ter) rs1060503328
NM_000038.5(APC):c.4725A>G (p.Leu1575=) rs1057523328
NM_000038.5(APC):c.4732T>G (p.Cys1578Gly) rs138367627
NM_000038.5(APC):c.473A>T (p.Tyr158Phe) rs587782477
NM_000038.5(APC):c.4740T>C (p.Ile1580=) rs760033815
NM_000038.5(APC):c.474T>C (p.Tyr158=) rs1060504891
NM_000038.5(APC):c.4752A>C (p.Pro1584=) rs1554086150
NM_000038.5(APC):c.4758G>A (p.Lys1586=) rs1060504890
NM_000038.5(APC):c.475dupT (p.Tyr159Leufs) rs863225361
NM_000038.5(APC):c.4761A>C (p.Ser1587=) rs863224280
NM_000038.5(APC):c.4765C>G (p.Arg1589Gly) rs72541813
NM_000038.5(APC):c.4765C>T (p.Arg1589Cys) rs72541813
NM_000038.5(APC):c.4766G>A (p.Arg1589His) rs374048423
NM_000038.5(APC):c.4768A>G (p.Lys1590Glu) rs878853450
NM_000038.5(APC):c.476dupA (p.Tyr159Terfs) rs878853451
NM_000038.5(APC):c.4776A>G (p.Lys1592=) rs878853452
NM_000038.5(APC):c.4779G>A (p.Lys1593=) rs1060504872
NM_000038.5(APC):c.477C>G (p.Tyr159Ter) rs863224281
NM_000038.5(APC):c.477C>T (p.Tyr159=) rs863224281
NM_000038.5(APC):c.477delC (p.Tyr159Terfs) rs730880250
NM_000038.5(APC):c.4780C>T (p.Pro1594Ser) rs1008704701
NM_000038.5(APC):c.4783G>C (p.Ala1595Pro) rs749782426
NM_000038.5(APC):c.4783G>T (p.Ala1595Ser) rs749782426
NM_000038.5(APC):c.478G>A (p.Ala160Thr) rs1114167556
NM_000038.5(APC):c.4796C>G (p.Ser1599Ter) rs1554086212
NM_000038.5(APC):c.4804_4806delCCTinsACA (p.Pro1602Thr) rs1554086216
NM_000038.5(APC):c.4813G>A (p.Val1605Met) rs1554086219
NM_000038.5(APC):c.4815G>A (p.Val1605=) rs1060503313
NM_000038.5(APC):c.481C>T (p.Gln161Ter) rs876658325
NM_000038.5(APC):c.4833G>A (p.Gln1611=) rs762030106
NM_000038.5(APC):c.4833G>C (p.Gln1611His)
NM_000038.5(APC):c.4837C>T (p.Pro1613Ser) rs1060503335
NM_000038.5(APC):c.4840G>A (p.Val1614Met) rs1554086234
NM_000038.5(APC):c.4846A>C (p.Lys1616Gln) rs1554086240
NM_000038.5(APC):c.4847A>T (p.Lys1616Ile) rs1554086241
NM_000038.5(APC):c.4849C>G (p.Leu1617Val) rs1489248428
NM_000038.5(APC):c.4850_4855delTTCTAC (p.Leu1617_Leu1618del) rs1057517588
NM_000038.5(APC):c.4854A>G (p.Leu1618=) rs377666490
NM_000038.5(APC):c.4856C>A (p.Pro1619Gln) rs952674488
NM_000038.5(APC):c.4857A>G (p.Pro1619=) rs564651232
NM_000038.5(APC):c.4879C>A (p.Gln1627Lys) rs1554086263
NM_000038.5(APC):c.487C>T (p.Gln163Ter) rs863225362
NM_000038.5(APC):c.4886A>C (p.His1629Pro)
NM_000038.5(APC):c.4888G>A (p.Val1630Ile)
NM_000038.5(APC):c.4891A>T (p.Ser1631Cys) rs876660680
NM_000038.5(APC):c.4893T>C (p.Ser1631=) rs35634377
NM_000038.5(APC):c.4898C>A (p.Thr1633Lys) rs765215625
NM_000038.5(APC):c.4898C>T (p.Thr1633Ile) rs765215625
NM_000038.5(APC):c.4900C>G (p.Pro1634Ala) rs587779795
NM_000038.5(APC):c.4901C>T (p.Pro1634Leu) rs370433763
NM_000038.5(APC):c.4901delC (p.Pro1634Argfs) rs1057518901
NM_000038.5(APC):c.4902G>A (p.Pro1634=) rs876659202
NM_000038.5(APC):c.4905G>A (p.Gly1635=) rs137988845
NM_000038.5(APC):c.4906G>T (p.Asp1636Tyr) rs730882128
NM_000038.5(APC):c.4906dup (p.Asp1636Glyfs) rs1554086285
NM_000038.5(APC):c.4913T>C (p.Met1638Thr) rs201797422
NM_000038.5(APC):c.4918C>T (p.Arg1640Trp) rs373440614
NM_000038.5(APC):c.4919G>A (p.Arg1640Gln) rs529480958
NM_000038.5(APC):c.4921G>A (p.Val1641Met) rs755126540
NM_000038.5(APC):c.4928G>A (p.Cys1643Tyr) rs748715887
NM_000038.5(APC):c.4928G>T (p.Cys1643Phe) rs748715887
NM_000038.5(APC):c.4932T>G (p.Val1644=) rs1554086321
NM_000038.5(APC):c.4941A>C (p.Thr1647=) rs876660116
NM_000038.5(APC):c.4945A>G (p.Ile1649Val) rs772273122
NM_000038.5(APC):c.495C>T (p.Leu165=) rs1554071591
NM_000038.5(APC):c.4962T>C (p.Ala1654=) rs551322279
NM_000038.5(APC):c.4963A>G (p.Thr1655Ala) rs759441332
NM_000038.5(APC):c.4965A>C (p.Thr1655=) rs863224282
NM_000038.5(APC):c.4965A>G (p.Thr1655=) rs863224282
NM_000038.5(APC):c.496A>G (p.Thr166Ala)
NM_000038.5(APC):c.496A>T (p.Thr166Ser)
NM_000038.5(APC):c.497_499delCTAinsTT (p.Thr166Ilefs) rs1114167588
NM_000038.5(APC):c.4980A>G (p.Leu1660=) rs863224283
NM_000038.5(APC):c.4984A>G (p.Ile1662Val) rs1434584091
NM_000038.5(APC):c.4986C>G (p.Ile1662Met) rs876658910
NM_000038.5(APC):c.4987G>A (p.Glu1663Lys) rs758987855
NM_000038.5(APC):c.4987G>T (p.Glu1663Ter) rs758987855
NM_000038.5(APC):c.4989A>G (p.Glu1663=) rs863224284
NM_000038.5(APC):c.4999A>G (p.Asn1667Asp) rs775241441
NM_000038.5(APC):c.499A>G (p.Lys167Glu) rs1310352139
NM_000038.5(APC):c.5001T>A (p.Asn1667Lys) rs1131691138
NM_000038.5(APC):c.5009C>T (p.Ala1670Val) rs202228932
NM_000038.5(APC):c.5011G>A (p.Ala1671Thr) rs587781600
NM_000038.5(APC):c.5017G>A (p.Glu1673Lys) rs587779796
NM_000038.5(APC):c.5020G>A (p.Gly1674Arg)
NM_000038.5(APC):c.5025T>C (p.Val1675=) rs876658169
NM_000038.5(APC):c.5025T>G (p.Val1675=) rs876658169
NM_000038.5(APC):c.5025dupT (p.Arg1676Terfs) rs878853454
NM_000038.5(APC):c.5026A>G (p.Arg1676Gly) rs370560998
NM_000038.5(APC):c.5026_5028delAGA (p.Arg1676del) rs768369050
NM_000038.5(APC):c.5027G>C (p.Arg1676Thr) rs143674116
NM_000038.5(APC):c.5031A>G (p.Gly1677=) rs878853453
NM_000038.5(APC):c.5034G>A (p.Gly1678=) rs42427
NM_000038.5(APC):c.503G>A (p.Arg168Lys) rs1554071604
NM_000038.5(APC):c.5042C>T (p.Ser1681Leu) rs876659056
NM_000038.5(APC):c.5052T>C (p.Phe1684=) rs1489564235
NM_000038.5(APC):c.5059C>T (p.Arg1687Ter) rs1554086415
NM_000038.5(APC):c.505A>G (p.Ile169Val) rs878853455
NM_000038.5(APC):c.5060G>A (p.Arg1687Gln) rs779068685
NM_000038.5(APC):c.5066C>T (p.Thr1689Ile) rs551084068
NM_000038.5(APC):c.5067C>G (p.Thr1689=) rs1554086427
NM_000038.5(APC):c.5068A>G (p.Ile1690Val) rs201142277
NM_000038.5(APC):c.5071C>A (p.Pro1691Thr) rs1064794106
NM_000038.5(APC):c.5072C>T (p.Pro1691Leu) rs1060503346
NM_000038.5(APC):c.5083A>G (p.Arg1695Gly) rs555019540
NM_000038.5(APC):c.5089A>G (p.Thr1697Ala) rs876660122
NM_000038.5(APC):c.508_509delGA (p.Asp170Terfs) rs886039642
NM_000038.5(APC):c.5092G>A (p.Asp1698Asn) rs745542459
NM_000038.5(APC):c.5098G>T (p.Ala1700Ser)
NM_000038.5(APC):c.509_512delATAG (p.Asp170Valfs) rs387906231
NM_000038.5(APC):c.5105G>A (p.Gly1702Glu) rs769273526
NM_000038.5(APC):c.5108G>C (p.Gly1703Ala) rs587778042
NM_000038.5(APC):c.5113A>G (p.Thr1705Ala) rs1554086453
NM_000038.5(APC):c.5115C>G (p.Thr1705=) rs373698193
NM_000038.5(APC):c.5119T>C (p.Ser1707Pro)
NM_000038.5(APC):c.5125A>T (p.Thr1709Ser) rs1554086463
NM_000038.5(APC):c.5128A>G (p.Ile1710Val) rs1554086465
NM_000038.5(APC):c.5136A>G (p.Glu1712=) rs573531013
NM_000038.5(APC):c.5138T>C (p.Leu1713Ser) rs587779797
NM_000038.5(APC):c.5140G>A (p.Asp1714Asn) rs148275069
NM_000038.5(APC):c.5140G>C (p.Asp1714His) rs148275069
NM_000038.5(APC):c.5145delC (p.Asp1715Glufs) rs863225363
NM_000038.5(APC):c.5147A>G (p.Asn1716Ser) rs141298709
NM_000038.5(APC):c.5156A>C (p.Glu1719Ala)
NM_000038.5(APC):c.5161G>C (p.Gly1721Arg)
NM_000038.5(APC):c.5162G>A (p.Gly1721Asp) rs876660114
NM_000038.5(APC):c.5165A>G (p.Asp1722Gly) rs1175970075
NM_000038.5(APC):c.516T>C (p.Leu172=) rs777643585
NM_000038.5(APC):c.5177A>G (p.Glu1726Gly) rs587780598
NM_000038.5(APC):c.5178A>G (p.Glu1726=) rs368494571
NM_000038.5(APC):c.5179T>C (p.Cys1727Arg) rs758815860
NM_000038.5(APC):c.5181_5195delCATTAATTCTGCTAT (p.Cys1727_Met1732delinsTrp) rs1554086508
NM_000038.5(APC):c.5189C>T (p.Ser1730Phe) rs864622256
NM_000038.5(APC):c.5192C>G (p.Ala1731Gly) rs876659661
NM_000038.5(APC):c.5194A>G (p.Met1732Val) rs752065261
NM_000038.5(APC):c.5207A>G (p.Lys1736Arg) rs863224544
NM_000038.5(APC):c.5212C>G (p.His1738Asp)
NM_000038.5(APC):c.5213A>C (p.His1738Pro) rs149882057
NM_000038.5(APC):c.5216A>G (p.Lys1739Arg) rs769558291
NM_000038.5(APC):c.5216A>T (p.Lys1739Met) rs769558291
NM_000038.5(APC):c.5218C>A (p.Pro1740Thr)
NM_000038.5(APC):c.5218C>T (p.Pro1740Ser) rs1332889016
NM_000038.5(APC):c.5224C>T (p.Arg1742Cys) rs876658835
NM_000038.5(APC):c.5225G>A (p.Arg1742His) rs199775075
NM_000038.5(APC):c.5236A>G (p.Ile1746Val) rs786202076
NM_000038.5(APC):c.5238_5240delAAT (p.Ile1746del)
NM_000038.5(APC):c.5240T>C (p.Met1747Thr) rs864622751
NM_000038.5(APC):c.5241G>A (p.Met1747Ile) rs1060503304
NM_000038.5(APC):c.524C>G (p.Thr175Ser) rs1554071616
NM_000038.5(APC):c.524_531+4delCTGAAAATGTAA rs863225364
