ClinVar Miner

List of variants in gene APC

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 5945
Download table as spreadsheet
HGVS dbSNP
APC deletion
APC, 1-BP DEL, 3720T
APC, 2-BP INS, CODON 1924
APC, 4-BP DEL, 7929TCTA
APC, 5-BP DEL, NT3221
NC_000005.10:g.112766534C>G
NC_000005.10:g.112780758T>C
NC_000005.10:g.112792712C>T
NC_000005.10:g.112801269A>G
NC_000005.10:g.112828010C>A
NC_000005.10:g.112834948T>C
NC_000005.9:g.(?_112043009)_(112043599_?)del
NC_000005.9:g.(?_112043009)_(112043599_?)dup
NC_000005.9:g.(?_112043009)_(112073585_?)dup
NC_000005.9:g.(?_112043009)_(112111444_?)dup
NC_000005.9:g.(?_112043009)_(112116610_?)del
NC_000005.9:g.(?_112043009)_(112179823_?)del
NC_000005.9:g.(?_112043009)_(112179833_?)del
NC_000005.9:g.(?_112072721)_(112090728_?)dup
NC_000005.9:g.(?_112072721)_(112102113_?)del
NC_000005.9:g.(?_112072721)_(112111440_?)dup
NC_000005.9:g.(?_112072721)_(112179829_?)del
NC_000005.9:g.(?_112072721)_(112179833_?)del
NC_000005.9:g.(?_112073556)_(112151290_?)del
NC_000005.9:g.(?_112090570)_(112157688_?)dup
NC_000005.9:g.(?_112090578)_(112111444_?)dup
NC_000005.9:g.(?_112090582)_(112111440_?)dup
NC_000005.9:g.(?_112090588)_(112179768_?)del
NC_000005.9:g.(?_112102013)_(112179833_?)del
NC_000005.9:g.(?_112111316)_(112137090_?)del
NC_000005.9:g.(?_112111320)_(112179829_?)del
NC_000005.9:g.(?_112116481)_(112179829_?)dup
NC_000005.9:g.(?_112116487)_(112181936_?)del
NC_000005.9:g.(?_112151182)_(112170872_?)del
NC_000005.9:g.(?_112151186)_(112179829_?)dup
NC_000005.9:g.(?_112151192)_(112157688_?)del
NC_000005.9:g.(?_112154663)_(112157688_?)del
NC_000005.9:g.(?_112162795)_(112179833_?)del
NC_000005.9:g.(?_112162795)_(112179833_?)dup
NC_000005.9:g.(?_112162805)_(112181936_?)dup
NC_000005.9:g.(?_112163620)_(112179829_?)del
NC_000005.9:g.(?_112164553)_(112164669_?)del
NC_000005.9:g.(?_112170642)_(112170868_?)del
NC_000005.9:g.(?_112173244)_(112179829_?)del
NC_000005.9:g.112179040_112192379del13340
NG_008481.4:g.(?_150033)_(158719_?)del
NM_000038.5(APC):c.(?_-37541)_(-27791_?)del
NM_000038.5(APC):c.-164T>C rs113017087
NM_000038.5(APC):c.-18-?_834+?dup
NM_000038.5(APC):c.-292G>A rs1340025419
NM_000038.5(APC):c.-30042T>C rs1191699028
NM_000038.5(APC):c.-30043A>G rs1487833679
NM_000038.5(APC):c.-30045G>A rs1057517556
NM_000038.5(APC):c.-30045G>T rs1057517556
NM_000038.5(APC):c.-30046G>C rs1223298182
NM_000038.5(APC):c.-30052G>T rs1296416614
NM_000038.5(APC):c.-30059G>T rs765384591
NM_000038.5(APC):c.-30061G>A rs1239946140
NM_000038.5(APC):c.-30064C>A rs1312050427
NM_000038.5(APC):c.-30070G>C rs888841371
NM_000038.5(APC):c.-30072G>C rs1554060317
NM_000038.5(APC):c.-30073A>G rs1554060315
NM_000038.5(APC):c.-30077G>A rs1163442131
NM_000038.5(APC):c.-30078G>C rs1366978080
NM_000038.5(APC):c.-30079T>C rs1488176769
NM_000038.5(APC):c.-30091A>C rs766151900
NM_000038.5(APC):c.-30092T>C rs1554060306
NM_000038.5(APC):c.-30093G>A rs1004213568
NM_000038.5(APC):c.-30093G>C rs1004213568
NM_000038.5(APC):c.-30094C>T rs755954869
NM_000038.5(APC):c.-30097G>A rs367773779
NM_000038.5(APC):c.-30097G>C rs367773779
NM_000038.5(APC):c.-30103G>A rs1057517582
NM_000038.5(APC):c.-30104G>A rs1189155420
NM_000038.5(APC):c.-30104G>T rs1189155420
NM_000038.5(APC):c.-30105C>T rs1057517584
NM_000038.5(APC):c.-30106C>G rs1248809012
NM_000038.5(APC):c.-30108G>A rs587778028
NM_000038.5(APC):c.-30108G>C rs587778028
NM_000038.5(APC):c.-30113G>A rs761467156
NM_000038.5(APC):c.-30124C>T rs1554060293
NM_000038.5(APC):c.-30127G>A rs1232734822
NM_000038.5(APC):c.-30128C>T rs1312161630
NM_000038.5(APC):c.-30136A>C rs1302045127
NM_000038.5(APC):c.-30141G>A rs1337289014
NM_000038.5(APC):c.-30147C>T rs1400852847
NM_000038.5(APC):c.-30153G>A rs1554060285
NM_000038.5(APC):c.-30156C>T rs770241997
NM_000038.5(APC):c.-30160G>A rs762748481
NM_000038.5(APC):c.-30161C>T rs1422300065
NM_000038.5(APC):c.-30163C>T rs1554060282
NM_000038.5(APC):c.-30179T>C rs980704771
NM_000038.5(APC):c.-30179T>G rs980704771
NM_000038.5(APC):c.-30181T>C rs1554060278
NM_000038.5(APC):c.-30188G>A rs772953367
NM_000038.5(APC):c.-30188G>C rs772953367
NM_000038.5(APC):c.-30197C>A rs917976853
NM_000038.5(APC):c.-30199G>T rs1397116635
NM_000038.5(APC):c.-30202C>A rs1291188034
NM_000038.5(APC):c.-30205G>A rs777188684
NM_000038.5(APC):c.-30210G>A rs1304453341
NM_000038.5(APC):c.-30215C>T rs1554060261
NM_000038.5(APC):c.-30224G>A rs1057517567
NM_000038.5(APC):c.-30226A>G rs189807660
NM_000038.5(APC):c.-30226A>T rs189807660
NM_000038.5(APC):c.-30228C>T rs1395970563
NM_000038.5(APC):c.-30231C>T rs972010514
NM_000038.5(APC):c.-30238T>C rs1057517554
NM_000038.5(APC):c.-30240C>T rs1554060248
NM_000038.5(APC):c.-30244C>A rs1357561329
NM_000038.5(APC):c.-30244C>G rs1357561329
NM_000038.5(APC):c.-30258C>T rs1015952631
NM_000038.5(APC):c.-30260C>T rs1376128351
NM_000038.5(APC):c.-30265T>A rs1466692709
NM_000038.5(APC):c.-30267G>T rs748454058
NM_000038.5(APC):c.-30281C>T rs1189950358
NM_000038.5(APC):c.-30285T>C rs1554060243
NM_000038.5(APC):c.-30287T>C rs1554060241
NM_000038.5(APC):c.-30290T>C rs1554060239
NM_000038.5(APC):c.-30291C>T rs1473007055
NM_000038.5(APC):c.-30294G>A rs1163893701
NM_000038.5(APC):c.-30297C>T rs544132569
NM_000038.5(APC):c.-30299C>G rs1415610352
NM_000038.5(APC):c.-30300T>C rs1554060234
NM_000038.5(APC):c.-30304C>T rs953008592
NM_000038.5(APC):c.-30305G>A rs1369181601
NM_000038.5(APC):c.-30309C>A rs1306105402
NM_000038.5(APC):c.-30309C>T rs1306105402
NM_000038.5(APC):c.-30310T>C rs1340630542
NM_000038.5(APC):c.-30312G>C rs926522652
NM_000038.5(APC):c.-30322A>C rs1411710258
NM_000038.5(APC):c.-30324G>A rs997256982
NM_000038.5(APC):c.-30334C>G rs561513597
NM_000038.5(APC):c.-30334C>T rs561513597
NM_000038.5(APC):c.-30335C>G rs761634030
NM_000038.5(APC):c.-30336C>T rs1029692674
NM_000038.5(APC):c.-30339A>G rs1052992527
NM_000038.5(APC):c.-30344G>T rs1372371966
NM_000038.5(APC):c.-30345G>A rs1460028540
NM_000038.5(APC):c.-30346C>T rs904073379
NM_000038.5(APC):c.-30347G>C rs1173776603
NM_000038.5(APC):c.-30349C>T rs185346146
NM_000038.5(APC):c.-30350C>G rs964366695
NM_000038.5(APC):c.-30350C>T rs964366695
NM_000038.5(APC):c.-30351A>T rs1045063324
NM_000038.5(APC):c.-30352G>A rs948080320
NM_000038.5(APC):c.-30352G>C rs948080320
NM_000038.5(APC):c.-30352G>T rs948080320
NM_000038.5(APC):c.-30354G>C rs543098847