NM_000038.5(APC):c.5250C>G (p.Val1750=) rs2229997
NM_000038.5(APC):c.5250C>T (p.Val1750=) rs2229997
NM_000038.5(APC):c.5253G>A (p.Gln1751=) rs1554086570
NM_000038.5(APC):c.5257G>C (p.Ala1753Pro) rs587781350
NM_000038.5(APC):c.5263G>T (p.Ala1755Ser) rs371067258
NM_000038.5(APC):c.5264C>T (p.Ala1755Val) rs771967537
NM_000038.5(APC):c.5265G>A (p.Ala1755=) rs34506289
NM_000038.5(APC):c.5268T>A (p.Ser1756=) rs866006
NM_000038.5(APC):c.5268T>G (p.Ser1756=) rs866006
NM_000038.5(APC):c.5271T>C (p.Ser1757=) rs752875511
NM_000038.5(APC):c.5272_5274delTCT (p.Ser1758del) rs780061589
NM_000038.5(APC):c.5274T>A (p.Ser1758=) rs199600387
NM_000038.5(APC):c.5282A>C (p.Asn1761Thr) rs752038930
NM_000038.5(APC):c.5282A>G (p.Asn1761Ser) rs752038930
NM_000038.5(APC):c.5283C>A (p.Asn1761Lys) rs933729249
NM_000038.5(APC):c.5283C>T (p.Asn1761=) rs933729249
NM_000038.5(APC):c.5284A>G (p.Lys1762Glu)
NM_000038.5(APC):c.5285A>G (p.Lys1762Arg) rs1554086604
NM_000038.5(APC):c.5290C>G (p.Gln1764Glu) rs529543591
NM_000038.5(APC):c.5292G>C (p.Gln1764His) rs876660722
NM_000038.5(APC):c.5293_5296delTTAG (p.Leu1765Metfs)
NM_000038.5(APC):c.5298T>C (p.Asp1766=) rs781533317
NM_000038.5(APC):c.5302A>G (p.Lys1768Glu) rs199630012
NM_000038.5(APC):c.5304G>A (p.Lys1768=) rs863224285
NM_000038.5(APC):c.5308A>G (p.Lys1770Glu) rs551183536
NM_000038.5(APC):c.531+16G>A rs770126046
NM_000038.5(APC):c.531+1G>C rs876659973
NM_000038.5(APC):c.531+2dupT rs1060503257
NM_000038.5(APC):c.531+3A>C rs1114167550
NM_000038.5(APC):c.531+5G>C rs587779798
NM_000038.5(APC):c.531+5_531+8delGTAA rs1554071617
NM_000038.5(APC):c.531+6T>C
NM_000038.5(APC):c.5312A>G (p.Lys1771Arg)
NM_000038.5(APC):c.5314C>T (p.Pro1772Ser) rs1554086631
NM_000038.5(APC):c.5318C>T (p.Thr1773Ile) rs1554086634
NM_000038.5(APC):c.5319T>A (p.Thr1773=) rs563219702
NM_000038.5(APC):c.5319T>C (p.Thr1773=) rs563219702
NM_000038.5(APC):c.532-17A>T rs997606437
NM_000038.5(APC):c.532-2A>G rs752152148
NM_000038.5(APC):c.532-6T>C rs1554072543
NM_000038.5(APC):c.532-7G>C rs1057520840
NM_000038.5(APC):c.532-7G>T rs1057520840
NM_000038.5(APC):c.532-8G>A rs1060503323
NM_000038.5(APC):c.532-939G>A rs551489857
NM_000038.5(APC):c.532-939G>T rs551489857
NM_000038.5(APC):c.532-9delT rs777844116
NM_000038.5(APC):c.532T>A (p.Phe178Ile) rs1060503344
NM_000038.5(APC):c.5335A>G (p.Ile1779Val)
NM_000038.5(APC):c.5337A>G (p.Ile1779Met) rs748063409
NM_000038.5(APC):c.5341C>T (p.Gln1781Ter) rs1554086653
NM_000038.5(APC):c.5348C>G (p.Thr1783Ser) rs878853456
NM_000038.5(APC):c.5348C>T (p.Thr1783Ile) rs878853456
NM_000038.5(APC):c.5350G>A (p.Glu1784Lys)
NM_000038.5(APC):c.5357G>A (p.Arg1786Lys) rs944674770
NM_000038.5(APC):c.5357G>C (p.Arg1786Thr) rs944674770
NM_000038.5(APC):c.5360C>G (p.Thr1787Arg)
NM_000038.5(APC):c.5362C>T (p.Arg1788Cys) rs773125634
NM_000038.5(APC):c.5363G>A (p.Arg1788His) rs201472075
NM_000038.5(APC):c.5365G>C (p.Val1789Leu) rs1554086666
NM_000038.5(APC):c.5369G>A (p.Arg1790Lys) rs1158503665
NM_000038.5(APC):c.5376T>C (p.Asn1792=) rs76364845
NM_000038.5(APC):c.5378C>G (p.Ala1793Gly) rs764203580
NM_000038.5(APC):c.537C>A (p.Ser179=) rs149736402
NM_000038.5(APC):c.5381A>T (p.Asp1794Val) rs1490241563
NM_000038.5(APC):c.5382C>A (p.Asp1794Glu) rs566370229
NM_000038.5(APC):c.5384C>G (p.Ser1795Ter) rs1554086694
NM_000038.5(APC):c.5386A>G (p.Lys1796Glu) rs367577259
NM_000038.5(APC):c.5392A>G (p.Asn1798Asp) rs200794097
NM_000038.5(APC):c.5399A>G (p.Asn1800Ser) rs865782682
NM_000038.5(APC):c.53T>A (p.Met18Lys) rs200960071
NM_000038.5(APC):c.5403T>C (p.Ala1801=) rs750936426
NM_000038.5(APC):c.5404G>C (p.Glu1802Gln) rs756465306
NM_000038.5(APC):c.5406G>C (p.Glu1802Asp) rs1060503349
NM_000038.5(APC):c.5408G>C (p.Arg1803Thr)
NM_000038.5(APC):c.5409A>G (p.Arg1803=) rs766679576
NM_000038.5(APC):c.5420A>G (p.Asp1807Gly) rs863224545
NM_000038.5(APC):c.5421C>T (p.Asp1807=) rs753501921
NM_000038.5(APC):c.5424C>T (p.Asn1808=) rs747721259
NM_000038.5(APC):c.5424_5426delCAA (p.Asn1808del) rs587782002
NM_000038.5(APC):c.5426A>G (p.Lys1809Arg) rs1060503297
NM_000038.5(APC):c.5430T>G (p.Asp1810Glu) rs149828124
NM_000038.5(APC):c.5431T>C (p.Ser1811Pro) rs777788406
NM_000038.5(APC):c.5432C>T (p.Ser1811Leu) rs1060503325
NM_000038.5(APC):c.543_546delAACA (p.Thr182Ilefs) rs1554072562
NM_000038.5(APC):c.5451A>G (p.Lys1817=) rs1004701019
NM_000038.5(APC):c.5458T>G (p.Ser1820Ala) rs1301894985
NM_000038.5(APC):c.5459C>G (p.Ser1820Cys) rs879367927
NM_000038.5(APC):c.5459C>T (p.Ser1820Phe) rs879367927
NM_000038.5(APC):c.5465T>G (p.Val1822Gly) rs459552
NM_000038.5(APC):c.546A>G (p.Thr182=) rs864622392
NM_000038.5(APC):c.5474A>T (p.Asp1825Val) rs1554086747
NM_000038.5(APC):c.5475T>C (p.Asp1825=) rs1554086751
NM_000038.5(APC):c.5476A>G (p.Lys1826Glu) rs1060503319
NM_000038.5(APC):c.5477A>G (p.Lys1826Arg)
NM_000038.5(APC):c.5478G>A (p.Lys1826=) rs768922376
NM_000038.5(APC):c.5479C>G (p.Leu1827Val) rs876660007
NM_000038.5(APC):c.5481C>A (p.Leu1827=) rs774567729
NM_000038.5(APC):c.5481C>T (p.Leu1827=) rs774567729
NM_000038.5(APC):c.5486A>G (p.Asn1829Ser) rs767612847
NM_000038.5(APC):c.5490_5493delTGAA (p.Asn1830Lysfs) rs730881273
NM_000038.5(APC):c.5495A>G (p.Asp1832Gly) rs537695710
NM_000038.5(APC):c.54G>A (p.Met18Ile) rs772873692
NM_000038.5(APC):c.5500G>A (p.Val1834Ile) rs555944438
NM_000038.5(APC):c.5501_5506delTCAGAG (p.Val1834_Arg1835del) rs587778029
NM_000038.5(APC):c.5503A>G (p.Arg1835Gly) rs879254181
NM_000038.5(APC):c.5506G>A (p.Gly1836Arg) rs766739164
NM_000038.5(APC):c.5507delG (p.Gly1836Glufs)
NM_000038.5(APC):c.551T>C (p.Met184Thr) rs1257143633
NM_000038.5(APC):c.5524T>A (p.Ser1842Thr) rs754648125
NM_000038.5(APC):c.5524delT (p.Ser1842Hisfs) rs1554086794
NM_000038.5(APC):c.5526A>G (p.Ser1842=) rs577725739
NM_000038.5(APC):c.5527C>A (p.Pro1843Thr) rs1461006300
NM_000038.5(APC):c.5528C>T (p.Pro1843Leu) rs368080169
NM_000038.5(APC):c.5529T>A (p.Pro1843=) rs1060504894
NM_000038.5(APC):c.5533C>T (p.His1845Tyr) rs1060503338
NM_000038.5(APC):c.5540C>T (p.Thr1847Met) rs371686531
NM_000038.5(APC):c.5541G>A (p.Thr1847=) rs777449060
NM_000038.5(APC):c.5543C>G (p.Pro1848Arg) rs746943534
NM_000038.5(APC):c.5571A>C (p.Ser1857=) rs376624613
NM_000038.5(APC):c.5572C>T (p.Arg1858Ter) rs1270783041
NM_000038.5(APC):c.5573G>A (p.Arg1858Gln) rs369831474
NM_000038.5(APC):c.5576A>G (p.Asn1859Ser) rs876658164
NM_000038.5(APC):c.557G>C (p.Arg186Thr)
NM_000038.5(APC):c.5582_5585delCTTT (p.Ser1861Terfs) rs587776520
NM_000038.5(APC):c.5593C>G (p.Leu1865Val) rs1064794887
NM_000038.5(APC):c.5603A>G (p.Asp1868Gly) rs781026376
NM_000038.5(APC):c.5611G>T (p.Asp1871Tyr) rs538571038
NM_000038.5(APC):c.5612_5614delATG (p.Asp1871del)
NM_000038.5(APC):c.5615T>A (p.Val1872Asp) rs748389037
NM_000038.5(APC):c.5619C>T (p.Asp1873=) rs755764542
NM_000038.5(APC):c.5623T>C (p.Ser1875Pro)
NM_000038.5(APC):c.5624C>G (p.Ser1875Cys)
NM_000038.5(APC):c.5627G>T (p.Arg1876Met) rs773201570
NM_000038.5(APC):c.5635G>C (p.Ala1879Pro) rs587779799
NM_000038.5(APC):c.5635G>T (p.Ala1879Ser) rs587779799
NM_000038.5(APC):c.564A>G (p.Gln188=) rs377493489
NM_000038.5(APC):c.5656G>C (p.Glu1886Gln) rs587781400
NM_000038.5(APC):c.5659_5663del5 (p.Asn1887Glyfs) rs1554086854
NM_000038.5(APC):c.565T>C (p.Leu189=) rs762146761
NM_000038.5(APC):c.5668T>C (p.Ser1890Pro) rs1060503265
NM_000038.5(APC):c.5669C>G (p.Ser1890Ter) rs1554086862
NM_000038.5(APC):c.5670A>G (p.Ser1890=) rs945185629
NM_000038.5(APC):c.5676T>C (p.Ala1892=) rs978239155
NM_000038.5(APC):c.567G>C (p.Leu189Phe) rs1554072586
NM_000038.5(APC):c.5687G>A (p.Ser1896Asn) rs751088165
NM_000038.5(APC):c.5690A>C (p.His1897Pro) rs112610898
NM_000038.5(APC):c.5692A>G (p.Thr1898Ala) rs786204149
NM_000038.5(APC):c.5695G>C (p.Glu1899Gln) rs878853457
NM_000038.5(APC):c.5698C>T (p.Leu1900=) rs944332850
NM_000038.5(APC):c.5708A>G (p.Asn1903Ser) rs750404000
NM_000038.5(APC):c.5712A>G (p.Gln1904=) rs755851369
NM_000038.5(APC):c.5715A>G (p.Gln1905=) rs779869418
NM_000038.5(APC):c.5718A>G (p.Ser1906=) rs1060504879
NM_000038.5(APC):c.5718delA (p.Ala1907Leufs) rs1554086923
NM_000038.5(APC):c.5733A>C (p.Gln1911His) rs1554086927
NM_000038.5(APC):c.573T>C (p.Tyr191=) rs185154886
NM_000038.5(APC):c.5741C>T (p.Ala1914Val)
NM_000038.5(APC):c.5743A>G (p.Lys1915Glu) rs587778031
NM_000038.5(APC):c.5746C>A (p.Gln1916Lys) rs1060503369
NM_000038.5(APC):c.5752A>G (p.Ile1918Val) rs776966222
NM_000038.5(APC):c.5755A>T (p.Asn1919Tyr) rs1554086959
NM_000038.5(APC):c.5756A>G (p.Asn1919Ser) rs147740612
NM_000038.5(APC):c.5758C>G (p.Arg1920Gly) rs587779800
NM_000038.5(APC):c.5759G>T (p.Arg1920Leu) rs587780599
NM_000038.5(APC):c.5761G>A (p.Gly1921Ser) rs1060503324
NM_000038.5(APC):c.5762G>T (p.Gly1921Val) rs786204093
NM_000038.5(APC):c.5768C>G (p.Pro1923Arg)
NM_000038.5(APC):c.5772delA (p.Lys1924Asnfs) rs1554086974
NM_000038.5(APC):c.5774C>A (p.Pro1925His) rs762682111
NM_000038.5(APC):c.5779C>A (p.Leu1927Ile) rs730881253
NM_000038.5(APC):c.5784G>A (p.Gln1928=) rs761186363
NM_000038.5(APC):c.5788C>G (p.Gln1930Glu) rs1554086988
NM_000038.5(APC):c.5789A>G (p.Gln1930Arg) rs879254254
NM_000038.5(APC):c.578C>G (p.Ala193Gly)
NM_000038.5(APC):c.5790A>G (p.Gln1930=) rs141152252
NM_000038.5(APC):c.5792C>A (p.Ser1931Tyr) rs1554086993
NM_000038.5(APC):c.5794A>T (p.Thr1932Ser) rs777604445
NM_000038.5(APC):c.5800C>T (p.Pro1934Ser) rs1554087001
NM_000038.5(APC):c.5801C>G (p.Pro1934Arg) rs587780600
NM_000038.5(APC):c.5801C>T (p.Pro1934Leu) rs587780600
NM_000038.5(APC):c.5802C>G (p.Pro1934=) rs876658810
NM_000038.5(APC):c.5804dupA (p.Ser1936Valfs) rs863225367
NM_000038.5(APC):c.5805G>A (p.Gln1935=) rs377040690
NM_000038.5(APC):c.5810C>T (p.Ser1937Phe)
NM_000038.5(APC):c.5816A>T (p.Asp1939Val) rs754783550
NM_000038.5(APC):c.5818A>G (p.Ile1940Val) rs544669011
NM_000038.5(APC):c.5820dup (p.Pro1941Thrfs)
NM_000038.5(APC):c.5821C>T (p.Pro1941Ser) rs747289299
NM_000038.5(APC):c.5823A>G (p.Pro1941=) rs770869007
NM_000038.5(APC):c.5826C>G (p.Asp1942Glu)
NM_000038.5(APC):c.5826_5829delCAGA (p.Asp1942Glufs) rs864622228
NM_000038.5(APC):c.5827_5828insAA (p.Arg1943Lysfs) rs1554087023
NM_000038.5(APC):c.582G>A (p.Arg194=) rs864622103
NM_000038.5(APC):c.5831G>T (p.Gly1944Val)
NM_000038.5(APC):c.5839A>G (p.Thr1947Ala) rs746346292
NM_000038.5(APC):c.583C>G (p.Gln195Glu) rs749479682
NM_000038.5(APC):c.5841T>G (p.Thr1947=) rs1114167570
NM_000038.5(APC):c.5847A>G (p.Glu1949=) rs1554087029
NM_000038.5(APC):c.5854C>G (p.Gln1952Glu) rs1166934042
NM_000038.5(APC):c.5860_5863delTTTG (p.Phe1954Leufs) rs1554087036
NM_000038.5(APC):c.5865T>C (p.Ala1955=) rs1060504868
NM_000038.5(APC):c.5866A>G (p.Ile1956Val) rs749597014
NM_000038.5(APC):c.5873A>C (p.Asn1958Thr) rs1060503306
NM_000038.5(APC):c.5876C>G (p.Thr1959Ser) rs1060503320
NM_000038.5(APC):c.5877T>A (p.Thr1959=) rs369899251
NM_000038.5(APC):c.5879C>T (p.Pro1960Leu) rs587781546
NM_000038.5(APC):c.5879_5880delCGinsTA (p.Pro1960Leu) rs587779801
NM_000038.5(APC):c.5880G>A (p.Pro1960=) rs465899
NM_000038.5(APC):c.5885G>A (p.Cys1962Tyr)
NM_000038.5(APC):c.588C>T (p.Ile196=) rs147846364
NM_000038.5(APC):c.5891C>T (p.Ser1964Phe) rs1060503274
NM_000038.5(APC):c.5894A>C (p.His1965Pro) rs773776516
NM_000038.5(APC):c.5894A>G (p.His1965Arg) rs773776516
NM_000038.5(APC):c.589A>G (p.Arg197Gly)
NM_000038.5(APC):c.5900C>G (p.Ser1967Cys)
NM_000038.5(APC):c.5907G>C (p.Leu1969=) rs200881543
NM_000038.5(APC):c.5909G>C (p.Ser1970Thr) rs753781948
NM_000038.5(APC):c.5912C>G (p.Ser1971Cys) rs754691867
NM_000038.5(APC):c.5916C>G (p.Leu1972=) rs1060504870
NM_000038.5(APC):c.5917A>G (p.Ser1973Gly) rs1060503354
NM_000038.5(APC):c.5917delA (p.Ser1973Valfs) rs878853458
NM_000038.5(APC):c.5923A>G (p.Ile1975Val)
NM_000038.5(APC):c.5931A>G (p.Gln1977=) rs975299630
NM_000038.5(APC):c.5934_5937delAAAC (p.Asn1979Thrfs) rs587781330
NM_000038.5(APC):c.5940_5942delCAA (p.Asn1981del) rs578171579
NM_000038.5(APC):c.5950A>G (p.Asn1984Asp) rs1554087095
NM_000038.5(APC):c.5952T>C (p.Asn1984=) rs142019870
NM_000038.5(APC):c.5952_5955delTGAA (p.Glu1985Leufs) rs1057517544
NM_000038.5(APC):c.5956C>A (p.Pro1986Thr) rs745885287
NM_000038.5(APC):c.5957C>T (p.Pro1986Leu) rs756266694
NM_000038.5(APC):c.595dupG (p.Ala199Glyfs) rs878853459
NM_000038.5(APC):c.5961C>G (p.Ile1987Met)
NM_000038.5(APC):c.596C>T (p.Ala199Val) rs748193367
NM_000038.5(APC):c.5974C>G (p.Pro1992Ala) rs749833343
NM_000038.5(APC):c.5976C>T (p.Pro1992=) rs768878237
NM_000038.5(APC):c.597G>A (p.Ala199=) rs587780601
NM_000038.5(APC):c.5981A>T (p.Asp1994Val) rs774815653
NM_000038.5(APC):c.5982C>A (p.Asp1994Glu) rs372852823
NM_000038.5(APC):c.5982C>G (p.Asp1994Glu) rs372852823
NM_000038.5(APC):c.5987A>T (p.Gln1996Leu) rs587779802
NM_000038.5(APC):c.5990G>C (p.Gly1997Ala)
NM_000038.5(APC):c.5995C>G (p.Pro1999Ala) rs1554087136
NM_000038.5(APC):c.5998A>C (p.Ser2000Arg) rs587782271
NM_000038.5(APC):c.5998A>G (p.Ser2000Gly) rs587782271
NM_000038.5(APC):c.599T>A (p.Met200Lys) rs1554072621
NM_000038.5(APC):c.600G>C (p.Met200Ile)
NM_000038.5(APC):c.6011_6012insTT (p.Ser2005Tyrfs)
NM_000038.5(APC):c.6019T>C (p.Tyr2007His) rs745811356
NM_000038.5(APC):c.6020A>G (p.Tyr2007Cys) rs752604668
NM_000038.5(APC):c.6022G>A (p.Ala2008Thr) rs1343830702
NM_000038.5(APC):c.6025C>A (p.Pro2009Thr) rs1554087150
NM_000038.5(APC):c.6037C>T (p.His2013Tyr) rs756213379
NM_000038.5(APC):c.6039T>C (p.His2013=) rs1554087166
NM_000038.5(APC):c.6040G>A (p.Val2014Ile) rs143313902
NM_000038.5(APC):c.6053delC (p.Pro2018Glnfs) rs1131691142
NM_000038.5(APC):c.6054A>G (p.Pro2018=) rs967247502
NM_000038.5(APC):c.6062T>A (p.Phe2021Tyr)
NM_000038.5(APC):c.6063C>T (p.Phe2021=) rs786203342
NM_000038.5(APC):c.6065C>G (p.Ser2022Ter) rs1554087174
NM_000038.5(APC):c.606A>G (p.Glu202=) rs878853460
NM_000038.5(APC):c.6071A>G (p.Asn2024Ser) rs863224546
NM_000038.5(APC):c.6074G>C (p.Ser2025Thr) rs1419565228
NM_000038.5(APC):c.607C>G (p.Gln203Glu) rs141576417
NM_000038.5(APC):c.607C>T (p.Gln203Ter) rs141576417
NM_000038.5(APC):c.6085_6093dupTCTCTTAGT (p.Ser2031_Ile2032insSerLeuSer) rs863224821
NM_000038.5(APC):c.608A>G (p.Gln203Arg) rs1554072626
NM_000038.5(APC):c.6099C>G (p.Asp2033Glu) rs370532497
NM_000038.5(APC):c.609A>G (p.Gln203=) rs1060504874
NM_000038.5(APC):c.60C>T (p.Asn20=) rs780155240
NM_000038.5(APC):c.6104A>T (p.Glu2035Val) rs748490937
NM_000038.5(APC):c.6109G>A (p.Asp2037Asn) rs864622311
NM_000038.5(APC):c.6112C>G (p.Leu2038Val) rs1433119360
NM_000038.5(APC):c.6117G>T (p.Leu2039Phe) rs372418435
NM_000038.5(APC):c.6118C>G (p.Gln2040Glu)
NM_000038.5(APC):c.6124T>C (p.Cys2042Arg) rs730881254
NM_000038.5(APC):c.6127A>G (p.Ile2043Val) rs876660233
NM_000038.5(APC):c.6131G>A (p.Ser2044Asn) rs375743017
NM_000038.5(APC):c.6135C>T (p.Ser2045=) rs187297940
NM_000038.5(APC):c.6136G>A (p.Ala2046Thr) rs770406711
NM_000038.5(APC):c.6136G>T (p.Ala2046Ser) rs770406711
NM_000038.5(APC):c.6137delC (p.Ala2046Glufs)
NM_000038.5(APC):c.6139A>G (p.Met2047Val) rs908214296
NM_000038.5(APC):c.6141G>A (p.Met2047Ile)
NM_000038.5(APC):c.6146A>G (p.Lys2049Arg) rs1554087254
NM_000038.5(APC):c.6162A>G (p.Ser2054=) rs776160547
NM_000038.5(APC):c.6166C>T (p.Leu2056Phe) rs921599281
NM_000038.5(APC):c.6168C>G (p.Leu2056=) rs878853461
NM_000038.5(APC):c.6173G>A (p.Gly2058Asp) rs150140908
NM_000038.5(APC):c.618C>A (p.Thr206=) rs1554072631
NM_000038.5(APC):c.6196A>G (p.Arg2066Gly) rs786204043
NM_000038.5(APC):c.6200A>G (p.Asn2067Ser)
NM_000038.5(APC):c.6203T>C (p.Met2068Thr) rs863224547
NM_000038.5(APC):c.6219T>G (p.Gly2073=) rs766559927
NM_000038.5(APC):c.6223G>A (p.Asp2075Asn) rs754004343
NM_000038.5(APC):c.622C>A (p.Gln208Lys) rs137854583
NM_000038.5(APC):c.6236A>C (p.Asp2079Ala) rs779413228
NM_000038.5(APC):c.6245A>G (p.Asp2082Gly) rs554370603
NM_000038.5(APC):c.6247_6250delATACinsTGT (p.Ile2083Cysfs) rs1064792978
NM_000038.5(APC):c.6248T>C (p.Ile2083Thr) rs758715972
NM_000038.5(APC):c.6248T>G (p.Ile2083Arg) rs758715972
NM_000038.5(APC):c.6249A>G (p.Ile2083Met) rs374625279
NM_000038.5(APC):c.624G>A (p.Gln208=) rs864622692
NM_000038.5(APC):c.6256C>G (p.Pro2086Ala) rs780667260
NM_000038.5(APC):c.6257C>G (p.Pro2086Arg) rs786202975
NM_000038.5(APC):c.6274C>T (p.Leu2092=) rs930830740