NM_000038.5(APC):c.-30356G>C rs1056513509
NM_000038.5(APC):c.-30356G>T rs1056513509
NM_000038.5(APC):c.-30357G>A rs572582235
NM_000038.5(APC):c.-30357G>C rs572582235
NM_000038.5(APC):c.-30357G>T rs572582235
NM_000038.5(APC):c.-30358G>A rs182500056
NM_000038.5(APC):c.-30358G>C rs182500056
NM_000038.5(APC):c.-30358G>T rs182500056
NM_000038.5(APC):c.-30359C>A rs79896135
NM_000038.5(APC):c.-30359C>G rs79896135
NM_000038.5(APC):c.-30359C>T rs79896135
NM_000038.5(APC):c.-30360T>A rs963346102
NM_000038.5(APC):c.-30360T>C rs963346102
NM_000038.5(APC):c.-30361C>G rs1311747020
NM_000038.5(APC):c.-30361C>T rs1311747020
NM_000038.5(APC):c.-30365G>C rs1554060208
NM_000038.5(APC):c.-30366C>A rs775297664
NM_000038.5(APC):c.-30366C>G rs775297664
NM_000038.5(APC):c.-30371C>G rs986030414
NM_000038.5(APC):c.-30372C>T rs1554060206
NM_000038.5(APC):c.-30375A>C rs922676017
NM_000038.5(APC):c.-30376G>A rs1459755551
NM_000038.5(APC):c.-30377G>C rs1029997545
NM_000038.5(APC):c.-30378C>T rs138386816
NM_000038.5(APC):c.-30382C>A rs1031181133
NM_000038.5(APC):c.-30382C>T rs1031181133
NM_000038.5(APC):c.-30383G>A rs1554060197
NM_000038.5(APC):c.-30389G>A rs558562104
NM_000038.5(APC):c.-30392C>A rs904001781
NM_000038.5(APC):c.-30392C>G rs904001781
NM_000038.5(APC):c.-30392C>T rs904001781
NM_000038.5(APC):c.-30393G>A rs1278244063
NM_000038.5(APC):c.-30394G>A rs1554060194
NM_000038.5(APC):c.-30396G>C rs1000470082
NM_000038.5(APC):c.-30397G>C rs968943120
NM_000038.5(APC):c.-30399A>G rs1273775271
NM_000038.5(APC):c.-30403T>A rs1020491376
NM_000038.5(APC):c.-30403T>C rs1020491376
NM_000038.5(APC):c.-30404G>A rs1045323633
NM_000038.5(APC):c.-30407C>T rs115658307
NM_000038.5(APC):c.-30408G>T rs1554060189
NM_000038.5(APC):c.-30410G>C rs575784409
NM_000038.5(APC):c.-30412G>T rs1554060187
NM_000038.5(APC):c.-30413G>A rs1554060186
NM_000038.5(APC):c.-30414C>T rs761454123
NM_000038.5(APC):c.-30430A>G rs554351451
NM_000038.5(APC):c.-30438G>A rs930090983
NM_000038.5(APC):c.-30439A>G rs1554060181
NM_000038.5(APC):c.-30444A>G rs1554060180
NM_000038.5(APC):c.-30445C>T rs1178835678
NM_000038.5(APC):c.-30453C>G rs1554060178
NM_000038.5(APC):c.-30458T>C rs1554060175
NM_000038.5(APC):c.-30459C>T rs1333841760
NM_000038.5(APC):c.-30460C>G rs145818737
NM_000038.5(APC):c.-30460C>T rs145818737
NM_000038.5(APC):c.-30466G>C rs59923692
NM_000038.5(APC):c.-30467A>C rs190326008
NM_000038.5(APC):c.-30467A>G rs190326008
NM_000038.5(APC):c.-30467delA rs201014315
NM_000038.5(APC):c.-30471A>C rs75580617
NM_000038.5(APC):c.-30476T>C rs538243333
NM_000038.5(APC):c.-30476T>G rs538243333
NM_000038.5(APC):c.-30478T>C rs931845291
NM_000038.5(APC):c.-30479C>A rs1424887097
NM_000038.5(APC):c.-30482G>C rs1409487828
NM_000038.5(APC):c.-30484C>A rs1554060161
NM_000038.5(APC):c.-30486C>G rs748588164
NM_000038.5(APC):c.-30487T>A rs1312495728
NM_000038.5(APC):c.-30487T>C rs1312495728
NM_000038.5(APC):c.-30490T>C rs1280021363
NM_000038.5(APC):c.-30492T>C rs866427693
NM_000038.5(APC):c.-30493C>T rs942777534
NM_000038.5(APC):c.-30500T>C rs1213502095
NM_000038.5(APC):c.-30501A>G rs911239343
NM_000038.5(APC):c.-30501A>T rs911239343
NM_000038.5(APC):c.-30502C>A rs1313658633
NM_000038.5(APC):c.-30502C>T rs1313658633
NM_000038.5(APC):c.-30503G>A rs979191484
NM_000038.5(APC):c.-30506T>C rs1279143171
NM_000038.5(APC):c.-30526A>C rs372923973
NM_000038.5(APC):c.-30526A>G rs372923973
NM_000038.5(APC):c.-30528G>T rs1373788988
NM_000038.5(APC):c.-30530G>A rs1432662523
NM_000038.5(APC):c.-30530G>T rs1432662523
NM_000038.5(APC):c.-30531A>T rs1345543059
NM_000038.5(APC):c.-30532A>C rs1012461653
NM_000038.5(APC):c.-30532A>T rs1012461653
NM_000038.5(APC):c.-30535G>C rs1020543876
NM_000038.5(APC):c.-30536C>G rs989021062
NM_000038.5(APC):c.-30540T>A rs1248905809
NM_000038.5(APC):c.-30540T>C rs1248905809
NM_000038.5(APC):c.-30541G>C rs1035047381
NM_000038.5(APC):c.-30543C>G rs1554060135
NM_000038.5(APC):c.-30547G>T rs1554060134
NM_000038.5(APC):c.-30550A>G rs571137741
NM_000038.5(APC):c.-30551C>G rs994601309
NM_000038.5(APC):c.-30555A>C rs1257642100
NM_000038.5(APC):c.-30558G>C rs1351477360
NM_000038.5(APC):c.-30559G>C rs1192399402
NM_000038.5(APC):c.-30560G>A rs1554060128
NM_000038.5(APC):c.-30560G>C rs1554060128
NM_000038.5(APC):c.-30568T>C rs1218378018
NM_000038.5(APC):c.-30569A>G rs13180781
NM_000038.5(APC):c.-30573A>G rs1554060123
NM_000038.5(APC):c.-30574C>T rs1273083857
NM_000038.5(APC):c.-30576G>A rs1320184514
NM_000038.5(APC):c.-30577A>G rs1046974767
NM_000038.5(APC):c.-30578T>C rs929883108
NM_000038.5(APC):c.-30579C>T rs1554060114
NM_000038.5(APC):c.-30585G>T rs560366894
NM_000038.5(APC):c.-30586C>T rs1554060110
NM_000038.5(APC):c.-30590G>A rs545524187
NM_000038.5(APC):c.-30593T>C rs1554060105
NM_000038.5(APC):c.-30603G>C rs1554060097
NM_000038.5(APC):c.-30605A>T rs1554060095
NM_000038.5(APC):c.-30608A>G rs1554060092
NM_000038.5(APC):c.-30608A>T rs1554060092
NM_000038.5(APC):c.-30610C>T rs1554060091
NM_000038.5(APC):c.-30611G>T rs1554060090
NM_000038.5(APC):c.-30626C>G rs931897682
NM_000038.5(APC):c.-30632C>T rs185951958
NM_000038.5(APC):c.-30642A>G rs116505416
NM_000038.5(APC):c.-30712G>A rs73216228
NM_000038.5(APC):c.-540G>A rs116483942
NM_000038.5(APC):c.-70G>C rs115242894
NM_000038.5(APC):c.-752C>T rs2439593
NM_000038.5(APC):c.-848A>G rs2464810
NM_000038.5(APC):c.-85-?_-19+?del
NM_000038.5(APC):c.-85-?_1048+?del
NM_000038.5(APC):c.-85-?_1743+?del
NM_000038.5(APC):c.-85-?_834+?del
NM_000038.5(APC):c.-85_*2113del
NM_000038.5(APC):c.1-?_1408+?del
NM_000038.5(APC):c.1-?_1958+?del
NM_000038.5(APC):c.1-?_8532+?del
NM_000038.5(APC):c.1312+3_1312+4delAT rs730881228
NM_000038.5(APC):c.1313-?_8532+?del
NM_000038.5(APC):c.1408+20delT rs772486710
NM_000038.5(APC):c.1409-?_*(1_?)del
NM_000038.5(APC):c.1409-?_1626+?del
NM_000038.5(APC):c.1409-?_1743+?del
NM_000038.5(APC):c.1530_1548+10delTGGAGATGTAGCCAACAAGGTATGTTTTT rs1554081752
NM_000038.5(APC):c.1548+3_1548+4delAT rs886039510
NM_000038.5(APC):c.1744-14_1744-13delCT rs1554083086
NM_000038.5(APC):c.1744-?_1958+?del (p.(?))
NM_000038.5(APC):c.1958+11_1958+12delAG rs1554083267
NM_000038.5(APC):c.1958+27delT rs1402242990
NM_000038.5(APC):c.2155-?_3960+?del
NM_000038.5(APC):c.220+10_220+12delAAA rs864622493
NM_000038.5(APC):c.3146-?_8532+?del
NM_000038.5(APC):c.423-?_531+?del (p.(?))