NM_000038.5(APC):c.6278C>T (p.Ser2093Phe) rs879254172
NM_000038.5(APC):c.6287C>G (p.Ser2096Ter)
NM_000038.5(APC):c.6289G>C (p.Glu2097Gln) rs730882132
NM_000038.5(APC):c.6294T>G (p.Asn2098Lys) rs1554087318
NM_000038.5(APC):c.6298G>T (p.Asp2100Tyr) rs1554087322
NM_000038.5(APC):c.6310A>G (p.Ile2104Val) rs878853462
NM_000038.5(APC):c.6316G>A (p.Glu2106Lys) rs886059796
NM_000038.5(APC):c.6348T>C (p.His2116=) rs1346330298
NM_000038.5(APC):c.6348T>G (p.His2116Gln)
NM_000038.5(APC):c.6349C>A (p.Gln2117Lys) rs587780546
NM_000038.5(APC):c.634A>G (p.Lys212Glu) rs771232437
NM_000038.5(APC):c.6358G>T (p.Ala2120Ser) rs754015152
NM_000038.5(APC):c.6360_6365dup (p.Ala2122_Cys2123insAlaAla) rs587780602
NM_000038.5(APC):c.6363_6365dupTGC (p.Ala2122_Cys2123insAla) rs587780602
NM_000038.5(APC):c.6368G>A (p.Cys2123Tyr)
NM_000038.5(APC):c.6368G>C (p.Cys2123Ser) rs878853463
NM_000038.5(APC):c.6371T>A (p.Leu2124Ter) rs1057517568
NM_000038.5(APC):c.637C>G (p.Arg213Gly) rs587781392
NM_000038.5(APC):c.637C>T (p.Arg213Ter) rs587781392
NM_000038.5(APC):c.6381A>G (p.Gln2127=) rs765256868
NM_000038.5(APC):c.6383C>T (p.Ala2128Val) rs753228011
NM_000038.5(APC):c.6383delC (p.Ala2128Valfs) rs587779803
NM_000038.5(APC):c.6387G>A (p.Ser2129=) rs374310157
NM_000038.5(APC):c.638G>A (p.Arg213Gln) rs1235428754
NM_000038.5(APC):c.6401C>G (p.Ser2134Cys) rs906640629
NM_000038.5(APC):c.6403A>G (p.Ile2135Val) rs757633174
NM_000038.5(APC):c.6434G>C (p.Gly2145Ala)
NM_000038.5(APC):c.6436T>C (p.Ser2146Pro)
NM_000038.5(APC):c.643C>T (p.Gln215Ter) rs137854577
NM_000038.5(APC):c.6440C>T (p.Pro2147Leu) rs779469633
NM_000038.5(APC):c.6446A>C (p.His2149Pro) rs749230730
NM_000038.5(APC):c.645+1G>A rs863225370
NM_000038.5(APC):c.645+9C>A rs863224286
NM_000038.5(APC):c.6452C>T (p.Thr2151Ile) rs1060503293
NM_000038.5(APC):c.6453A>C (p.Thr2151=) rs1057524298
NM_000038.5(APC):c.6457G>C (p.Asp2153His) rs1196287183
NM_000038.5(APC):c.645G>A (p.Gln215=) rs1060503295
NM_000038.5(APC):c.645G>C (p.Gln215His) rs1060503295
NM_000038.5(APC):c.646-20G>A rs1057517635
NM_000038.5(APC):c.646-8T>A rs879254149
NM_000038.5(APC):c.646-9T>C rs1060504878
NM_000038.5(APC):c.6460C>A (p.Gln2154Lys) rs1003613894
NM_000038.5(APC):c.6460C>G (p.Gln2154Glu) rs1003613894
NM_000038.5(APC):c.6463G>A (p.Glu2155Lys) rs774440273
NM_000038.5(APC):c.646C>T (p.Arg216Ter) rs62619935
NM_000038.5(APC):c.6473C>A (p.Pro2158His) rs587779804
NM_000038.5(APC):c.6473C>G (p.Pro2158Arg) rs587779804
NM_000038.5(APC):c.6474C>A (p.Pro2158=) rs772027192
NM_000038.5(APC):c.6474C>G (p.Pro2158=) rs772027192
NM_000038.5(APC):c.6477T>A (p.Phe2159Leu)
NM_000038.5(APC):c.647G>A (p.Arg216Gln) rs76685252
NM_000038.5(APC):c.6481A>G (p.Ser2161Gly) rs1162723112
NM_000038.5(APC):c.6485A>G (p.Asn2162Ser) rs1064795210
NM_000038.5(APC):c.6491G>C (p.Gly2164Ala) rs1490726940
NM_000038.5(APC):c.6492C>T (p.Gly2164=) rs765332758
NM_000038.5(APC):c.6493C>A (p.Pro2165Thr)
NM_000038.5(APC):c.6496C>A (p.Arg2166=) rs764527706
NM_000038.5(APC):c.6496C>G (p.Arg2166Gly)
NM_000038.5(APC):c.6497G>A (p.Arg2166Gln) rs752091655
NM_000038.5(APC):c.6499A>G (p.Ile2167Val)
NM_000038.5(APC):c.6502C>T (p.Leu2168=) rs767818933
NM_000038.5(APC):c.6508C>T (p.Pro2170Ser) rs1229142303
NM_000038.5(APC):c.6510A>C (p.Pro2170=) rs138571760
NM_000038.5(APC):c.6512G>A (p.Gly2171Glu) rs748745776
NM_000038.5(APC):c.6514G>A (p.Glu2172Lys) rs864622314
NM_000038.5(APC):c.6522T>C (p.Ser2174=) rs370781162
NM_000038.5(APC):c.6525A>G (p.Thr2175=) rs200151646
NM_000038.5(APC):c.6526T>C (p.Leu2176=) rs183468041
NM_000038.5(APC):c.6539A>C (p.Lys2180Thr) rs762955111
NM_000038.5(APC):c.6539A>G (p.Lys2180Arg)
NM_000038.5(APC):c.6547T>A (p.Ser2183Thr)
NM_000038.5(APC):c.6550G>A (p.Glu2184Lys) rs1064794107
NM_000038.5(APC):c.6553A>G (p.Ser2185Gly) rs1060503292
NM_000038.5(APC):c.6554G>A (p.Ser2185Asn) rs764255983
NM_000038.5(APC):c.656C>A (p.Ala219Asp)
NM_000038.5(APC):c.6573A>G (p.Gly2191=) rs553815910
NM_000038.5(APC):c.6577A>G (p.Lys2193Glu) rs1060503343
NM_000038.5(APC):c.6579_6587delAGTTTATAAinsGTT (p.Val2194_Lys2196delinsLeu) rs1554087540
NM_000038.5(APC):c.6581T>C (p.Val2194Ala)
NM_000038.5(APC):c.6586A>G (p.Lys2196Glu) rs864622102
NM_000038.5(APC):c.6588A>C (p.Lys2196Asn) rs961108427
NM_000038.5(APC):c.6605A>G (p.Lys2202Arg) rs1554087564
NM_000038.5(APC):c.6606A>C (p.Lys2202Asn) rs587781903
NM_000038.5(APC):c.6609T>C (p.Val2203=) rs149328018
NM_000038.5(APC):c.6610C>T (p.Arg2204Ter) rs752654519
NM_000038.5(APC):c.6611G>T (p.Arg2204Leu) rs1554087570
NM_000038.5(APC):c.6614C>G (p.Ser2205Cys) rs876659684
NM_000038.5(APC):c.6619_6620delTCinsAA (p.Ser2207Lys)
NM_000038.5(APC):c.6623A>C (p.Glu2208Ala) rs777612081
NM_000038.5(APC):c.6624A>G (p.Glu2208=) rs886059798
NM_000038.5(APC):c.6630A>G (p.Ser2210=) rs746725965
NM_000038.5(APC):c.6635A>G (p.Gln2212Arg) rs1060503262
NM_000038.5(APC):c.6637A>G (p.Met2213Val) rs186926737
NM_000038.5(APC):c.6637A>T (p.Met2213Leu) rs186926737
NM_000038.5(APC):c.6639G>A (p.Met2213Ile) rs35540155
NM_000038.5(APC):c.6648C>T (p.Pro2216=) rs776930640
NM_000038.5(APC):c.6658A>G (p.Asn2220Asp) rs374464049
NM_000038.5(APC):c.665A>T (p.Gln222Leu) rs1554074733
NM_000038.5(APC):c.6665C>T (p.Pro2222Leu) rs367761032
NM_000038.5(APC):c.6669A>G (p.Ser2223=) rs372680843
NM_000038.5(APC):c.6670A>G (p.Ile2224Val) rs374597207
NM_000038.5(APC):c.6674C>G (p.Ser2225Cys) rs759307079
NM_000038.5(APC):c.6675T>C (p.Ser2225=) rs950337714
NM_000038.5(APC):c.6676C>G (p.Arg2226Gly) rs1064794626
NM_000038.5(APC):c.6677G>A (p.Arg2226Gln) rs1246580689
NM_000038.5(APC):c.6679G>T (p.Gly2227Cys) rs367905430
NM_000038.5(APC):c.667C>T (p.Gln223Ter) rs1554074738
NM_000038.5(APC):c.6680G>T (p.Gly2227Val) rs786203367
NM_000038.5(APC):c.6682A>G (p.Arg2228Gly) rs199648202
NM_000038.5(APC):c.6684G>A (p.Arg2228=) rs752314977
NM_000038.5(APC):c.6694C>G (p.His2232Asp) rs730881256
NM_000038.5(APC):c.6699T>C (p.Ile2233=) rs1057521840
NM_000038.5(APC):c.669A>C (p.Gln223His) rs769482880
NM_000038.5(APC):c.6700C>T (p.Pro2234Ser) rs749507584
NM_000038.5(APC):c.6703G>A (p.Gly2235Arg) rs1432451765
NM_000038.5(APC):c.6710G>A (p.Arg2237Gln) rs1299714632
NM_000038.5(APC):c.6724A>G (p.Ser2242Gly) rs201375478
NM_000038.5(APC):c.6727A>G (p.Thr2243Ala) rs773539706
NM_000038.5(APC):c.6729A>C (p.Thr2243=) rs761296130
NM_000038.5(APC):c.672C>T (p.Ile224=) rs367816013
NM_000038.5(APC):c.6736G>A (p.Val2246Ile) rs1055180096
NM_000038.5(APC):c.6738T>A (p.Val2246=) rs1554087680
NM_000038.5(APC):c.6739T>C (p.Ser2247Pro) rs1554087682
NM_000038.5(APC):c.673G>A (p.Glu225Lys) rs768233232
NM_000038.5(APC):c.673G>C (p.Glu225Gln)
NM_000038.5(APC):c.6741T>C (p.Ser2247=) rs878853464
NM_000038.5(APC):c.6748G>A (p.Gly2250Ser) rs587783032
NM_000038.5(APC):c.674A>T (p.Glu225Val) rs1255190244
NM_000038.5(APC):c.6750C>T (p.Gly2250=) rs555799753
NM_000038.5(APC):c.6751C>T (p.Pro2251Ser) rs777206261
NM_000038.5(APC):c.6759T>G (p.Leu2253=) rs1554087705
NM_000038.5(APC):c.6771C>T (p.Ala2257=) rs1060504893
NM_000038.5(APC):c.6775A>G (p.Lys2259Glu) rs763707129
NM_000038.5(APC):c.6779G>A (p.Ser2260Asn) rs587781393
NM_000038.5(APC):c.6779G>T (p.Ser2260Ile) rs587781393
NM_000038.5(APC):c.6781C>G (p.Pro2261Ala)
NM_000038.5(APC):c.6781C>T (p.Pro2261Ser)
NM_000038.5(APC):c.6782C>T (p.Pro2261Leu) rs376494248
NM_000038.5(APC):c.6785G>T (p.Ser2262Ile) rs878853465
NM_000038.5(APC):c.6789A>G (p.Glu2263=) rs1057521959
NM_000038.5(APC):c.6790G>T (p.Gly2264Cys) rs755904252
NM_000038.5(APC):c.6794A>T (p.Gln2265Leu) rs864622560
NM_000038.5(APC):c.6795A>G (p.Gln2265=) rs779065389
NM_000038.5(APC):c.6796_6810delACAGCCACCACTTCT (p.Thr2266_Ser2270del) rs1057517569
NM_000038.5(APC):c.679G>T (p.Asp227Tyr) rs1554074749
NM_000038.5(APC):c.67C>G (p.Leu23Val) rs372367350
NM_000038.5(APC):c.6805A>C (p.Thr2269Pro)
NM_000038.5(APC):c.6809C>T (p.Ser2270Phe) rs878853466
NM_000038.5(APC):c.6811_6813delCCT (p.Pro2271del) rs786203391
NM_000038.5(APC):c.6813T>C (p.Pro2271=) rs1057520427
NM_000038.5(APC):c.6818G>A (p.Gly2273Glu) rs587781364
NM_000038.5(APC):c.6818G>T (p.Gly2273Val) rs587781364
NM_000038.5(APC):c.681C>G (p.Asp227Glu) rs1060503359
NM_000038.5(APC):c.6821C>T (p.Ala2274Val) rs34919187
NM_000038.5(APC):c.682A>G (p.Ile228Val) rs1554074757
NM_000038.5(APC):c.6838T>C (p.Ser2280Pro) rs777950722
NM_000038.5(APC):c.6841G>A (p.Glu2281Lys) rs1236451833
NM_000038.5(APC):c.6847A>G (p.Ser2283Gly) rs1554087786
NM_000038.5(APC):c.684_687delACTT (p.Leu229Valfs) rs1554074759
NM_000038.5(APC):c.6850C>A (p.Pro2284Thr) rs1554087789
NM_000038.5(APC):c.6850C>T (p.Pro2284Ser)
NM_000038.5(APC):c.6855T>C (p.Val2285=) rs1057524550
NM_000038.5(APC):c.6857C>T (p.Ala2286Val) rs200587641
NM_000038.5(APC):c.6866C>A (p.Thr2289Lys) rs876660654
NM_000038.5(APC):c.6866C>T (p.Thr2289Ile) rs876660654
NM_000038.5(APC):c.6871C>G (p.Gln2291Glu)
NM_000038.5(APC):c.6871C>T (p.Gln2291Ter)
NM_000038.5(APC):c.6872A>C (p.Gln2291Pro)
NM_000038.5(APC):c.6873A>T (p.Gln2291His) rs148878262
NM_000038.5(APC):c.6875T>C (p.Ile2292Thr)
NM_000038.5(APC):c.6877G>C (p.Gly2293Arg) rs876660777
NM_000038.5(APC):c.6880G>A (p.Gly2294Arg) rs1019564963
NM_000038.5(APC):c.6880G>C (p.Gly2294Arg) rs1019564963
NM_000038.5(APC):c.6885A>G (p.Ser2295=) rs763506865
NM_000038.5(APC):c.6887G>A (p.Ser2296Asn) rs919611781
NM_000038.5(APC):c.688C>T (p.Arg230Cys) rs587779805
NM_000038.5(APC):c.6895C>T (p.Pro2299Ser) rs1060503267
NM_000038.5(APC):c.6896C>T (p.Pro2299Leu) rs876658800
NM_000038.5(APC):c.6898_6900delTCT (p.Ser2300del) rs1554087834
NM_000038.5(APC):c.689G>A (p.Arg230His) rs587780545
NM_000038.5(APC):c.6907G>A (p.Gly2303Arg) rs544549596
NM_000038.5(APC):c.6913A>G (p.Arg2305Gly) rs1060503370
NM_000038.5(APC):c.6918T>A (p.Asp2306Glu) rs1060503350
NM_000038.5(APC):c.6920C>T (p.Ser2307Leu)
NM_000038.5(APC):c.6921G>A (p.Ser2307=) rs2229993
NM_000038.5(APC):c.6921G>C (p.Ser2307=) rs2229993
NM_000038.5(APC):c.6926C>T (p.Pro2309Leu) rs1060503329
NM_000038.5(APC):c.6931A>G (p.Arg2311Gly) rs878853467
NM_000038.5(APC):c.6932G>A (p.Arg2311Lys) rs878853468
NM_000038.5(APC):c.6933A>G (p.Arg2311=) rs752834820
NM_000038.5(APC):c.6934C>A (p.Pro2312Thr)
NM_000038.5(APC):c.693A>G (p.Ile231Met) rs1554074769
NM_000038.5(APC):c.6944A>G (p.Gln2315Arg) rs1060503273
NM_000038.5(APC):c.6945A>G (p.Gln2315=) rs786201348
NM_000038.5(APC):c.6948A>G (p.Pro2316=) rs202144406
NM_000038.5(APC):c.694C>T (p.Arg232Ter) rs397515734
NM_000038.5(APC):c.6952A>G (p.Ser2318Gly) rs747056590
NM_000038.5(APC):c.6959C>T (p.Pro2320Leu) rs863224548
NM_000038.5(APC):c.695G>A (p.Arg232Gln) rs201727026
NM_000038.5(APC):c.6963A>G (p.Ile2321Met)
NM_000038.5(APC):c.6965A>G (p.Gln2322Arg) rs1057517549
NM_000038.5(APC):c.6966G>C (p.Gln2322His) rs786204171
NM_000038.5(APC):c.6976C>T (p.Arg2326Ter) rs1060503355
NM_000038.5(APC):c.6977G>A (p.Arg2326Gln) rs531178000
NM_000038.5(APC):c.697C>T (p.Gln233Ter) rs1554074772
NM_000038.5(APC):c.6985A>G (p.Ile2329Val) rs146048493
NM_000038.5(APC):c.6989C>T (p.Ser2330Phe) rs1554087891
NM_000038.5(APC):c.6994G>C (p.Gly2332Arg) rs1389311736
NM_000038.5(APC):c.7001A>G (p.Asn2334Ser) rs1166730302
NM_000038.5(APC):c.7006A>G (p.Ile2336Val) rs1554087900
NM_000038.5(APC):c.7009A>C (p.Ser2337Arg) rs1554087905
NM_000038.5(APC):c.700C>T (p.Leu234Phe) rs1554074777
NM_000038.5(APC):c.7013C>G (p.Pro2338Arg) rs1060503377
NM_000038.5(APC):c.7018A>C (p.Asn2340His) rs748940586
NM_000038.5(APC):c.7020C>A (p.Asn2340Lys) rs773108684
NM_000038.5(APC):c.7020C>T (p.Asn2340=) rs773108684
NM_000038.5(APC):c.7022A>G (p.Lys2341Arg) rs760649454
NM_000038.5(APC):c.7026A>G (p.Leu2342=) rs766086022
NM_000038.5(APC):c.7026A>T (p.Leu2342Phe) rs766086022
NM_000038.5(APC):c.7032A>G (p.Gln2344=) rs753728632
NM_000038.5(APC):c.7036C>T (p.Pro2346Ser) rs200756935
NM_000038.5(APC):c.7043C>T (p.Thr2348Ile) rs1060503342
NM_000038.5(APC):c.7049C>T (p.Ser2350Phe) rs75207119
NM_000038.5(APC):c.7052C>G (p.Pro2351Arg) rs1554087955
NM_000038.5(APC):c.7059T>C (p.Thr2353=) rs1054356903
NM_000038.5(APC):c.705A>G (p.Leu235=) rs147036141
NM_000038.5(APC):c.7066A>C (p.Thr2356Pro) rs751861630
NM_000038.5(APC):c.7066A>G (p.Thr2356Ala)
NM_000038.5(APC):c.7066A>T (p.Thr2356Ser) rs751861630
NM_000038.5(APC):c.7074C>T (p.Ser2358=) rs1554087974
NM_000038.5(APC):c.7077A>G (p.Ser2359=) rs781472719
NM_000038.5(APC):c.7079G>T (p.Gly2360Val) rs750960862
NM_000038.5(APC):c.7088A>G (p.Lys2363Arg) rs587779806
NM_000038.5(APC):c.7089A>G (p.Lys2363=) rs864622761
NM_000038.5(APC):c.7095A>G (p.Ser2365=) rs747844776
NM_000038.5(APC):c.7097A>G (p.Tyr2366Cys)
NM_000038.5(APC):c.7098T>C (p.Tyr2366=) rs561394771
NM_000038.5(APC):c.7099A>G (p.Thr2367Ala) rs772778630
NM_000038.5(APC):c.70C>T (p.Arg24Ter) rs145945630
NM_000038.5(APC):c.7105C>T (p.Pro2369Ser) rs377308875
NM_000038.5(APC):c.7105_7107delCCA (p.Pro2369del) rs1064794884
NM_000038.5(APC):c.7107A>G (p.Pro2369=) rs778471612
NM_000038.5(APC):c.7109G>T (p.Gly2370Val) rs140079759
NM_000038.5(APC):c.7117A>G (p.Met2373Val) rs879254221
NM_000038.5(APC):c.7118T>G (p.Met2373Arg) rs1060503286
NM_000038.5(APC):c.7122C>T (p.Ser2374=) rs1554088024
NM_000038.5(APC):c.7125A>G (p.Gln2375=) rs587780603
NM_000038.5(APC):c.7128G>C (p.Gln2376His) rs762167924
NM_000038.5(APC):c.712dup (p.Gln238Profs) rs1554074793
NM_000038.5(APC):c.7132C>G (p.Leu2378Val) rs587782711
NM_000038.5(APC):c.7136C>G (p.Thr2379Ser) rs767691072
NM_000038.5(APC):c.7136C>T (p.Thr2379Ile) rs767691072
NM_000038.5(APC):c.7137C>G (p.Thr2379=) rs141454910
NM_000038.5(APC):c.7138A>C (p.Lys2380Gln) rs1554088069
NM_000038.5(APC):c.7143A>C (p.Gln2381His) rs756153152
NM_000038.5(APC):c.7147G>C (p.Gly2383Arg) rs1008025963
NM_000038.5(APC):c.7148G>A (p.Gly2383Asp) rs754320004
NM_000038.5(APC):c.7148G>T (p.Gly2383Val) rs754320004
NM_000038.5(APC):c.7150T>A (p.Leu2384Ile) rs755345693
NM_000038.5(APC):c.7154C>G (p.Ser2385Cys)
NM_000038.5(APC):c.7157A>G (p.Lys2386Arg) rs1554088082
NM_000038.5(APC):c.715G>A (p.Ala239Thr) rs777760565
NM_000038.5(APC):c.715G>C (p.Ala239Pro) rs777760565
NM_000038.5(APC):c.715G>T (p.Ala239Ser) rs777760565
NM_000038.5(APC):c.7166G>A (p.Ser2389Asn) rs779287035
NM_000038.5(APC):c.7166G>T (p.Ser2389Ile) rs779287035
NM_000038.5(APC):c.7169G>T (p.Ser2390Ile) rs1554088097
NM_000038.5(APC):c.7171A>G (p.Ile2391Val) rs1554088100
NM_000038.5(APC):c.7174C>A (p.Pro2392Thr) rs730881257
NM_000038.5(APC):c.7174C>T (p.Pro2392Ser)
NM_000038.5(APC):c.7175C>A (p.Pro2392Gln) rs1554088107
NM_000038.5(APC):c.7189G>A (p.Ala2397Thr) rs1554088112
NM_000038.5(APC):c.7190C>T (p.Ala2397Val) rs1554088113
NM_000038.5(APC):c.7193C>T (p.Ser2398Phe) rs150882838
NM_000038.5(APC):c.7194C>T (p.Ser2398=) rs565688379
NM_000038.5(APC):c.71G>A (p.Arg24Gln) rs878853469
NM_000038.5(APC):c.71G>T (p.Arg24Leu)
NM_000038.5(APC):c.7201C>G (p.Leu2401Val) rs2229994
NM_000038.5(APC):c.7201C>T (p.Leu2401=) rs2229994
NM_000038.5(APC):c.7204A>T (p.Asn2402Tyr) rs587780550
NM_000038.5(APC):c.7205A>G (p.Asn2402Ser) rs745843442
NM_000038.5(APC):c.7206T>G (p.Asn2402Lys)
NM_000038.5(APC):c.7209G>A (p.Gln2403=) rs769603145
NM_000038.5(APC):c.7211T>A (p.Met2404Lys) rs864622246
NM_000038.5(APC):c.7214A>C (p.Asn2405Thr) rs730881258
NM_000038.5(APC):c.7219G>A (p.Gly2407Ser)
NM_000038.5(APC):c.721G>A (p.Glu241Lys) rs777603154
NM_000038.5(APC):c.7235A>G (p.Lys2412Arg) rs869312785
NM_000038.5(APC):c.723A>G (p.Glu241=) rs1302603852
NM_000038.5(APC):c.7245A>G (p.Glu2415=) rs1554088172
NM_000038.5(APC):c.7252A>G (p.Arg2418Gly) rs760755317
NM_000038.5(APC):c.7262C>T (p.Ser2421Leu) rs536557651
NM_000038.5(APC):c.7264A>G (p.Thr2422Ala) rs730881260
NM_000038.5(APC):c.7264A>T (p.Thr2422Ser) rs730881260
NM_000038.5(APC):c.7265C>T (p.Thr2422Ile)
NM_000038.5(APC):c.7269A>G (p.Lys2423=) rs786203620
NM_000038.5(APC):c.7272A>G (p.Ser2424=) rs1554088209
NM_000038.5(APC):c.7273A>G (p.Ser2425Gly) rs730881261
NM_000038.5(APC):c.7276G>A (p.Gly2426Arg) rs1060503353
NM_000038.5(APC):c.7278A>G (p.Gly2426=) rs756770951
NM_000038.5(APC):c.7281T>C (p.Ser2427=) rs786201448
NM_000038.5(APC):c.7285T>C (p.Ser2429Pro) rs780608768
NM_000038.5(APC):c.7286C>G (p.Ser2429Cys) rs1060503363
NM_000038.5(APC):c.729+3delT rs780245766
NM_000038.5(APC):c.729+4A>G rs1114167548