NM_000038.5(APC):c.423-?_729+?del
NM_000038.5(APC):c.4575_4576ins337
NM_000038.5(APC):c.531+5_531+8delGTAA rs1554071617
NM_000038.5(APC):c.532-14_532-12delATT rs765893314
NM_000038.5(APC):c.729+3delT rs780245766
NM_000038.5(APC):c.730_731delAG (p.Arg244Valfs) rs387906228
NM_000038.5(APC):c.792del (p.Gly265Glufs) rs863224459
NM_000038.5(APC):c.934-?_*2113+?del
NM_000038.5:c.423-17insT
NM_000038.5:c.5844_5845delTGAAAAGinsGGAAAA
NM_000038.6(APC):c.*1050T>C rs17135042
NM_000038.6(APC):c.*1098T>C rs41116
NM_000038.6(APC):c.*10A>G rs1554089226
NM_000038.6(APC):c.*1132C>A rs886059811
NM_000038.6(APC):c.*1164G>A rs576186544
NM_000038.6(APC):c.*1203A>C rs6594650
NM_000038.6(APC):c.*1233_*1235TAT[1] rs886059812
NM_000038.6(APC):c.*1294A>G rs886059813
NM_000038.6(APC):c.*1304G>A rs112588804
NM_000038.6(APC):c.*1320T>A rs373883680
NM_000038.6(APC):c.*134C>A rs76439767
NM_000038.6(APC):c.*134C>G rs76439767
NM_000038.6(APC):c.*135T>G rs79414727
NM_000038.6(APC):c.*137G>A rs75440329
NM_000038.6(APC):c.*142C>T rs6875894
NM_000038.6(APC):c.*1460C>T rs3733961
NM_000038.6(APC):c.*1497C>T rs138754620
NM_000038.6(APC):c.*1535G>T rs76017392
NM_000038.6(APC):c.*1555C>T rs886059814
NM_000038.6(APC):c.*1556C>G rs448475
NM_000038.6(APC):c.*1609T>C rs767384752
NM_000038.6(APC):c.*1753G>A rs397768
NM_000038.6(APC):c.*1834T>G rs886059815
NM_000038.6(APC):c.*1840A>G rs886059816
NM_000038.6(APC):c.*1937G>T rs886059817
NM_000038.6(APC):c.*1960C>G rs886059818
NM_000038.6(APC):c.*1970T>G rs886059819
NM_000038.6(APC):c.*2005T>G rs559244186
NM_000038.6(APC):c.*2087C>A rs886059820
NM_000038.6(APC):c.*2090C>A rs78525333
NM_000038.6(APC):c.*210_*213del rs763673039
NM_000038.6(APC):c.*248A>G rs186777258
NM_000038.6(APC):c.*266C>A rs191347307
NM_000038.6(APC):c.*2_*3AG[2]
NM_000038.6(APC):c.*404_*405insA rs1554089340
NM_000038.6(APC):c.*405C>A rs79379053
NM_000038.6(APC):c.*414dup rs397817775
NM_000038.6(APC):c.*434C>T rs12189
NM_000038.6(APC):c.*467A>G rs74503138
NM_000038.6(APC):c.*505C>A rs886059803
NM_000038.6(APC):c.*551T>C rs886059804
NM_000038.6(APC):c.*574T>C rs886059805
NM_000038.6(APC):c.*624A>C rs886059806
NM_000038.6(APC):c.*634C>A rs75495374
NM_000038.6(APC):c.*645A>G rs886059807
NM_000038.6(APC):c.*714G>T rs886059808
NM_000038.6(APC):c.*805C>A rs75717494
NM_000038.6(APC):c.*86C>A rs1804197
NM_000038.6(APC):c.*913T>C rs886059809
NM_000038.6(APC):c.*928_*929del rs555618339
NM_000038.6(APC):c.-14A>G rs1057521293
NM_000038.6(APC):c.-16C>T rs371665872
NM_000038.6(APC):c.-18-1090T>C rs2439591
NM_000038.6(APC):c.-18-1121C>T rs76062715
NM_000038.6(APC):c.-18-112A>G rs765486151
NM_000038.6(APC):c.-18-1160G>T rs79575641
NM_000038.6(APC):c.-18-1288T>C rs11241183
NM_000038.6(APC):c.-18-136G>T rs77982776
NM_000038.6(APC):c.-18-13T>G rs1554067089
NM_000038.6(APC):c.-18-1457G>T rs79521550
NM_000038.6(APC):c.-18-151G>T rs77384355
NM_000038.6(APC):c.-18-1815T>G rs769073607
NM_000038.6(APC):c.-18-1966T>G rs6891448
NM_000038.6(APC):c.-18-2063G>A rs4705617
NM_000038.6(APC):c.-18-2126C>G rs74792427
NM_000038.6(APC):c.-18-250C>G rs78810609
NM_000038.6(APC):c.-18-251G>A rs78038307
NM_000038.6(APC):c.-18-2625C>A rs78847434
NM_000038.6(APC):c.-18-2634C>A rs77939971
NM_000038.6(APC):c.-18-2858T>C rs76885576
NM_000038.6(APC):c.-18-3206C>A rs79856040
NM_000038.6(APC):c.-18-3243T>G rs11954856
NM_000038.6(APC):c.-18-3696C>T rs11950612
NM_000038.6(APC):c.-18-396T>A rs80230956
NM_000038.6(APC):c.-18-398A>C rs76429873
NM_000038.6(APC):c.-18-3dup rs1414740147
NM_000038.6(APC):c.-18-4405T>A rs12518091
NM_000038.6(APC):c.-18-4623A>C rs75276466
NM_000038.6(APC):c.-18-4626G>C rs75169120
NM_000038.6(APC):c.-18-4629T>G rs75886562
NM_000038.6(APC):c.-18-4631C>A rs76924560
NM_000038.6(APC):c.-18-4635C>A rs80288037
NM_000038.6(APC):c.-18-4959T>G rs28373740
NM_000038.6(APC):c.-18-5070A>G rs75848865
NM_000038.6(APC):c.-18-5107T>G rs75609412
NM_000038.6(APC):c.-18-5113C>A rs77576438
NM_000038.6(APC):c.-18-5277A>C rs80351719
NM_000038.6(APC):c.-18-5318G>C rs75448677
NM_000038.6(APC):c.-18-5320T>G rs77973517
NM_000038.6(APC):c.-18-5328C>A rs79440809
NM_000038.6(APC):c.-18-53G>C rs77090722
NM_000038.6(APC):c.-18-5649C>A rs78520528
NM_000038.6(APC):c.-18-56C>A rs79234413
NM_000038.6(APC):c.-18-6158A>G rs77761239
NM_000038.6(APC):c.-18-6234A>G rs79280419
NM_000038.6(APC):c.-18-62T>A rs76865148
NM_000038.6(APC):c.-18-7621C>A rs78383074
NM_000038.6(APC):c.-18-7625A>G rs2112210
NM_000038.6(APC):c.-18-7632A>G rs79345778
NM_000038.6(APC):c.-18-7698C>A rs75603862
NM_000038.6(APC):c.-18-7760G>C rs77931349
NM_000038.6(APC):c.-18-7763T>G rs74798743
NM_000038.6(APC):c.-18-7765C>A rs75728657
NM_000038.6(APC):c.-18-7C>G rs934014454
NM_000038.6(APC):c.-18-807C>A rs79955296
NM_000038.6(APC):c.-18-8204G>C rs76308165
NM_000038.6(APC):c.-18-8447A>T rs79175013
NM_000038.6(APC):c.-18-871T>C rs115198624
NM_000038.6(APC):c.-18-931T>C rs550427653
NM_000038.6(APC):c.-18-93T>C rs182529004
NM_000038.6(APC):c.-18-952T>C rs145308873
NM_000038.6(APC):c.-18-966G>T rs74698368
NM_000038.6(APC):c.-19+1100C>G rs1974786
NM_000038.6(APC):c.-19+1265T>C rs79187181
NM_000038.6(APC):c.-19+1328C>A rs74579629
NM_000038.6(APC):c.-19+1416G>T rs77310566
NM_000038.6(APC):c.-19+141T>C rs74393987
NM_000038.6(APC):c.-19+148G>C rs79577178
NM_000038.6(APC):c.-19+1592A>C rs191565835
NM_000038.6(APC):c.-19+1718A>G rs78907369
NM_000038.6(APC):c.-19+1721A>G rs76069662
NM_000038.6(APC):c.-19+1830G>A rs79827817
NM_000038.6(APC):c.-19+1838G>A rs78307381
NM_000038.6(APC):c.-19+1872G>T rs75812605
NM_000038.6(APC):c.-19+18C>T rs968269319
NM_000038.6(APC):c.-19+20T>C rs1025523700
NM_000038.6(APC):c.-19+2145A>G rs76965783
NM_000038.6(APC):c.-19+2325T>C rs74627407
NM_000038.6(APC):c.-19+2392A>G rs869312466
NM_000038.6(APC):c.-19+2566C>A rs75791687
NM_000038.6(APC):c.-19+2868T>G rs77714918
NM_000038.6(APC):c.-19+2871G>T rs76705974
NM_000038.6(APC):c.-19+2880G>T rs75496952
NM_000038.6(APC):c.-19+310G>C rs76537511
NM_000038.6(APC):c.-19+3825T>A rs4705608
NM_000038.6(APC):c.-19+3861T>C rs75455838
NM_000038.6(APC):c.-19+3869A>C rs74463383
NM_000038.6(APC):c.-19+3876G>C rs80011470
NM_000038.6(APC):c.-19+3969G>T rs78511549
NM_000038.6(APC):c.-19+3A>G rs1064793457
NM_000038.6(APC):c.-19+4059C>T rs7706623
NM_000038.6(APC):c.-19+4148A>G rs4705609
NM_000038.6(APC):c.-19+4298G>C rs4705610
NM_000038.6(APC):c.-19+42A>G rs80112297
NM_000038.6(APC):c.-19+45G>A
NM_000038.6(APC):c.-19+4670G>T rs79278712
NM_000038.6(APC):c.-19+4791C>A rs74427656
NM_000038.6(APC):c.-19+49A>G rs76241113
NM_000038.6(APC):c.-19+512G>A rs550306841
NM_000038.6(APC):c.-19+53T>C
NM_000038.6(APC):c.-19+53T>G rs80313086
NM_000038.6(APC):c.-19+5495A>C rs77465371
NM_000038.6(APC):c.-19+5496T>A rs75951266
NM_000038.6(APC):c.-19+5503T>A rs80063288
NM_000038.6(APC):c.-19+5505A>G rs74943313
NM_000038.6(APC):c.-19+559T>G rs77120173
NM_000038.6(APC):c.-19+561T>G rs75110764
NM_000038.6(APC):c.-19+563G>T rs78811626
NM_000038.6(APC):c.-19+6005C>T rs75813016
NM_000038.6(APC):c.-19+6007G>T rs77813423
NM_000038.6(APC):c.-19+6054C>A rs78719754
NM_000038.6(APC):c.-19+6260T>G rs10071425
NM_000038.6(APC):c.-19+647A>G rs2019720
NM_000038.6(APC):c.-19+6497A>G rs181436331
NM_000038.6(APC):c.-19+679T>A rs79491077
NM_000038.6(APC):c.-19+6803G>A rs76198215
NM_000038.6(APC):c.-19+6805G>A rs76565133