NM_000038.5(APC):c.7292G>A (p.Arg2431Lys) rs879254262
NM_000038.5(APC):c.7298A>G (p.Glu2433Gly) rs730881262
NM_000038.5(APC):c.730-10A>G rs756676415
NM_000038.5(APC):c.730-22G>C rs115634618
NM_000038.5(APC):c.730-3C>T rs786203125
NM_000038.5(APC):c.730-5A>G
NM_000038.5(APC):c.7308A>G (p.Val2436=) rs1220693522
NM_000038.5(APC):c.730_731delAG (p.Arg244Valfs) rs387906228
NM_000038.5(APC):c.7315C>T (p.Arg2439Cys) rs1311878041
NM_000038.5(APC):c.7320G>C (p.Gln2440His) rs1554088251
NM_000038.5(APC):c.7324A>G (p.Thr2442Ala) rs863224549
NM_000038.5(APC):c.7334A>G (p.Lys2445Arg) rs1465349688
NM_000038.5(APC):c.7337A>C (p.Glu2446Ala)
NM_000038.5(APC):c.7338A>C (p.Glu2446Asp) rs887554004
NM_000038.5(APC):c.7339G>A (p.Ala2447Thr) rs864622136
NM_000038.5(APC):c.735A>G (p.Ser245=) rs876659397
NM_000038.5(APC):c.7361_7363delGAA (p.Arg2454del) rs1291144227
NM_000038.5(APC):c.7374A>T (p.Glu2458Asp) rs1554088285
NM_000038.5(APC):c.7377T>C (p.Ser2459=) rs775573115
NM_000038.5(APC):c.7378G>C (p.Ala2460Pro) rs771929461
NM_000038.5(APC):c.7380T>G (p.Ala2460=) rs1060504889
NM_000038.5(APC):c.7388A>C (p.Glu2463Ala) rs876660182
NM_000038.5(APC):c.7389A>C (p.Glu2463Asp) rs587782127
NM_000038.5(APC):c.7391C>A (p.Ser2464Tyr) rs766473931
NM_000038.5(APC):c.7391C>G (p.Ser2464Cys)
NM_000038.5(APC):c.7393C>G (p.Leu2465Val) rs1455101572
NM_000038.5(APC):c.7395T>C (p.Leu2465=) rs369906346
NM_000038.5(APC):c.7396T>C (p.Ser2466Pro) rs786203234
NM_000038.5(APC):c.7399C>A (p.Pro2467Thr) rs372305287
NM_000038.5(APC):c.7399C>G (p.Pro2467Ala) rs372305287
NM_000038.5(APC):c.7400C>T (p.Pro2467Leu) rs758713824
NM_000038.5(APC):c.7402T>C (p.Ser2468Pro) rs375586273
NM_000038.5(APC):c.7402T>G (p.Ser2468Ala) rs375586273
NM_000038.5(APC):c.7404A>G (p.Ser2468=) rs863224287
NM_000038.5(APC):c.7405T>C (p.Ser2469Pro)
NM_000038.5(APC):c.7407T>C (p.Ser2469=) rs1282202968
NM_000038.5(APC):c.7411C>T (p.Pro2471Ser)
NM_000038.5(APC):c.7415C>T (p.Ala2472Val) rs200399245
NM_000038.5(APC):c.7424C>T (p.Thr2475Ile) rs1554088345
NM_000038.5(APC):c.7433A>C (p.Gln2478Pro) rs745307814
NM_000038.5(APC):c.7435G>A (p.Ala2479Thr) rs369365383
NM_000038.5(APC):c.7438C>T (p.Gln2480Ter) rs1554088359
NM_000038.5(APC):c.7442C>A (p.Thr2481Asn)
NM_000038.5(APC):c.7443T>A (p.Thr2481=) rs147757080
NM_000038.5(APC):c.744C>G (p.Asn248Lys)
NM_000038.5(APC):c.7459T>C (p.Ser2487Pro) rs1060503300
NM_000038.5(APC):c.7468G>A (p.Asp2490Asn) rs538230198
NM_000038.5(APC):c.7471A>G (p.Met2491Val) rs375674083
NM_000038.5(APC):c.7472T>C (p.Met2491Thr) rs369075403
NM_000038.5(APC):c.7477_7478delCT (p.Leu2493Ilefs) rs1554088391
NM_000038.5(APC):c.7478T>C (p.Leu2493Pro) rs769889352
NM_000038.5(APC):c.747G>A (p.Lys249=) rs878853470
NM_000038.5(APC):c.748C>T (p.His250Tyr) rs1554076141
NM_000038.5(APC):c.7490C>T (p.Ser2497Leu) rs141010008
NM_000038.5(APC):c.7491G>C (p.Ser2497=) rs776327733
NM_000038.5(APC):c.7495G>C (p.Val2499Leu) rs33941929
NM_000038.5(APC):c.7497T>C (p.Val2499=) rs1554088406
NM_000038.5(APC):c.7498C>A (p.Gln2500Lys) rs372535376
NM_000038.5(APC):c.7498C>G (p.Gln2500Glu) rs372535376
NM_000038.5(APC):c.7498C>T (p.Gln2500Ter)
NM_000038.5(APC):c.7499A>G (p.Gln2500Arg)
NM_000038.5(APC):c.749A>G (p.His250Arg) rs774296531
NM_000038.5(APC):c.74_75delAA (p.Gln25Argfs) rs1554067124
NM_000038.5(APC):c.7504G>A (p.Gly2502Ser) rs2229995
NM_000038.5(APC):c.7511G>A (p.Trp2504Ter) rs755046558
NM_000038.5(APC):c.7514G>A (p.Arg2505Gln) rs147549623
NM_000038.5(APC):c.7519C>T (p.Leu2507Phe)
NM_000038.5(APC):c.7531C>T (p.Leu2511Phe) rs72541815
NM_000038.5(APC):c.7532T>C (p.Leu2511Pro) rs1554088437
NM_000038.5(APC):c.7533C>T (p.Leu2511=) rs1057522957
NM_000038.5(APC):c.7535G>C (p.Ser2512Thr) rs1060503315
NM_000038.5(APC):c.7536T>C (p.Ser2512=) rs587780604
NM_000038.5(APC):c.753A>G (p.Glu251=) rs1554076143
NM_000038.5(APC):c.7540A>C (p.Thr2514Pro)
NM_000038.5(APC):c.7540A>G (p.Thr2514Ala) rs545125246
NM_000038.5(APC):c.7541C>G (p.Thr2514Ser) rs747833393
NM_000038.5(APC):c.7543A>G (p.Ile2515Val) rs554356011
NM_000038.5(APC):c.7548G>A (p.Glu2516=) rs548471464
NM_000038.5(APC):c.7550A>G (p.Tyr2517Cys) rs587783036
NM_000038.5(APC):c.7557T>C (p.Asp2519=) rs864622391
NM_000038.5(APC):c.7558G>A (p.Gly2520Arg) rs746138566
NM_000038.5(APC):c.7564C>A (p.Pro2522Thr) rs371149405
NM_000038.5(APC):c.7565C>G (p.Pro2522Arg) rs763438389
NM_000038.5(APC):c.756C>T (p.Thr252=) rs771535363
NM_000038.5(APC):c.7570A>G (p.Lys2524Glu) rs143060722
NM_000038.5(APC):c.7574G>A (p.Arg2525His) rs762034315
NM_000038.5(APC):c.7577A>G (p.His2526Arg) rs750012595
NM_000038.5(APC):c.757G>A (p.Gly253Ser) rs772806807
NM_000038.5(APC):c.7582A>G (p.Ile2528Val) rs1554088492
NM_000038.5(APC):c.7583T>C (p.Ile2528Thr) rs730881264
NM_000038.5(APC):c.7586C>T (p.Ala2529Val) rs1554088496
NM_000038.5(APC):c.7588C>T (p.Arg2530Trp) rs730881265
NM_000038.5(APC):c.7591T>G (p.Ser2531Ala) rs1060503311
NM_000038.5(APC):c.7594C>T (p.His2532Tyr) rs375080917
NM_000038.5(APC):c.759C>T (p.Gly253=) rs746850663
NM_000038.5(APC):c.75A>G (p.Gln25=) rs876659361
NM_000038.5(APC):c.7606C>T (p.Pro2536Ser)
NM_000038.5(APC):c.7616T>A (p.Leu2539His) rs1554088529
NM_000038.5(APC):c.7619C>T (p.Pro2540Leu) rs777667481
NM_000038.5(APC):c.761C>G (p.Ser254Ter) rs1060503334
NM_000038.5(APC):c.761C>T (p.Ser254Leu) rs1060503334
NM_000038.5(APC):c.7621A>G (p.Ile2541Val) rs587778033
NM_000038.5(APC):c.7625A>G (p.Asn2542Ser) rs151163793
NM_000038.5(APC):c.7629G>A (p.Arg2543=) rs780270498
NM_000038.5(APC):c.7632A>G (p.Ser2544=) rs749324187
NM_000038.5(APC):c.7639T>A (p.Trp2547Arg)
NM_000038.5(APC):c.7639T>G (p.Trp2547Gly)
NM_000038.5(APC):c.7645C>T (p.Arg2549Cys) rs199539353
NM_000038.5(APC):c.764A>G (p.His255Arg) rs530670052
NM_000038.5(APC):c.7652A>T (p.His2551Leu) rs1060503314
NM_000038.5(APC):c.7654A>T (p.Ser2552Cys) rs1554088567
NM_000038.5(APC):c.7657A>C (p.Lys2553Gln) rs772318413
NM_000038.5(APC):c.7660C>T (p.His2554Tyr) rs1213302882
NM_000038.5(APC):c.7664C>T (p.Ser2555Leu) rs1554088582
NM_000038.5(APC):c.7667C>T (p.Ser2556Leu) rs761133356
NM_000038.5(APC):c.768T>C (p.Asp256=) rs764268036
NM_000038.5(APC):c.768T>G (p.Asp256Glu) rs764268036
NM_000038.5(APC):c.7696A>C (p.Arg2566=) rs1060504883
NM_000038.5(APC):c.7704A>C (p.Gly2568=) rs35043160
NM_000038.5(APC):c.7704A>G (p.Gly2568=) rs35043160
NM_000038.5(APC):c.7707T>G (p.Ser2569Arg)
NM_000038.5(APC):c.7711_7716delTCTTCA (p.Ser2571_Ser2572del) rs760567682
NM_000038.5(APC):c.7717A>G (p.Ile2573Val) rs145444830
NM_000038.5(APC):c.7721T>C (p.Leu2574Pro) rs1282183992
NM_000038.5(APC):c.7731A>G (p.Ser2577=) rs537187449
NM_000038.5(APC):c.7754A>C (p.Lys2585Thr) rs876658884
NM_000038.5(APC):c.7757G>T (p.Ser2586Ile) rs199806334
NM_000038.5(APC):c.775C>T (p.Arg259Trp) rs762117133
NM_000038.5(APC):c.7764T>A (p.Asp2588Glu) rs757073062
NM_000038.5(APC):c.7766A>G (p.Glu2589Gly) rs200406572
NM_000038.5(APC):c.776G>A (p.Arg259Gln) rs767457050
NM_000038.5(APC):c.7772A>C (p.His2591Pro) rs375393416
NM_000038.5(APC):c.7778A>G (p.Asn2593Ser) rs367676584
NM_000038.5(APC):c.7779C>T (p.Asn2593=) rs1425732484
NM_000038.5(APC):c.777G>C (p.Arg259=) rs147704593
NM_000038.5(APC):c.777G>T (p.Arg259=) rs147704593
NM_000038.5(APC):c.7781C>G (p.Ser2594Cys) rs543396310
NM_000038.5(APC):c.7786T>G (p.Ser2596Ala) rs138137162
NM_000038.5(APC):c.7793C>A (p.Thr2598Asn) rs747339588
NM_000038.5(APC):c.7797A>C (p.Lys2599Asn) rs730881267
NM_000038.5(APC):c.7802G>A (p.Ser2601Asn) rs1554088668
NM_000038.5(APC):c.7808A>G (p.Glu2603Gly) rs587779807
NM_000038.5(APC):c.7815A>C (p.Gln2605His) rs1554088680
NM_000038.5(APC):c.7817T>C (p.Val2606Ala)
NM_000038.5(APC):c.7821C>T (p.Ser2607=) rs532235331
NM_000038.5(APC):c.7822G>A (p.Ala2608Thr) rs878853471
NM_000038.5(APC):c.7823C>G (p.Ala2608Gly) rs1554088688
NM_000038.5(APC):c.7829G>T (p.Gly2610Val)
NM_000038.5(APC):c.7832C>A (p.Thr2611Lys) rs587778037
NM_000038.5(APC):c.7832C>T (p.Thr2611Ile) rs587778037
NM_000038.5(APC):c.7833A>G (p.Thr2611=) rs1057520909
NM_000038.5(APC):c.7836G>C (p.Trp2612Cys) rs1239291755
NM_000038.5(APC):c.7838G>A (p.Arg2613Lys) rs1554088693