NM_000038.6(APC):c.-19+6806A>T rs76978459
NM_000038.6(APC):c.-19+6807G>A rs75261426
NM_000038.6(APC):c.-19+694G>T rs79522969
NM_000038.6(APC):c.-19+695C>T rs76620114
NM_000038.6(APC):c.-19+7106G>A rs464002
NM_000038.6(APC):c.-19+7205G>A rs79655915
NM_000038.6(APC):c.-19+7206G>T rs77054573
NM_000038.6(APC):c.-19+7207T>A rs80258949
NM_000038.6(APC):c.-19+734C>T rs2020383
NM_000038.6(APC):c.-19+7711T>C rs75384810
NM_000038.6(APC):c.-19+7757C>A rs79334785
NM_000038.6(APC):c.-19+7791T>G rs79482241
NM_000038.6(APC):c.-19+7793C>G rs78123091
NM_000038.6(APC):c.-19+7795A>C rs76173496
NM_000038.6(APC):c.-19+797C>A rs78386365
NM_000038.6(APC):c.-19+8064G>T rs80193344
NM_000038.6(APC):c.-19+8065G>T rs77399711
NM_000038.6(APC):c.-19+8302A>G rs6594646
NM_000038.6(APC):c.-19+8413C>A rs75031223
NM_000038.6(APC):c.-19+8468T>G rs75068913
NM_000038.6(APC):c.-19+8469A>C rs76147666
NM_000038.6(APC):c.-19+8470A>C rs74581427
NM_000038.6(APC):c.-19+888G>T rs76376330
NM_000038.6(APC):c.-19+894G>T rs75329700
NM_000038.6(APC):c.-19+904G>T rs79375613
NM_000038.6(APC):c.-19+913G>T rs77802252
NM_000038.6(APC):c.-19+968C>T rs149097203
NM_000038.6(APC):c.-19+985A>G rs111717700
NM_000038.6(APC):c.-19G>A rs1064793813
NM_000038.6(APC):c.-19G>C rs1064793813
NM_000038.6(APC):c.-30100G>A
NM_000038.6(APC):c.-30114C>T
NM_000038.6(APC):c.-30120A>G
NM_000038.6(APC):c.-30142G>T
NM_000038.6(APC):c.-30144G>A rs1057517606
NM_000038.6(APC):c.-30150G>T
NM_000038.6(APC):c.-30156C>G
NM_000038.6(APC):c.-30171C>T
NM_000038.6(APC):c.-30174C>T
NM_000038.6(APC):c.-30188G>T
NM_000038.6(APC):c.-30193C>T
NM_000038.6(APC):c.-30200G>C
NM_000038.6(APC):c.-30248T>G
NM_000038.6(APC):c.-30254G>A
NM_000038.6(APC):c.-30283G>A
NM_000038.6(APC):c.-30286G>A
NM_000038.6(APC):c.-30291_-30290del
NM_000038.6(APC):c.-30294G>C
NM_000038.6(APC):c.-30296A>C
NM_000038.6(APC):c.-30309C>G
NM_000038.6(APC):c.-30309del
NM_000038.6(APC):c.-30317G>C
NM_000038.6(APC):c.-30331G>C
NM_000038.6(APC):c.-30334C>A
NM_000038.6(APC):c.-30335C>A
NM_000038.6(APC):c.-30340C>G
NM_000038.6(APC):c.-30341T>C
NM_000038.6(APC):c.-30343_-30323del
NM_000038.6(APC):c.-30345G>C
NM_000038.6(APC):c.-30352del
NM_000038.6(APC):c.-30353G>T
NM_000038.6(APC):c.-30359_-30358delinsGC
NM_000038.6(APC):c.-30360_-30359insGGG
NM_000038.6(APC):c.-30368G>C
NM_000038.6(APC):c.-30371C>T
NM_000038.6(APC):c.-30373G>A
NM_000038.6(APC):c.-30374A>C
NM_000038.6(APC):c.-30376G>C
NM_000038.6(APC):c.-30379C>T
NM_000038.6(APC):c.-30391G>A
NM_000038.6(APC):c.-30397G>A
NM_000038.6(APC):c.-30398A>T
NM_000038.6(APC):c.-30400C>A
NM_000038.6(APC):c.-30409G>A
NM_000038.6(APC):c.-30418_-30417delinsTAGCAAGGG
NM_000038.6(APC):c.-30427T>C
NM_000038.6(APC):c.-30439A>T
NM_000038.6(APC):c.-30440T>C
NM_000038.6(APC):c.-30446G>A
NM_000038.6(APC):c.-30450A>G
NM_000038.6(APC):c.-30481G>T
NM_000038.6(APC):c.-30482G>A
NM_000038.6(APC):c.-30489A>C
NM_000038.6(APC):c.-30495G>A
NM_000038.6(APC):c.-30496A>G
NM_000038.6(APC):c.-30504C>A
NM_000038.6(APC):c.-30507_-30493del
NM_000038.6(APC):c.-30511G>A
NM_000038.6(APC):c.-30513T>A
NM_000038.6(APC):c.-30513T>C
NM_000038.6(APC):c.-30517C>T
NM_000038.6(APC):c.-30524C>G
NM_000038.6(APC):c.-30527G>C
NM_000038.6(APC):c.-30529C>T
NM_000038.6(APC):c.-30531A>G
NM_000038.6(APC):c.-30532A>G
NM_000038.6(APC):c.-30541G>A
NM_000038.6(APC):c.-30545A>G
NM_000038.6(APC):c.-30566G>C
NM_000038.6(APC):c.-30575G>A
NM_000038.6(APC):c.-30581G>A
NM_000038.6(APC):c.-30585G>C
NM_000038.6(APC):c.-30587T>A
NM_000038.6(APC):c.-30591dup
NM_000038.6(APC):c.-30596A>G
NM_000038.6(APC):c.-30598G>A
NM_000038.6(APC):c.-30601G>C
NM_000038.6(APC):c.-30602T>C
NM_000038.6(APC):c.-30606dup
NM_000038.6(APC):c.-30608dup
NM_000038.6(APC):c.-30611G>A
NM_000038.6(APC):c.-30612G>A
NM_000038.6(APC):c.-30612G>C
NM_000038.6(APC):c.-30630G>A
NM_000038.6(APC):c.-30C>G rs990850257
NM_000038.6(APC):c.-43A>C rs879254014
NM_000038.6(APC):c.1002G>C (p.Leu334Phe) rs928733098
NM_000038.6(APC):c.1005A>C (p.Leu335=) rs3797704
NM_000038.6(APC):c.1005A>G (p.Leu335=) rs3797704
NM_000038.6(APC):c.1009A>G (p.Met337Val) rs1438780449
NM_000038.6(APC):c.1015A>G (p.Ser339Gly) rs1060503301
NM_000038.6(APC):c.1016G>A (p.Ser339Asn) rs1554079972
NM_000038.6(APC):c.1019C>A (p.Ser340Tyr)
NM_000038.6(APC):c.1021C>A (p.Gln341Lys) rs77058194
NM_000038.6(APC):c.1023A>G (p.Gln341=) rs774764623
NM_000038.6(APC):c.1026C>A (p.Asp342Glu)
NM_000038.6(APC):c.1026C>T (p.Asp342=) rs1168959523
NM_000038.6(APC):c.1029C>T (p.Ser343=) rs762233995
NM_000038.6(APC):c.1030T>A (p.Cys344Ser) rs1561540861
NM_000038.6(APC):c.1031G>C (p.Cys344Ser) rs786201840
NM_000038.6(APC):c.1035A>T (p.Ile345=) rs1057521594
NM_000038.6(APC):c.1039A>G (p.Met347Val) rs902593216
NM_000038.6(APC):c.1043G>A (p.Arg348Gln) rs1402950946
NM_000038.6(APC):c.1045C>T (p.Gln349Ter) rs863225307
NM_000038.6(APC):c.1046A>G (p.Gln349Arg) rs1554079986
NM_000038.6(APC):c.1048_1141del (p.Ser350fs) rs1554079988
NM_000038.6(APC):c.104C>A (p.Thr35Lys)
NM_000038.6(APC):c.104del (p.Thr35fs) rs1114167593
NM_000038.6(APC):c.1050T>G (p.Ser350=) rs760345157
NM_000038.6(APC):c.1057C>A (p.Leu353Ile)
NM_000038.6(APC):c.1059_1060insAAGGATGATAT (p.Pro354fs) rs1554079996
NM_000038.6(APC):c.1059dup (p.Pro354fs)
NM_000038.6(APC):c.1060C>A (p.Pro354Thr)
NM_000038.6(APC):c.1061C>A (p.Pro354His) rs1060503337
NM_000038.6(APC):c.1061C>T (p.Pro354Leu) rs1060503337
NM_000038.6(APC):c.1069dup (p.Ile357fs) rs387906232
NM_000038.6(APC):c.1071C>T (p.Ile357=) rs1114167600
NM_000038.6(APC):c.1072C>T (p.Gln358Ter) rs863224455
NM_000038.6(APC):c.1073A>G (p.Gln358Arg) rs1064793508
NM_000038.6(APC):c.1082A>G (p.His361Arg) rs1554080006
NM_000038.6(APC):c.1089T>C (p.Asn363=) rs754925114
NM_000038.6(APC):c.108del (p.Lys36fs) rs1554067141
NM_000038.6(APC):c.1092C>G (p.Asp364Glu) rs1199369536
NM_000038.6(APC):c.1094A>G (p.Lys365Arg)
NM_000038.6(APC):c.1096G>A (p.Asp366Asn) rs199562537
NM_000038.6(APC):c.1096G>C (p.Asp366His) rs199562537
NM_000038.6(APC):c.1097A>C (p.Asp366Ala) rs1554080010
NM_000038.6(APC):c.1098_1099CT[1] (p.Ser367fs) rs387906237
NM_000038.6(APC):c.10G>C (p.Ala4Pro) rs774219012
NM_000038.6(APC):c.10G>T (p.Ala4Ser) rs774219012
NM_000038.6(APC):c.1100C>G (p.Ser367Cys) rs1554080012
NM_000038.6(APC):c.1101del (p.Val368fs) rs587782744
NM_000038.6(APC):c.1102G>T (p.Val368Leu) rs914534364
NM_000038.6(APC):c.1102_1103del (p.Val368fs) rs1554080016
NM_000038.6(APC):c.1110G>A (p.Leu370=) rs1439967202
NM_000038.6(APC):c.1111G>C (p.Gly371Arg) rs863224535
NM_000038.6(APC):c.1111G>T (p.Gly371Ter)
NM_000038.6(APC):c.1112G>A (p.Gly371Glu) rs377351581
NM_000038.6(APC):c.1114A>G (p.Asn372Asp) rs201478136
NM_000038.6(APC):c.1118C>T (p.Ser373Phe)
NM_000038.6(APC):c.111G>A (p.Leu37=) rs1554067149
NM_000038.6(APC):c.1120C>T (p.Arg374Trp) rs947634162
NM_000038.6(APC):c.1121G>A (p.Arg374Gln) rs141582813
NM_000038.6(APC):c.1122G>A (p.Arg374=) rs780123034
NM_000038.6(APC):c.1124G>A (p.Gly375Asp) rs1554080027
NM_000038.6(APC):c.1124del (p.Gly375fs) rs876658538
NM_000038.6(APC):c.1136C>G (p.Ala379Gly) rs1060503308
NM_000038.6(APC):c.1139G>A (p.Arg380Gln) rs587782886
NM_000038.6(APC):c.1139G>C (p.Arg380Pro) rs587782886
NM_000038.6(APC):c.1141del (p.Ala381fs) rs1554080036
NM_000038.6(APC):c.1142C>T (p.Ala381Val) rs1064795692
NM_000038.6(APC):c.1154C>T (p.Ala385Val) rs730881232