NM_000038.5(APC):c.7843A>G (p.Ile2615Val) rs863224550
NM_000038.5(APC):c.7844T>C (p.Ile2615Thr) rs1317953419
NM_000038.5(APC):c.7852A>G (p.Asn2618Asp) rs863224551
NM_000038.5(APC):c.7858T>A (p.Phe2620Ile) rs587781816
NM_000038.5(APC):c.7862C>G (p.Ser2621Cys) rs72541816
NM_000038.5(APC):c.7864C>G (p.Pro2622Ala) rs1060503330
NM_000038.5(APC):c.7865C>T (p.Pro2622Leu) rs267600320
NM_000038.5(APC):c.7867A>G (p.Thr2623Ala) rs1060503368
NM_000038.5(APC):c.7878T>G (p.Thr2626=) rs757020188
NM_000038.5(APC):c.7882C>G (p.Gln2628Glu)
NM_000038.5(APC):c.7888G>A (p.Val2630Ile) rs199688874
NM_000038.5(APC):c.7889T>C (p.Val2630Ala) rs876660453
NM_000038.5(APC):c.7891T>G (p.Ser2631Ala) rs1060503376
NM_000038.5(APC):c.7893C>T (p.Ser2631=) rs876659640
NM_000038.5(APC):c.789T>A (p.Gly263=) rs767053295
NM_000038.5(APC):c.7903A>G (p.Thr2635Ala) rs886059799
NM_000038.5(APC):c.7909G>A (p.Gly2637Ser) rs1060503272
NM_000038.5(APC):c.790C>G (p.Gln264Glu) rs1434813233
NM_000038.5(APC):c.7912G>C (p.Ala2638Pro) rs1554088749
NM_000038.5(APC):c.7914T>G (p.Ala2638=) rs758440266
NM_000038.5(APC):c.7915G>C (p.Glu2639Gln) rs878853472
NM_000038.5(APC):c.7916A>C (p.Glu2639Ala) rs778376399
NM_000038.5(APC):c.791A>G (p.Gln264Arg) rs369345931
NM_000038.5(APC):c.7929A>C (p.Leu2643=) rs138796072
NM_000038.5(APC):c.7929A>G (p.Leu2643=) rs138796072
NM_000038.5(APC):c.792A>G (p.Gln264=) rs863224288
NM_000038.5(APC):c.792del (p.Gly265Glufs) rs863224459
NM_000038.5(APC):c.7930_7934delATTTA (p.Ile2644Serfs)
NM_000038.5(APC):c.7936C>G (p.Gln2646Glu) rs1554088768
NM_000038.5(APC):c.7942G>A (p.Ala2648Thr)
NM_000038.5(APC):c.7942G>T (p.Ala2648Ser) rs1195417407
NM_000038.5(APC):c.7944A>T (p.Ala2648=) rs1554088776
NM_000038.5(APC):c.7945C>T (p.Pro2649Ser) rs864622245
NM_000038.5(APC):c.7950T>C (p.Ala2650=) rs1554088784
NM_000038.5(APC):c.7957A>G (p.Lys2653Glu) rs1554088788
NM_000038.5(APC):c.7967A>G (p.Asp2656Gly) rs1463203731
NM_000038.5(APC):c.7977G>A (p.Val2659=) rs1392424178
NM_000038.5(APC):c.7979G>A (p.Arg2660Lys) rs775012353
NM_000038.5(APC):c.7986G>A (p.Glu2662=) rs571645304
NM_000038.5(APC):c.7988A>G (p.Asp2663Gly) rs1060503277
NM_000038.5(APC):c.7993C>T (p.Pro2665Ser)
NM_000038.5(APC):c.8003A>G (p.Asn2668Ser) rs374886362
NM_000038.5(APC):c.8006C>G (p.Pro2669Arg) rs1335624903
NM_000038.5(APC):c.8008A>C (p.Arg2670=) rs756875223
NM_000038.5(APC):c.800G>A (p.Gly267Glu) rs747759906
NM_000038.5(APC):c.8010A>G (p.Arg2670=) rs786201524
NM_000038.5(APC):c.8013T>C (p.Ser2671=) rs1294217069
NM_000038.5(APC):c.8017A>C (p.Arg2673=) rs767286063
NM_000038.5(APC):c.8017A>G (p.Arg2673Gly) rs767286063
NM_000038.5(APC):c.8023C>T (p.Pro2675Ser)
NM_000038.5(APC):c.8029G>A (p.Gly2677Ser) rs750174880
NM_000038.5(APC):c.802G>T (p.Glu268Ter) rs1326410920
NM_000038.5(APC):c.8030G>A (p.Gly2677Asp) rs760391304
NM_000038.5(APC):c.8035A>T (p.Thr2679Ser)
NM_000038.5(APC):c.8038C>G (p.Pro2680Ala) rs587780553
NM_000038.5(APC):c.8038C>T (p.Pro2680Ser) rs587780553
NM_000038.5(APC):c.8042C>T (p.Pro2681Leu) rs182456139
NM_000038.5(APC):c.8043G>A (p.Pro2681=) rs149347068
NM_000038.5(APC):c.8043G>C (p.Pro2681=) rs149347068
NM_000038.5(APC):c.8048T>C (p.Ile2683Thr)
NM_000038.5(APC):c.8054G>C (p.Ser2685Thr) rs1554088868
NM_000038.5(APC):c.8057T>C (p.Val2686Ala) rs757901425
NM_000038.5(APC):c.805A>G (p.Ile269Val) rs1554076203
NM_000038.5(APC):c.8060C>T (p.Ser2687Leu) rs144746572
NM_000038.5(APC):c.8061A>G (p.Ser2687=) rs746180965
NM_000038.5(APC):c.8065A>G (p.Lys2689Glu) rs1554088874
NM_000038.5(APC):c.8068G>A (p.Ala2690Thr) rs140868933
NM_000038.5(APC):c.8071A>G (p.Asn2691Asp) rs1060503281
NM_000038.5(APC):c.807C>A (p.Ile269=) rs1000878850
NM_000038.5(APC):c.8086G>T (p.Asp2696Tyr) rs368724873
NM_000038.5(APC):c.8089T>A (p.Ser2697Thr) rs1388750461
NM_000038.5(APC):c.8089T>G (p.Ser2697Ala) rs1388750461
NM_000038.5(APC):c.8100T>C (p.Asn2700=) rs761326128
NM_000038.5(APC):c.8104G>A (p.Ala2702Thr) rs587779808
NM_000038.5(APC):c.8107A>G (p.Lys2703Glu) rs730881270
NM_000038.5(APC):c.8119G>T (p.Gly2707Cys) rs1554088906
NM_000038.5(APC):c.811A>G (p.Met271Val) rs587781464
NM_000038.5(APC):c.8127C>G (p.Gly2709=) rs1060504871
NM_000038.5(APC):c.8128A>C (p.Ser2710Arg) rs760472102
NM_000038.5(APC):c.8134C>G (p.Pro2712Ala) rs76933416
NM_000038.5(APC):c.8138T>C (p.Met2713Thr) rs1479889029
NM_000038.5(APC):c.813G>A (p.Met271Ile) rs1064793903
NM_000038.5(APC):c.8140C>A (p.Arg2714Ser) rs864622205
NM_000038.5(APC):c.8140C>G (p.Arg2714Gly) rs864622205
NM_000038.5(APC):c.8140_8141delCG (p.Arg2714Tyrfs)
NM_000038.5(APC):c.8141G>A (p.Arg2714His) rs747362422
NM_000038.5(APC):c.8143A>G (p.Thr2715Ala) rs749895442
NM_000038.5(APC):c.8144C>T (p.Thr2715Ile) rs587780605
NM_000038.5(APC):c.8146G>A (p.Val2716Met) rs587778044
NM_000038.5(APC):c.8146G>C (p.Val2716Leu) rs587778044
NM_000038.5(APC):c.8148G>C (p.Val2716=) rs1158207177
NM_000038.5(APC):c.8149G>T (p.Gly2717Cys) rs764260286
NM_000038.5(APC):c.814G>C (p.Ala272Pro) rs878853473
NM_000038.5(APC):c.8150G>C (p.Gly2717Ala) rs876658201
NM_000038.5(APC):c.8154G>T (p.Leu2718Phe) rs1459209015
NM_000038.5(APC):c.8161C>T (p.Arg2721Cys) rs587782312
NM_000038.5(APC):c.8162G>A (p.Arg2721His) rs587780606
NM_000038.5(APC):c.817A>G (p.Thr273Ala)
NM_000038.5(APC):c.8182G>A (p.Val2728Met) rs587778045
NM_000038.5(APC):c.8188G>A (p.Ala2730Thr) rs1060503348
NM_000038.5(APC):c.8189C>T (p.Ala2730Val) rs976132108
NM_000038.5(APC):c.8197C>G (p.Gln2733Glu) rs1429919728
NM_000038.5(APC):c.8199A>G (p.Gln2733=) rs372365378
NM_000038.5(APC):c.8203G>C (p.Gly2735Arg) rs376392084
NM_000038.5(APC):c.8207C>T (p.Thr2736Ile) rs1291474243
NM_000038.5(APC):c.8208T>G (p.Thr2736=) rs786201421
NM_000038.5(APC):c.8212A>G (p.Ile2738Val) rs876658839
NM_000038.5(APC):c.8213T>C (p.Ile2738Thr) rs863224552
NM_000038.5(APC):c.8214A>G (p.Ile2738Met) rs1554088977
NM_000038.5(APC):c.8226A>G (p.Gln2742=) rs1404406885
NM_000038.5(APC):c.8229T>G (p.Asn2743Lys)
NM_000038.5(APC):c.8233C>T (p.Pro2745Ser) rs587779809
NM_000038.5(APC):c.8234C>T (p.Pro2745Leu) rs759421641
NM_000038.5(APC):c.8240C>T (p.Pro2747Leu) rs774747249
NM_000038.5(APC):c.8241T>G (p.Pro2747=) rs1060504875
NM_000038.5(APC):c.8245T>A (p.Ser2749Thr) rs1064794391
NM_000038.5(APC):c.8250G>A (p.Glu2750=) rs767530768
NM_000038.5(APC):c.8251A>G (p.Thr2751Ala) rs1060503341
NM_000038.5(APC):c.8252C>T (p.Thr2751Ile) rs1441515372
NM_000038.5(APC):c.8255A>C (p.Asn2752Thr) rs878853474
NM_000038.5(APC):c.8258A>G (p.Glu2753Gly) rs876660649
NM_000038.5(APC):c.8261G>A (p.Ser2754Asn) rs369721828
NM_000038.5(APC):c.8264C>G (p.Ser2755Cys) rs1383526361
NM_000038.5(APC):c.8265T>C (p.Ser2755=) rs756633556
NM_000038.5(APC):c.8265T>G (p.Ser2755=) rs756633556
NM_000038.5(APC):c.8266A>G (p.Ile2756Val) rs146115809
NM_000038.5(APC):c.8273A>G (p.Glu2758Gly) rs371616945
NM_000038.5(APC):c.8275C>T (p.Arg2759Cys) rs755366812
NM_000038.5(APC):c.8276G>A (p.Arg2759His) rs538289470
NM_000038.5(APC):c.8281C>T (p.Pro2761Ser) rs1060503332
NM_000038.5(APC):c.8282C>T (p.Pro2761Leu) rs757874563
NM_000038.5(APC):c.8286C>A (p.Phe2762Leu) rs879254185
NM_000038.5(APC):c.8291C>G (p.Ser2764Cys) rs1057520223
NM_000038.5(APC):c.8291C>T (p.Ser2764Phe) rs1057520223
NM_000038.5(APC):c.8293A>G (p.Ser2765Gly) rs1554089051
NM_000038.5(APC):c.8298C>T (p.Ser2766=) rs876658523
NM_000038.5(APC):c.8303_8306delGCAA (p.Ser2768Asnfs) rs1554089054
NM_000038.5(APC):c.8306A>G (p.Lys2769Arg) rs878853475
NM_000038.5(APC):c.8310_8311delCA (p.His2770Glnfs)
NM_000038.5(APC):c.8312G>T (p.Ser2771Ile) rs1554089060
NM_000038.5(APC):c.8316A>G (p.Ser2772=) rs1554089062
NM_000038.5(APC):c.8319T>G (p.Pro2773=) rs587780539
NM_000038.5(APC):c.8321G>C (p.Ser2774Thr) rs863224553
NM_000038.5(APC):c.8323G>A (p.Gly2775Arg)
NM_000038.5(APC):c.8324G>C (p.Gly2775Ala)
NM_000038.5(APC):c.8325G>A (p.Gly2775=) rs770719841
NM_000038.5(APC):c.832C>T (p.Gln278Ter) rs1554076217
NM_000038.5(APC):c.8332G>T (p.Ala2778Ser) rs587778046
NM_000038.5(APC):c.8341delG (p.Val2781Terfs) rs1554089068
NM_000038.5(APC):c.8349T>G (p.Pro2783=) rs1468974374