NM_000038.6(APC):c.1155A>C (p.Ala385=) rs1554080041
NM_000038.6(APC):c.1158A>G (p.Ala386=) rs370669642
NM_000038.6(APC):c.115A>G (p.Thr39Ala)
NM_000038.6(APC):c.1163_1165ACA[1] (p.Asn389del) rs876658225
NM_000038.6(APC):c.1168A>G (p.Ile390Val) rs1060503345
NM_000038.6(APC):c.116C>G (p.Thr39Ser) rs1561445008
NM_000038.6(APC):c.1171A>G (p.Ile391Val) rs587781586
NM_000038.6(APC):c.1175A>G (p.His392Arg) rs876658392
NM_000038.6(APC):c.1177T>C (p.Ser393Pro) rs1060503352
NM_000038.6(APC):c.1177dup (p.Ser393fs)
NM_000038.6(APC):c.1178C>G (p.Ser393Ter) rs1114167545
NM_000038.6(APC):c.1179A>G (p.Ser393=) rs876659399
NM_000038.6(APC):c.117T>C (p.Thr39=) rs751827696
NM_000038.6(APC):c.1186G>A (p.Asp396Asn)
NM_000038.6(APC):c.1188T>C (p.Asp396=) rs1554080056
NM_000038.6(APC):c.1192A>C (p.Lys398Gln) rs765196085
NM_000038.6(APC):c.1192_1193del (p.Lys398fs) rs387906238
NM_000038.6(APC):c.1193A>G (p.Lys398Arg) rs145912662
NM_000038.6(APC):c.1197A>G (p.Arg399=) rs786202331
NM_000038.6(APC):c.1198G>A (p.Gly400Ser) rs1561541770
NM_000038.6(APC):c.1203G>A (p.Arg401=) rs587780589
NM_000038.6(APC):c.1203G>T (p.Arg401Ser) rs587780589
NM_000038.6(APC):c.1204C>T (p.Arg402Cys) rs876660612
NM_000038.6(APC):c.1205G>A (p.Arg402His) rs878853416
NM_000038.6(APC):c.120G>A (p.Glu40=) rs142720069
NM_000038.6(APC):c.1210del (p.Ile404fs) rs1064794225
NM_000038.6(APC):c.1213C>T (p.Arg405Ter) rs587779780
NM_000038.6(APC):c.1213del (p.Arg405fs) rs1554080070
NM_000038.6(APC):c.1214G>A (p.Arg405Gln) rs587782383
NM_000038.6(APC):c.1218C>T (p.Val406=) rs1554080074
NM_000038.6(APC):c.1219C>G (p.Leu407Val) rs1554080075
NM_000038.6(APC):c.1219del (p.Leu407fs) rs1114167558
NM_000038.6(APC):c.121G>A (p.Ala41Thr) rs1554067157
NM_000038.6(APC):c.121G>T (p.Ala41Ser)
NM_000038.6(APC):c.1223A>T (p.His408Leu) rs890378836
NM_000038.6(APC):c.1225C>A (p.Leu409Ile)
NM_000038.6(APC):c.1229dup (p.Leu410fs) rs863225308
NM_000038.6(APC):c.1234C>G (p.Gln412Glu) rs876660802
NM_000038.6(APC):c.1234C>T (p.Gln412Ter) rs876660802
NM_000038.6(APC):c.1239dup (p.Arg414fs) rs879254088
NM_000038.6(APC):c.123A>G (p.Ala41=) rs1561445056
NM_000038.6(APC):c.1240C>A (p.Arg414Ser) rs137854567
NM_000038.6(APC):c.1240C>G (p.Arg414Gly)
NM_000038.6(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.6(APC):c.1240del (p.Arg414fs) rs1554080082
NM_000038.6(APC):c.1241G>A (p.Arg414His) rs730881233
NM_000038.6(APC):c.1241_1246delinsA (p.Arg414fs)
NM_000038.6(APC):c.1242C>T (p.Arg414=) rs751423790
NM_000038.6(APC):c.1243G>A (p.Ala415Thr) rs756336949
NM_000038.6(APC):c.1245T>G (p.Ala415=) rs1561542004
NM_000038.6(APC):c.1246_1249del (p.Tyr416fs) rs1554080089
NM_000038.6(APC):c.1246dup (p.Tyr416fs) rs1060503366
NM_000038.6(APC):c.1249T>C (p.Cys417Arg) rs1443626644
NM_000038.6(APC):c.1250G>C (p.Cys417Ser) rs780178612
NM_000038.6(APC):c.1251T>A (p.Cys417Ter) rs1114167607
NM_000038.6(APC):c.1259G>T (p.Cys420Phe) rs1367937646
NM_000038.6(APC):c.1262G>A (p.Trp421Ter) rs559510809
NM_000038.6(APC):c.1263G>A (p.Trp421Ter) rs1554080106
NM_000038.6(APC):c.1264G>A (p.Glu422Lys) rs755069015
NM_000038.6(APC):c.1270C>T (p.Gln424Ter) rs1561542165
NM_000038.6(APC):c.1272G>A (p.Gln424=) rs778975532
NM_000038.6(APC):c.1272G>C (p.Gln424His) rs778975532
NM_000038.6(APC):c.1274A>G (p.Glu425Gly) rs77907679
NM_000038.6(APC):c.1276G>T (p.Ala426Ser) rs200598389
NM_000038.6(APC):c.1279C>A (p.His427Asn) rs587779781
NM_000038.6(APC):c.1281T>A (p.His427Gln)
NM_000038.6(APC):c.1282G>A (p.Glu428Lys) rs1302087242
NM_000038.6(APC):c.1283A>G (p.Glu428Gly) rs750487805
NM_000038.6(APC):c.1286C>T (p.Pro429Leu) rs1003390887
NM_000038.6(APC):c.1289G>A (p.Gly430Asp) rs1060503317
NM_000038.6(APC):c.1290C>T (p.Gly430=) rs730881234
NM_000038.6(APC):c.1291A>G (p.Met431Val) rs730881235
NM_000038.6(APC):c.1292T>C (p.Met431Thr)
NM_000038.6(APC):c.1292T>G (p.Met431Arg)
NM_000038.6(APC):c.1293G>A (p.Met431Ile) rs786201795
NM_000038.6(APC):c.1295A>G (p.Asp432Gly) rs786202283
NM_000038.6(APC):c.1295A>T (p.Asp432Val) rs786202283
NM_000038.6(APC):c.1297C>T (p.Gln433Ter) rs863225309
NM_000038.6(APC):c.1298A>G (p.Gln433Arg) rs1064793424
NM_000038.6(APC):c.1298A>T (p.Gln433Leu) rs1064793424
NM_000038.6(APC):c.1300G>A (p.Asp434Asn) rs769365014
NM_000038.6(APC):c.1306A>T (p.Asn436Tyr)
NM_000038.6(APC):c.1307A>T (p.Asn436Ile) rs876658856
NM_000038.6(APC):c.1307del (p.Asn436fs) rs1554080162
NM_000038.6(APC):c.1309C>G (p.Pro437Ala) rs1554080176
NM_000038.6(APC):c.1310C>G (p.Pro437Arg) rs762936223
NM_000038.6(APC):c.1311_1312+1del rs397514030
NM_000038.6(APC):c.1312+1039T>G rs75710383
NM_000038.6(APC):c.1312+1041C>T rs76855953
NM_000038.6(APC):c.1312+1042A>C rs75014659
NM_000038.6(APC):c.1312+1044G>T rs75114082
NM_000038.6(APC):c.1312+1056A>C rs76044691
NM_000038.6(APC):c.1312+1058C>G rs79851383
NM_000038.6(APC):c.1312+1059A>C rs75435442
NM_000038.6(APC):c.1312+1239T>G rs146819357
NM_000038.6(APC):c.1312+12A>G rs372970635
NM_000038.6(APC):c.1312+163C>G rs151219923
NM_000038.6(APC):c.1312+16T>A rs376965806
NM_000038.6(APC):c.1312+1G>A rs863225310
NM_000038.6(APC):c.1312+27G>A rs74975092
NM_000038.6(APC):c.1312+2T>C rs1114167579
NM_000038.6(APC):c.1312+352C>T rs79764746
NM_000038.6(APC):c.1312+369C>A rs74736032
NM_000038.6(APC):c.1312+3A>C rs863225311
NM_000038.6(APC):c.1312+3A>G rs863225311
NM_000038.6(APC):c.1312+463C>G rs2545163
NM_000038.6(APC):c.1312+46T>C rs747389686
NM_000038.6(APC):c.1312+5G>A rs886039507
NM_000038.6(APC):c.1312+5G>C rs886039507
NM_000038.6(APC):c.1312+752G>C rs501250
NM_000038.6(APC):c.1312+778G>A rs548408102
NM_000038.6(APC):c.1313-10T>C rs373744889
NM_000038.6(APC):c.1313-18G>A rs775118833
NM_000038.6(APC):c.1313-2A>G rs1561545780
NM_000038.6(APC):c.1313-476T>G rs74842328
NM_000038.6(APC):c.1313-730G>C rs6885768
NM_000038.6(APC):c.1313-892C>A rs76420505
NM_000038.6(APC):c.1313-8T>A rs1060504892
NM_000038.6(APC):c.1313-9A>G rs368494354
NM_000038.6(APC):c.1313T>C (p.Met438Thr) rs774212108
NM_000038.6(APC):c.1317A>G (p.Pro439=) rs761821491
NM_000038.6(APC):c.1318G>A (p.Ala440Thr) rs1064793023
NM_000038.6(APC):c.1318G>C (p.Ala440Pro) rs1064793023
NM_000038.6(APC):c.1319C>G (p.Ala440Gly) rs1561545834
NM_000038.6(APC):c.1321C>A (p.Pro441Thr) rs1444245614
NM_000038.6(APC):c.1323del (p.Val442fs)
NM_000038.6(APC):c.1329_1331del (p.Glu443_His444delinsAsp) rs1554080672
NM_000038.6(APC):c.132dup (p.Lys45fs) rs1561445097
NM_000038.6(APC):c.1331A>G (p.His444Arg) rs371065509
NM_000038.6(APC):c.1332T>A (p.His444Gln) rs773087899
NM_000038.6(APC):c.1332T>G (p.His444Gln) rs773087899
NM_000038.6(APC):c.1333C>G (p.Gln445Glu) rs876658802
NM_000038.6(APC):c.1333C>T (p.Gln445Ter) rs876658802
NM_000038.6(APC):c.1334A>G (p.Gln445Arg) rs876659157
NM_000038.6(APC):c.1336del (p.Ile446fs) rs1554080688
NM_000038.6(APC):c.1341T>A (p.Cys447Ter) rs1561545947
NM_000038.6(APC):c.1342C>G (p.Pro448Ala) rs374195067
NM_000038.6(APC):c.1343C>G (p.Pro448Arg) rs1561545979
NM_000038.6(APC):c.1343dup (p.Ala449fs) rs1554080695
NM_000038.6(APC):c.1344T>A (p.Pro448=) rs752774532
NM_000038.6(APC):c.1346C>T (p.Ala449Val) rs1554080697
NM_000038.6(APC):c.1348G>T (p.Val450Leu) rs1561546045
NM_000038.6(APC):c.1348_1349GT[3] (p.Val452fs) rs1554080698
NM_000038.6(APC):c.1348_1349GT[5] (p.Leu453fs) rs1554080698
NM_000038.6(APC):c.135+1150C>G rs115110409
NM_000038.6(APC):c.135+12G>T rs1057524184
NM_000038.6(APC):c.135+1680T>G rs4705486
NM_000038.6(APC):c.135+17T>G rs1057522199
NM_000038.6(APC):c.135+1G>T rs750508765
NM_000038.6(APC):c.135+2275G>T rs79425114
NM_000038.6(APC):c.135+2703G>C rs76641316
NM_000038.6(APC):c.135+2T>C rs1554067164
NM_000038.6(APC):c.135+3233A>G rs369952
NM_000038.6(APC):c.135+3577G>C rs76976179
NM_000038.6(APC):c.135+3578C>A rs76013957
NM_000038.6(APC):c.135+3580T>G rs74394833
NM_000038.6(APC):c.135+3581G>C rs79193737
NM_000038.6(APC):c.135+3582A>C rs77757035
NM_000038.6(APC):c.135+3583G>C rs75330662
NM_000038.6(APC):c.135+3586A>C rs76167643
NM_000038.6(APC):c.135+3678T>G rs80009531
NM_000038.6(APC):c.135+3679G>C rs75260747
NM_000038.6(APC):c.135+3682G>A rs10073398
NM_000038.6(APC):c.135+3685T>C rs76963617
NM_000038.6(APC):c.135+3728A>C rs75088576
NM_000038.6(APC):c.135+3821A>C rs74578553
NM_000038.6(APC):c.135+4410G>T rs75876029
NM_000038.6(APC):c.135+4609C>G rs76716334
NM_000038.6(APC):c.135+4610G>A rs2546116
NM_000038.6(APC):c.135+4611T>G rs77819922
NM_000038.6(APC):c.135+4614G>C rs76578536
NM_000038.6(APC):c.135+4777T>A rs79703980
NM_000038.6(APC):c.135+4782G>C rs77280974
NM_000038.6(APC):c.135+4T>C rs1561445118
NM_000038.6(APC):c.135+5053T>A rs4705624
NM_000038.6(APC):c.135+610G>T rs80132568
NM_000038.6(APC):c.135+6A>G
NM_000038.6(APC):c.135+859A>G rs74438587
NM_000038.6(APC):c.135+862A>G rs75194627
NM_000038.6(APC):c.135+8G>C rs1554067166
NM_000038.6(APC):c.135+982C>G rs4099181
NM_000038.6(APC):c.1350G>A (p.Val450=) rs1554080701
NM_000038.6(APC):c.1357C>G (p.Leu453Val) rs1561546092
NM_000038.6(APC):c.1358del (p.Leu453fs) rs1554080702
NM_000038.6(APC):c.1359A>G (p.Leu453=) rs751945983
NM_000038.6(APC):c.136-1001G>T rs79792854
NM_000038.6(APC):c.136-1041T>G rs75950054
NM_000038.6(APC):c.136-1084C>A rs74389055
NM_000038.6(APC):c.136-12T>C rs1554069478
NM_000038.6(APC):c.136-1428A>C rs2464807
NM_000038.6(APC):c.136-1527G>A rs76596358
NM_000038.6(APC):c.136-15T>A rs730881271
NM_000038.6(APC):c.136-1728A>G rs75064858
NM_000038.6(APC):c.136-1763C>T rs75487989
NM_000038.6(APC):c.136-18T>C rs1261769588
NM_000038.6(APC):c.136-1965A>G rs78371714
NM_000038.6(APC):c.136-1966T>A rs77626584
NM_000038.6(APC):c.136-1996G>A rs6867243
NM_000038.6(APC):c.136-19A>G rs778690797
NM_000038.6(APC):c.136-1G>A rs1554069481
NM_000038.6(APC):c.136-2078A>C rs76315937
NM_000038.6(APC):c.136-20T>C rs1219730982
NM_000038.6(APC):c.136-217C>A rs75348204
NM_000038.6(APC):c.136-219C>A rs77470563
NM_000038.6(APC):c.136-220G>C rs78535297
NM_000038.6(APC):c.136-2228T>A rs77179372
NM_000038.6(APC):c.136-2230A>T rs79492842
NM_000038.6(APC):c.136-2231A>T rs74625414
NM_000038.6(APC):c.136-230C>A rs2464805
NM_000038.6(APC):c.136-2311A>G rs80044522
NM_000038.6(APC):c.136-2333T>C rs7723423
NM_000038.6(APC):c.136-2352A>C rs77616734
NM_000038.6(APC):c.136-2355C>G rs75075213
NM_000038.6(APC):c.136-2358T>G rs79485695
NM_000038.6(APC):c.136-2527G>A rs7703438
NM_000038.6(APC):c.136-277T>G rs78728577
NM_000038.6(APC):c.136-2827G>C rs79068683
NM_000038.6(APC):c.136-2828T>A rs79248399
NM_000038.6(APC):c.136-2830T>A rs76113999
NM_000038.6(APC):c.136-2831A>T rs78307272
NM_000038.6(APC):c.136-284A>G rs77335832
NM_000038.6(APC):c.136-287A>G rs79035771
NM_000038.6(APC):c.136-2953C>T rs78830334
NM_000038.6(APC):c.136-2954T>C rs76994479
NM_000038.6(APC):c.136-2963T>G rs78880731
NM_000038.6(APC):c.136-2965G>A rs79620312
NM_000038.6(APC):c.136-2995A>G rs9647583
NM_000038.6(APC):c.136-2A>G rs886039625
NM_000038.6(APC):c.136-3072A>G rs76869117
NM_000038.6(APC):c.136-3085T>A rs9647582
NM_000038.6(APC):c.136-3112G>A rs380589
NM_000038.6(APC):c.136-3456A>T rs74473355
NM_000038.6(APC):c.136-3506G>T rs76529795
NM_000038.6(APC):c.136-350A>G rs78418904
NM_000038.6(APC):c.136-358C>A rs79439776
NM_000038.6(APC):c.136-383G>T rs78519130
NM_000038.6(APC):c.136-3C>T rs1060503361
NM_000038.6(APC):c.136-4266A>G rs11241184
NM_000038.6(APC):c.136-4681G>T rs75740764
NM_000038.6(APC):c.136-4684C>T rs80317562
NM_000038.6(APC):c.136-4789G>A rs28578275
NM_000038.6(APC):c.136-5227A>C rs77047220
NM_000038.6(APC):c.136-5233G>C rs78705673
NM_000038.6(APC):c.136-5236T>G rs79527859
NM_000038.6(APC):c.136-5245T>G rs79277510
NM_000038.6(APC):c.136-527G>A rs2464806
NM_000038.6(APC):c.136-53T>C rs2304793
NM_000038.6(APC):c.136-5499C>T rs78363681
NM_000038.6(APC):c.136-5500T>C rs77636537
NM_000038.6(APC):c.136-5501T>C rs78604264
NM_000038.6(APC):c.136-566G>T rs12659119
NM_000038.6(APC):c.136-625A>C rs76452131
NM_000038.6(APC):c.136-646A>T rs869312471
NM_000038.6(APC):c.136-808G>T rs79249699
NM_000038.6(APC):c.1365A>G (p.Lys455=) rs1554080704
NM_000038.6(APC):c.1366C>G (p.Leu456Val) rs876660195
NM_000038.6(APC):c.1366C>T (p.Leu456Phe) rs876660195
NM_000038.6(APC):c.1367T>C (p.Leu456Pro) rs1554080708
NM_000038.6(APC):c.1369T>G (p.Ser457Ala) rs1554080710
NM_000038.6(APC):c.1369del (p.Ser457fs) rs387906229
NM_000038.6(APC):c.1370C>A (p.Ser457Ter) rs1060503333
NM_000038.6(APC):c.1370C>G (p.Ser457Ter) rs1060503333
NM_000038.6(APC):c.1376A>G (p.Asp459Gly) rs1554080714
NM_000038.6(APC):c.1377_1383del (p.Glu460fs) rs1554080716
NM_000038.6(APC):c.1378G>A (p.Glu460Lys) rs786203718
NM_000038.6(APC):c.137A>G (p.Glu46Gly) rs879254287
NM_000038.6(APC):c.1383G>A (p.Glu461=) rs1561546239
NM_000038.6(APC):c.1385A>G (p.His462Arg) rs1561546254
NM_000038.6(APC):c.1386T>C (p.His462=) rs1561546280
NM_000038.6(APC):c.1389A>T (p.Arg463Ser)
NM_000038.6(APC):c.138A>C (p.Glu46Asp)
NM_000038.6(APC):c.1391A>G (p.His464Arg) rs730881236
NM_000038.6(APC):c.1392T>A (p.His464Gln) rs1057524073
NM_000038.6(APC):c.1392T>C (p.His464=) rs1057524073
NM_000038.6(APC):c.1393G>T (p.Ala465Ser) rs863224536
NM_000038.6(APC):c.1394C>G (p.Ala465Gly) rs757814834
NM_000038.6(APC):c.1396A>G (p.Met466Val) rs781364007
NM_000038.6(APC):c.1396A>T (p.Met466Leu)
NM_000038.6(APC):c.1398G>A (p.Met466Ile) rs878853417
NM_000038.6(APC):c.139G>A (p.Val47Ile) rs969611536
NM_000038.6(APC):c.1402G>A (p.Glu468Lys) rs1060503340
NM_000038.6(APC):c.1402G>T (p.Glu468Ter) rs1060503340
NM_000038.6(APC):c.1405C>G (p.Leu469Val) rs746293695
NM_000038.6(APC):c.1405C>T (p.Leu469=) rs746293695
NM_000038.6(APC):c.1408+1262T>A rs182458072
NM_000038.6(APC):c.1408+1672A>G rs79083929
NM_000038.6(APC):c.1408+1697A>G rs2545160
NM_000038.6(APC):c.1408+1782A>G rs2546107
NM_000038.6(APC):c.1408+1857A>C rs75491644
NM_000038.6(APC):c.1408+1874A>G rs2545159
NM_000038.6(APC):c.1408+2167A>T rs76823257
NM_000038.6(APC):c.1408+27A>G rs863225312
NM_000038.6(APC):c.1408+295C>A rs76628974
NM_000038.6(APC):c.1408+3A>G rs534358523
NM_000038.6(APC):c.1408+524C>A rs79204769
NM_000038.6(APC):c.1408+5G>A rs779919032
NM_000038.6(APC):c.1408+743G>A rs2545162
NM_000038.6(APC):c.1408+792A>T rs77551834
NM_000038.6(APC):c.1408+806T>C rs78475274
NM_000038.6(APC):c.1408+890C>A rs79239291
NM_000038.6(APC):c.1408+8A>G rs1057523135
NM_000038.6(APC):c.1409-1336C>A rs2546108
NM_000038.6(APC):c.1409-13C>G rs1554081628
NM_000038.6(APC):c.1409-143G>T rs77980903
NM_000038.6(APC):c.1409-1508C>A rs78153805
NM_000038.6(APC):c.1409-17T>G rs764042245
NM_000038.6(APC):c.1409-1847T>A rs76295624
NM_000038.6(APC):c.1409-1848G>A rs78265064
NM_000038.6(APC):c.1409-1860C>A rs76424346
NM_000038.6(APC):c.1409-1869T>C rs79032423