NM_000038.5(APC):c.834G>A (p.Gln278=) rs1060503261
NM_000038.5(APC):c.835-15G>A rs1057521022
NM_000038.5(APC):c.835-20A>G rs777546674
NM_000038.5(APC):c.835-3T>C rs372090940
NM_000038.5(APC):c.835-4T>G rs756807560
NM_000038.5(APC):c.8353A>C (p.Asn2785His) rs769736863
NM_000038.5(APC):c.8354A>T (p.Asn2785Ile) rs1408383396
NM_000038.5(APC):c.835G>T (p.Gly279Cys) rs1554079129
NM_000038.5(APC):c.8360A>G (p.Asn2787Ser)
NM_000038.5(APC):c.836G>T (p.Gly279Val) rs587780607
NM_000038.5(APC):c.8372_8374delGGA (p.Arg2791del)
NM_000038.5(APC):c.8378G>A (p.Ser2793Asn) rs374853436
NM_000038.5(APC):c.8382C>A (p.Ser2794Arg) rs762190393
NM_000038.5(APC):c.8382C>T (p.Ser2794=) rs762190393
NM_000038.5(APC):c.8383G>A (p.Ala2795Thr) rs369264968
NM_000038.5(APC):c.8383G>C (p.Ala2795Pro)
NM_000038.5(APC):c.8389A>G (p.Ser2797Gly) rs147287751
NM_000038.5(APC):c.8390G>A (p.Ser2797Asn) rs1060503339
NM_000038.5(APC):c.8391C>A (p.Ser2797Arg) rs1060503256
NM_000038.5(APC):c.8395T>C (p.Ser2799Pro) rs906191341
NM_000038.5(APC):c.8398G>T (p.Ala2800Ser) rs1554089100
NM_000038.5(APC):c.8399C>T (p.Ala2800Val) rs141024271
NM_000038.5(APC):c.8401C>T (p.Arg2801Trp) rs1242407699
NM_000038.5(APC):c.8402G>A (p.Arg2801Gln) rs754363694
NM_000038.5(APC):c.8405C>T (p.Pro2802Leu) rs765631031
NM_000038.5(APC):c.8406A>G (p.Pro2802=) rs1060504895
NM_000038.5(APC):c.8410C>G (p.Gln2804Glu) rs1554089117
NM_000038.5(APC):c.8412G>T (p.Gln2804His) rs878853476
NM_000038.5(APC):c.8416C>G (p.Pro2806Ala) rs587780608
NM_000038.5(APC):c.8419A>C (p.Thr2807Pro) rs894164638
NM_000038.5(APC):c.841A>G (p.Thr281Ala) rs769727966
NM_000038.5(APC):c.841A>T (p.Thr281Ser) rs769727966
NM_000038.5(APC):c.8420C>A (p.Thr2807Asn)
NM_000038.5(APC):c.8420C>T (p.Thr2807Ile)
NM_000038.5(APC):c.8424A>G (p.Pro2808=) rs1060504881
NM_000038.5(APC):c.8425G>A (p.Val2809Met) rs886059801
NM_000038.5(APC):c.8429A>G (p.Asn2810Ser) rs758044862
NM_000038.5(APC):c.8430T>A (p.Asn2810Lys) rs1057522374
NM_000038.5(APC):c.8433C>T (p.Asn2811=) rs864622247
NM_000038.5(APC):c.8436C>T (p.Asn2812=) rs750971628
NM_000038.5(APC):c.8438C>A (p.Thr2813Lys) rs1060503275
NM_000038.5(APC):c.8439A>C (p.Thr2813=) rs864622211
NM_000038.5(APC):c.8439A>T (p.Thr2813=) rs864622211
NM_000038.5(APC):c.8441A>G (p.Lys2814Arg) rs878853477
NM_000038.5(APC):c.8442G>C (p.Lys2814Asn) rs1267993620
NM_000038.5(APC):c.845C>A (p.Thr282Lys) rs1554079132
NM_000038.5(APC):c.8462A>G (p.Asp2821Gly) rs780049836
NM_000038.5(APC):c.8464A>G (p.Ser2822Gly) rs1554089167
NM_000038.5(APC):c.8467A>C (p.Thr2823Pro) rs587778034
NM_000038.5(APC):c.846A>G (p.Thr282=) rs1554079134
NM_000038.5(APC):c.8477G>A (p.Ser2826Asn) rs587780609
NM_000038.5(APC):c.847C>T (p.Arg283Ter) rs786201856
NM_000038.5(APC):c.8483C>A (p.Thr2828Asn) rs1554089195
NM_000038.5(APC):c.8484C>G (p.Thr2828=) rs864622473
NM_000038.5(APC):c.848G>A (p.Arg283Gln) rs149154604
NM_000038.5(APC):c.8492C>T (p.Pro2831Leu) rs773513581
NM_000038.5(APC):c.8497C>G (p.Arg2833Gly)
NM_000038.5(APC):c.849A>G (p.Arg283=) rs878853478
NM_000038.5(APC):c.8501A>C (p.His2834Pro)
NM_000038.5(APC):c.8506G>A (p.Gly2836Arg) rs1427281586
NM_000038.5(APC):c.8508G>T (p.Gly2836=) rs878853479
NM_000038.5(APC):c.8511T>C (p.Ser2837=) rs1010623341
NM_000038.5(APC):c.8518G>A (p.Val2840Met) rs878853480
NM_000038.5(APC):c.8523A>G (p.Thr2841=) rs753003333
NM_000038.5(APC):c.8524T>G (p.Ser2842Ala) rs587780610
NM_000038.5(APC):c.8525C>T (p.Ser2842Phe)
NM_000038.5(APC):c.853G>A (p.Asp285Asn) rs773525821
NM_000038.5(APC):c.853G>C (p.Asp285His) rs773525821
NM_000038.5(APC):c.854A>G (p.Asp285Gly) rs201093383
NM_000038.5(APC):c.855C>T (p.Asp285=) rs1060504896
NM_000038.5(APC):c.866C>T (p.Ala289Val) rs1554079159
NM_000038.5(APC):c.868A>G (p.Ser290Gly)
NM_000038.5(APC):c.869G>A (p.Ser290Asn) rs776852155
NM_000038.5(APC):c.869G>C (p.Ser290Thr) rs776852155
NM_000038.5(APC):c.870T>C (p.Ser290=) rs863224289
NM_000038.5(APC):c.874_880delTTGAGTT (p.Ser293Valfs) rs1060503263
NM_000038.5(APC):c.876G>C (p.Leu292Phe) rs760059672
NM_000038.5(APC):c.878G>A (p.Ser293Asn) rs1040502776
NM_000038.5(APC):c.87T>G (p.Asp29Glu)
NM_000038.5(APC):c.883A>G (p.Ser295Gly) rs587780611
NM_000038.5(APC):c.893A>G (p.His298Arg) rs1554079195
NM_000038.5(APC):c.894C>T (p.His298=) rs143341972
NM_000038.5(APC):c.895T>A (p.Ser299Thr) rs763630775
NM_000038.5(APC):c.896_897delCT (p.Ser299Cysfs) rs397515735
NM_000038.5(APC):c.899C>T (p.Ala300Val)
NM_000038.5(APC):c.901C>T (p.Pro301Ser)
NM_000038.5(APC):c.903T>G (p.Pro301=) rs1554079205
NM_000038.5(APC):c.904C>T (p.Arg302Ter) rs137854568
NM_000038.5(APC):c.905G>A (p.Arg302Gln) rs764841552
NM_000038.5(APC):c.911T>C (p.Leu304Pro) rs1064793322
NM_000038.5(APC):c.916A>G (p.Ser306Gly) rs1554079212
NM_000038.5(APC):c.918T>G (p.Ser306Arg) rs730881231
NM_000038.5(APC):c.920A>T (p.His307Leu) rs869312787
NM_000038.5(APC):c.921T>A (p.His307Gln) rs1554079215
NM_000038.5(APC):c.924G>A (p.Leu308=) rs1060504873
NM_000038.5(APC):c.924G>T (p.Leu308=) rs1060504873
NM_000038.5(APC):c.925G>T (p.Gly309Ter) rs786204118
NM_000038.5(APC):c.928A>G (p.Thr310Ala)
NM_000038.5(APC):c.933+16A>G rs1057517599
NM_000038.5(APC):c.933+19C>A rs778599778
NM_000038.5(APC):c.933+1G>A rs876660765
NM_000038.5(APC):c.933+2T>C rs1057517559
NM_000038.5(APC):c.933+5C>A rs573528468
NM_000038.5(APC):c.934-14C>T rs778707022
NM_000038.5(APC):c.934-21C>A rs754906600
NM_000038.5(APC):c.934-2A>G rs1554079938
NM_000038.5(APC):c.934-?_*2113+?del
NM_000038.5(APC):c.934G>A (p.Val312Met) rs1060503285
NM_000038.5(APC):c.935dupT (p.Glu313Glyfs) rs587781451
NM_000038.5(APC):c.937_938delGA (p.Glu313Asnfs) rs387906239
NM_000038.5(APC):c.940A>G (p.Met314Val) rs1554079946
NM_000038.5(APC):c.942G>A (p.Met314Ile)
NM_000038.5(APC):c.943G>T (p.Val315Leu) rs863224554
NM_000038.5(APC):c.948T>C (p.Tyr316=) rs748010172
NM_000038.5(APC):c.948T>G (p.Tyr316Ter) rs748010172
NM_000038.5(APC):c.94A>G (p.Asn32Asp) rs587781972
NM_000038.5(APC):c.951A>T (p.Ser317=) rs970626019
NM_000038.5(APC):c.956delT (p.Leu319Cysfs) rs1064793530
NM_000038.5(APC):c.958T>G (p.Ser320Ala) rs1554079952
NM_000038.5(APC):c.95A>G (p.Asn32Ser) rs539108537
NM_000038.5(APC):c.961A>G (p.Met321Val) rs781603478
NM_000038.5(APC):c.968G>C (p.Gly323Ala) rs1554079954
NM_000038.5(APC):c.977A>T (p.Asp326Val)
NM_000038.5(APC):c.986A>G (p.Asp329Gly) rs878853482
NM_000038.5(APC):c.989delT (p.Met330Serfs)
NM_000038.5(APC):c.992C>T (p.Ser331Leu) rs745918184
NM_000038.5(APC):c.993G>A (p.Ser331=) rs148343173
NM_000038.5(APC):c.994C>T (p.Arg332Ter) rs775126020
NM_000038.5(APC):c.995G>A (p.Arg332Gln) rs377665107
NM_000038.5(APC):c.995G>T (p.Arg332Leu) rs377665107
NM_000038.5:c.2057_2058delAT
NM_000038.5:c.281_282delGT
NM_000038.6(APC):c.2840_2841del (p.Cys947Phefs) rs1554084531
NM_000038.6(APC):c.2995C>G (p.Gln999Glu)
NM_000038.6(APC):c.4018_4020dup (p.Ser1341_Leu1342insSer) rs864622376
NM_000038.6(APC):c.423-5_423-3del rs876657408
NM_000038.6(APC):c.5465T>A (p.Val1822Asp) rs459552
NM_001127510.2(APC):c.4363_4365delAATinsGCTGA (p.Asn1455Alafs) rs1554085825
NM_001127510.2(APC):c.4389dup (p.Glu1464Argfs) rs1554085850
NM_001127510.2(APC):c.532-1G>A rs1554072547
NM_001127510.2(APC):c.5942del (p.Asn1981Ilefs) rs397509433
NM_001127510.2(APC):c.7573C>T (p.Arg2525Cys) rs774952444
NM_001127511.2(APC):c.-192A>G rs879253784
NM_001127511.2(APC):c.-192A>T rs879253784
NM_001127511.2(APC):c.-5C>A rs972010514
NM_001127511.2(APC):c.1015dup (p.Ile339Asnfs) rs387906232
NM_001127511.2(APC):c.1300_1301dup (p.Leu435Phefs) rs1554080698
NM_001127511.2(APC):c.1476dup (p.Gly493Trpfs) rs1554081749
NM_001127511.2(APC):c.2361dup (p.His788Thrfs) rs1554084141
NM_001127511.2(APC):c.4923_4949dup (p.Asn1649_Glu1650insAspLeuThrIleGluSerProProAsn) rs1064793736
NM_001127511.2(APC):c.5558_5560dup (p.Asp1853_Val1854insAsp) rs779014936
NM_001127511.2(APC):c.6529_6533delTATAAinsAT (p.Tyr2177_Lys2178delinsIle) rs1554087551
NM_001127511.2(APC):c.78C>A (p.Ser26Arg) rs113782655
NM_001127511.2(APC):c.83G>A (p.Gly28Asp) rs1057517606
NM_001127511.2(APC):c.[-125delA;-195A>C]

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.