NM_000038.6(APC):c.1409-19C>G rs763168564
NM_000038.6(APC):c.1409-1G>A rs863225313
NM_000038.6(APC):c.1409-1G>T rs863225313
NM_000038.6(APC):c.1409-20T>C rs775635324
NM_000038.6(APC):c.1409-2234C>T rs76616867
NM_000038.6(APC):c.1409-2342G>C rs77948403
NM_000038.6(APC):c.1409-2343A>T rs75821202
NM_000038.6(APC):c.1409-2354A>C rs869312474
NM_000038.6(APC):c.1409-2358T>A rs74796938
NM_000038.6(APC):c.1409-2360A>T rs76989207
NM_000038.6(APC):c.1409-2531T>A rs78985134
NM_000038.6(APC):c.1409-2A>C rs1064794163
NM_000038.6(APC):c.1409-2A>G rs1064794163
NM_000038.6(APC):c.1409-2A>T rs1064794163
NM_000038.6(APC):c.1409-2_1409del rs1554081631
NM_000038.6(APC):c.1409-320T>G rs536225490
NM_000038.6(APC):c.1409-392A>G rs2546110
NM_000038.6(APC):c.1409-3T>G rs1554081629
NM_000038.6(APC):c.1409-422A>T rs77627307
NM_000038.6(APC):c.1409-434C>A rs78974378
NM_000038.6(APC):c.1409-506C>A rs2546109
NM_000038.6(APC):c.1409-5A>G rs768109346
NM_000038.6(APC):c.1409-6A>G rs886039508
NM_000038.6(APC):c.1409-931G>T rs78861802
NM_000038.6(APC):c.1409-934C>G rs79511526
NM_000038.6(APC):c.1409-934C>T rs79511526
NM_000038.6(APC):c.1409-935T>G rs79411535
NM_000038.6(APC):c.1409G>A (p.Gly470Glu) rs1561553355
NM_000038.6(APC):c.1411G>A (p.Gly471Arg) rs1554081633
NM_000038.6(APC):c.1412G>T (p.Gly471Val) rs1191271600
NM_000038.6(APC):c.1415dup (p.Gln473fs) rs1561553403
NM_000038.6(APC):c.1416A>G (p.Leu472=) rs1554081635
NM_000038.6(APC):c.1417C>T (p.Gln473Ter) rs876658868
NM_000038.6(APC):c.1418A>G (p.Gln473Arg)
NM_000038.6(APC):c.1419G>A (p.Gln473=) rs141579422
NM_000038.6(APC):c.1420G>T (p.Ala474Ser)
NM_000038.6(APC):c.1424T>C (p.Ile475Thr) rs1554081639
NM_000038.6(APC):c.1426G>A (p.Ala476Thr) rs786203723
NM_000038.6(APC):c.1427C>T (p.Ala476Val)
NM_000038.6(APC):c.1431del (p.Glu477fs) rs1554081640
NM_000038.6(APC):c.1431dup (p.Leu478fs) rs1554081640
NM_000038.6(APC):c.1433T>G (p.Leu478Ter) rs863225314
NM_000038.6(APC):c.1433del (p.Leu478fs) rs1240024893
NM_000038.6(APC):c.1434A>C (p.Leu478Phe) rs1561553567
NM_000038.6(APC):c.1435T>A (p.Leu479Met) rs780577693
NM_000038.6(APC):c.1435T>C (p.Leu479=) rs780577693
NM_000038.6(APC):c.1437G>A (p.Leu479=) rs1114167598
NM_000038.6(APC):c.1438C>A (p.Gln480Lys) rs570514864
NM_000038.6(APC):c.1440A>C (p.Gln480His) rs863224537
NM_000038.6(APC):c.1440A>T (p.Gln480His) rs863224537
NM_000038.6(APC):c.1441G>A (p.Val481Met) rs587780542
NM_000038.6(APC):c.1442T>C (p.Val481Ala) rs1561553667
NM_000038.6(APC):c.1443G>A (p.Val481=) rs146179851
NM_000038.6(APC):c.1444G>A (p.Asp482Asn) rs1554081666
NM_000038.6(APC):c.1447_1448TG[1] (p.Cys483_Glu484delinsTer) rs1554081669
NM_000038.6(APC):c.1450G>C (p.Glu484Gln) rs730881237
NM_000038.6(APC):c.1453A>C (p.Met485Leu) rs1561553769
NM_000038.6(APC):c.1455G>A (p.Met485Ile) rs747739964
NM_000038.6(APC):c.1458T>C (p.Tyr486=) rs2229992
NM_000038.6(APC):c.1458T>G (p.Tyr486Ter)
NM_000038.6(APC):c.1458_1459inv (p.Gly487Arg) rs1554081676
NM_000038.6(APC):c.1458_1460delinsCGA (p.Gly487Glu) rs1554081678
NM_000038.6(APC):c.1459G>A (p.Gly487Arg) rs1554081680
NM_000038.6(APC):c.1461G>A (p.Gly487=) rs1554081682
NM_000038.6(APC):c.1461G>T (p.Gly487=) rs1554081682
NM_000038.6(APC):c.1462C>T (p.Leu488Phe) rs587779782
NM_000038.6(APC):c.1463T>C (p.Leu488Pro) rs368434773
NM_000038.6(APC):c.1464_1467del (p.Thr489fs) rs1114167602
NM_000038.6(APC):c.146A>C (p.Lys49Thr) rs587781587
NM_000038.6(APC):c.146A>G (p.Lys49Arg) rs587781587
NM_000038.6(APC):c.1471G>A (p.Asp491Asn) rs1554081685
NM_000038.6(APC):c.1478A>G (p.Tyr493Cys) rs770649674
NM_000038.6(APC):c.1479C>A (p.Tyr493Ter)
NM_000038.6(APC):c.1479C>T (p.Tyr493=) rs1561553939
NM_000038.6(APC):c.147_150del (p.Lys49fs) rs587781694
NM_000038.6(APC):c.1480A>G (p.Ser494Gly) rs1554081689
NM_000038.6(APC):c.1481G>A (p.Ser494Asn) rs1554081691
NM_000038.6(APC):c.1481G>C (p.Ser494Thr) rs1554081691
NM_000038.6(APC):c.1483A>G (p.Ile495Val) rs372047677
NM_000038.6(APC):c.1485dup (p.Thr496fs) rs1131691137
NM_000038.6(APC):c.1487C>T (p.Thr496Ile) rs1369979539
NM_000038.6(APC):c.1488A>T (p.Thr496=) rs9282599
NM_000038.6(APC):c.1489C>T (p.Leu497=) rs768973715
NM_000038.6(APC):c.1491A>G (p.Leu497=) rs201992951
NM_000038.6(APC):c.1494del (p.Arg498fs) rs1554081719
NM_000038.6(APC):c.1495C>G (p.Arg499Gly) rs137854580
NM_000038.6(APC):c.1495C>T (p.Arg499Ter) rs137854580
NM_000038.6(APC):c.1498T>C (p.Tyr500His) rs762019672
NM_000038.6(APC):c.1499A>G (p.Tyr500Cys)
NM_000038.6(APC):c.14C>A (p.Ser5Ter) rs373718658
NM_000038.6(APC):c.14C>T (p.Ser5Leu) rs373718658
NM_000038.6(APC):c.14del (p.Ser5fs) rs1554067104
NM_000038.6(APC):c.1500T>A (p.Tyr500Ter) rs387906230
NM_000038.6(APC):c.1500T>C (p.Tyr500=) rs387906230
NM_000038.6(APC):c.1500T>G (p.Tyr500Ter) rs387906230
NM_000038.6(APC):c.1502C>T (p.Ala501Val) rs1390189763
NM_000038.6(APC):c.1503T>G (p.Ala501=) rs201664378
NM_000038.6(APC):c.1505G>A (p.Gly502Glu) rs1554081732
NM_000038.6(APC):c.1510G>A (p.Ala504Thr)
NM_000038.6(APC):c.1512T>C (p.Ala504=) rs1561554267
NM_000038.6(APC):c.1515G>T (p.Leu505Phe) rs77451514
NM_000038.6(APC):c.151C>T (p.Leu51=) rs1554069497
NM_000038.6(APC):c.1522_1523del (p.Leu508fs) rs886039509
NM_000038.6(APC):c.1524G>C (p.Leu508Phe) rs1561554327
NM_000038.6(APC):c.1525A>T (p.Thr509Ser) rs1554081744
NM_000038.6(APC):c.1525_1527del (p.Thr509del) rs863225315
NM_000038.6(APC):c.1526del (p.Thr509fs) rs1064794092
NM_000038.6(APC):c.1530T>C (p.Phe510=) rs1554081754
NM_000038.6(APC):c.1530dup (p.Gly511fs) rs1554081749
NM_000038.6(APC):c.1531G>T (p.Gly511Ter) rs876658811
NM_000038.6(APC):c.1534G>A (p.Asp512Asn) rs876659153
NM_000038.6(APC):c.1535A>T (p.Asp512Val)
NM_000038.6(APC):c.1538T>C (p.Val513Ala) rs876658167
NM_000038.6(APC):c.1538_1539dup (p.Ala514Ter) rs1554081762
NM_000038.6(APC):c.1539A>G (p.Val513=) rs766807361
NM_000038.6(APC):c.153A>G (p.Leu51=) rs1554069500
NM_000038.6(APC):c.1541C>T (p.Ala514Val) rs1131691147
NM_000038.6(APC):c.1542C>A (p.Ala514=) rs1561554519
NM_000038.6(APC):c.1548+11A>G rs1057521473
NM_000038.6(APC):c.1548+17T>C rs367690523
NM_000038.6(APC):c.1548+18G>A rs1554081769
NM_000038.6(APC):c.1548+1G>A rs1114167599
NM_000038.6(APC):c.1548+1G>C rs1114167599
NM_000038.6(APC):c.1548+1G>T rs1114167599
NM_000038.6(APC):c.1548+293A>G rs76597814
NM_000038.6(APC):c.1548+294G>T rs74747084
NM_000038.6(APC):c.1548+298A>T rs75941845
NM_000038.6(APC):c.1548+2T>C rs1057517561
NM_000038.6(APC):c.1548G>A (p.Lys516=) rs879254090
NM_000038.6(APC):c.1548G>C (p.Lys516Asn) rs879254090
NM_000038.6(APC):c.1549-13A>T rs587781267
NM_000038.6(APC):c.1549-14T>C rs761211430
NM_000038.6(APC):c.1549-16T>C rs773455401
NM_000038.6(APC):c.1549-17C>T rs1047599759
NM_000038.6(APC):c.1549-1G>A rs863225316
NM_000038.6(APC):c.1549-208A>G rs528500907
NM_000038.6(APC):c.1549-20A>C rs993325922
NM_000038.6(APC):c.1549-212C>A rs869312469
NM_000038.6(APC):c.1549-4A>G rs1554081872
NM_000038.6(APC):c.1549-9A>C rs1057521553
NM_000038.6(APC):c.154C>A (p.Gln52Lys) rs786202584
NM_000038.6(APC):c.154C>T (p.Gln52Ter) rs786202584
NM_000038.6(APC):c.1553C>T (p.Thr518Met) rs371453363
NM_000038.6(APC):c.1554G>A (p.Thr518=) rs546568052
NM_000038.6(APC):c.1557A>G (p.Leu519=) rs765537673
NM_000038.6(APC):c.1560del (p.Ser521fs)
NM_000038.6(APC):c.1562C>G (p.Ser521Cys) rs1554081882
NM_000038.6(APC):c.1562C>T (p.Ser521Phe) rs1554081882
NM_000038.6(APC):c.1564A>G (p.Met522Val) rs587781692
NM_000038.6(APC):c.1564dup (p.Met522fs) rs1554081884
NM_000038.6(APC):c.156del (p.Gly53fs)
NM_000038.6(APC):c.1570G>A (p.Gly524Ser) rs1174962542
NM_000038.6(APC):c.1571G>A (p.Gly524Asp) rs587782868
NM_000038.6(APC):c.1571G>C (p.Gly524Ala) rs587782868
NM_000038.6(APC):c.1576A>G (p.Met526Val) rs777219286
NM_000038.6(APC):c.1579A>G (p.Arg527Gly) rs751120046
NM_000038.6(APC):c.1580G>C (p.Arg527Thr) rs1554081889
NM_000038.6(APC):c.1587T>C (p.Leu529=) rs1554081894
NM_000038.6(APC):c.1588G>A (p.Val530Met) rs786204178
NM_000038.6(APC):c.1588G>T (p.Val530Leu)
NM_000038.6(APC):c.1589T>C (p.Val530Ala) rs202199891
NM_000038.6(APC):c.1593C>G (p.Ala531=) rs878853418
NM_000038.6(APC):c.1594C>G (p.Gln532Glu) rs1554081901
NM_000038.6(APC):c.1594C>T (p.Gln532Ter) rs1554081901
NM_000038.6(APC):c.1596A>G (p.Gln532=) rs1331131200
NM_000038.6(APC):c.1597C>A (p.Leu533Ile) rs905180328
NM_000038.6(APC):c.15A>G (p.Ser5=) rs1554067106
NM_000038.6(APC):c.1600A>T (p.Lys534Ter)
NM_000038.6(APC):c.1604C>T (p.Ser535Phe) rs75870842
NM_000038.6(APC):c.1605_1606del (p.Glu536fs) rs1554081906
NM_000038.6(APC):c.1606G>A (p.Glu536Lys) rs138098808
NM_000038.6(APC):c.1606G>T (p.Glu536Ter) rs138098808
NM_000038.6(APC):c.1609A>G (p.Ser537Gly) rs876659043
NM_000038.6(APC):c.1609del (p.Ser537fs) rs863225317
NM_000038.6(APC):c.1610G>A (p.Ser537Asn) rs1001526630
NM_000038.6(APC):c.1610G>C (p.Ser537Thr) rs1001526630
NM_000038.6(APC):c.1613A>T (p.Glu538Val) rs1561555761
NM_000038.6(APC):c.1614A>G (p.Glu538=) rs772204077
NM_000038.6(APC):c.1616_1623del (p.Asp539fs) rs1554081910
NM_000038.6(APC):c.1617C>A (p.Asp539Glu) rs1554081912
NM_000038.6(APC):c.1617C>T (p.Asp539=) rs1554081912
NM_000038.6(APC):c.1617delinsTGT (p.Leu540fs) rs1114167613
NM_000038.6(APC):c.1620A>C (p.Leu540Phe) rs1280077533
NM_000038.6(APC):c.1620del (p.Leu540fs) rs1554081921
NM_000038.6(APC):c.1620dup (p.Gln541fs) rs1131691555
NM_000038.6(APC):c.1621C>T (p.Gln541Ter) rs137854572
NM_000038.6(APC):c.1625A>C (p.Gln542Pro) rs1554081925
NM_000038.6(APC):c.1626+135T>C rs74725935
NM_000038.6(APC):c.1626+18A>G rs747123005
NM_000038.6(APC):c.1626+19C>T rs376863032
NM_000038.6(APC):c.1626+1G>A rs1554081934
NM_000038.6(APC):c.1626+290G>C rs74587487
NM_000038.6(APC):c.1626+2T>C rs876658858
NM_000038.6(APC):c.1626+2T>G rs876658858
NM_000038.6(APC):c.1626+3A>C rs1060503372
NM_000038.6(APC):c.1626+3A>G rs1060503372
NM_000038.6(APC):c.1626+4C>A rs1202435147
NM_000038.6(APC):c.1626+5T>G rs1561555947
NM_000038.6(APC):c.1626+6A>G rs1197354854
NM_000038.6(APC):c.1626+8T>C rs773400235
NM_000038.6(APC):c.1626+8T>G rs773400235
NM_000038.6(APC):c.1626G>C (p.Gln542His)
NM_000038.6(APC):c.1626_1626+6del rs1554081930
NM_000038.6(APC):c.1627-10T>A
NM_000038.6(APC):c.1627-10T>G rs863224538
NM_000038.6(APC):c.1627-16A>C rs1561557222
NM_000038.6(APC):c.1627-17A>G rs1554082075
NM_000038.6(APC):c.1627-2A>G
NM_000038.6(APC):c.1627-315C>T rs187075
NM_000038.6(APC):c.1627-3C>T rs1554082079
NM_000038.6(APC):c.1627-93A>C rs115157960
NM_000038.6(APC):c.1627G>T (p.Val543Phe) rs1554082080
NM_000038.6(APC):c.1629T>C (p.Val543=) rs779848042
NM_000038.6(APC):c.1630A>C (p.Ile544Leu)
NM_000038.6(APC):c.1631T>A (p.Ile544Asn) rs144056494
NM_000038.6(APC):c.1631T>C (p.Ile544Thr) rs144056494
NM_000038.6(APC):c.1632T>C (p.Ile544=) rs758661066
NM_000038.6(APC):c.1633dup (p.Ala545fs) rs1554082082
NM_000038.6(APC):c.1635G>A (p.Ala545=) rs351771
NM_000038.6(APC):c.1638T>C (p.Ser546=) rs1409874487
NM_000038.6(APC):c.1639G>A (p.Val547Ile) rs1554082089
NM_000038.6(APC):c.163A>G (p.Ile55Val) rs760158426
NM_000038.6(APC):c.163_164insG (p.Ile55fs) rs1554069524
NM_000038.6(APC):c.1640T>G (p.Val547Gly)
NM_000038.6(APC):c.1642T>A (p.Leu548Met)
NM_000038.6(APC):c.1642T>G (p.Leu548Val) rs1060503373
NM_000038.6(APC):c.1643del (p.Val547_Leu548insTer) rs1554082091
NM_000038.6(APC):c.1643dup (p.Leu548fs) rs1554082091
NM_000038.6(APC):c.1647G>A (p.Arg549=) rs1057521935
NM_000038.6(APC):c.164T>C (p.Ile55Thr) rs1554069530
NM_000038.6(APC):c.1652del (p.Leu551fs) rs1554082100
NM_000038.6(APC):c.1654_1658del (p.Ser552fs) rs876659452
NM_000038.6(APC):c.1655C>G (p.Ser552Cys) rs1561557447
NM_000038.6(APC):c.1656T>G (p.Ser552=) rs1554082105
NM_000038.6(APC):c.1657del (p.Trp553fs) rs1114167594
NM_000038.6(APC):c.1658G>A (p.Trp553Ter) rs863225318
NM_000038.6(APC):c.1659G>A (p.Trp553Ter) rs398123116
NM_000038.6(APC):c.1660C>T (p.Arg554Ter) rs137854573
NM_000038.6(APC):c.1662A>C (p.Arg554=) rs1057521976
NM_000038.6(APC):c.166G>C (p.Glu56Gln) rs786203566
NM_000038.6(APC):c.1673A>G (p.Asn558Ser) rs1381359478
NM_000038.6(APC):c.1680A>G (p.Lys560=) rs1554082120
NM_000038.6(APC):c.1682A>G (p.Lys561Arg) rs1561557634
NM_000038.6(APC):c.1682del (p.Lys561fs) rs1554082118
NM_000038.6(APC):c.1685C>T (p.Thr562Met) rs587783034
NM_000038.6(APC):c.1686G>A (p.Thr562=) rs770256026
NM_000038.6(APC):c.1687T>C (p.Leu563=) rs1057522640
NM_000038.6(APC):c.168A>G (p.Glu56=) rs1554069532
NM_000038.6(APC):c.1690C>T (p.Arg564Ter) rs137854574
NM_000038.6(APC):c.1691G>A (p.Arg564Gln) rs747418061
NM_000038.6(APC):c.1695A>G (p.Glu565=) rs77921116
NM_000038.6(APC):c.1695del (p.Val566fs) rs397514032
NM_000038.6(APC):c.1697T>A (p.Val566Asp) rs1554082127
NM_000038.6(APC):c.1697T>C (p.Val566Ala)
NM_000038.6(APC):c.1705G>A (p.Val569Met) rs876658405
NM_000038.6(APC):c.1705del (p.Ser568_Val569insTer) rs1554082135
NM_000038.6(APC):c.170A>T (p.Asp57Val) rs794729227
NM_000038.6(APC):c.170_175del (p.Asp57_Glu58del) rs1167769425
NM_000038.6(APC):c.1712C>T (p.Ala571Val) rs1413470754
NM_000038.6(APC):c.1713A>G (p.Ala571=) rs529306174
NM_000038.6(APC):c.1715T>A (p.Leu572Ter) rs886039511
NM_000038.6(APC):c.171T>C (p.Asp57=) rs770894012
NM_000038.6(APC):c.1721A>G (p.Glu574Gly) rs1561557875
NM_000038.6(APC):c.1722A>G (p.Glu574=) rs786201277
NM_000038.6(APC):c.1723T>A (p.Cys575Ser) rs1391594497
NM_000038.6(APC):c.1723T>C (p.Cys575Arg) rs1391594497
NM_000038.6(APC):c.1729T>G (p.Leu577Val) rs1060503284
NM_000038.6(APC):c.1739A>G (p.Lys580Arg) rs1561557943
NM_000038.6(APC):c.1742del (p.Lys581fs) rs1060503259
NM_000038.6(APC):c.1743+1053T>C rs79636900
NM_000038.6(APC):c.1743+1062A>C rs75279428
NM_000038.6(APC):c.1743+1075A>G rs181983752
NM_000038.6(APC):c.1743+1320G>A rs75190104
NM_000038.6(APC):c.1743+1377C>A rs74531593
NM_000038.6(APC):c.1743+1378T>A rs67111599
NM_000038.6(APC):c.1743+1535T>A rs75007163
NM_000038.6(APC):c.1743+1539C>A rs76056284
NM_000038.6(APC):c.1743+1544A>C rs78798527
NM_000038.6(APC):c.1743+1623C>A rs75997944
NM_000038.6(APC):c.1743+1735T>G rs77072083
NM_000038.6(APC):c.1743+1737A>G rs74417023
NM_000038.6(APC):c.1743+1810A>G rs75209153
NM_000038.6(APC):c.1743+1898A>T rs76293295
NM_000038.6(APC):c.1743+18_1743+106del rs1554082152
NM_000038.6(APC):c.1743+1900G>T rs80072260
NM_000038.6(APC):c.1743+193G>A rs351772
NM_000038.6(APC):c.1743+1G>A rs761458613
NM_000038.6(APC):c.1743+1G>T rs761458613
NM_000038.6(APC):c.1743+2155T>G rs77642001
NM_000038.6(APC):c.1743+2156G>T rs76302894
NM_000038.6(APC):c.1743+2157A>T rs79631901
NM_000038.6(APC):c.1743+2158G>T rs79434877
NM_000038.6(APC):c.1743+2159A>T rs78185547
NM_000038.6(APC):c.1743+2193G>A rs2253987
NM_000038.6(APC):c.1743+2374A>C rs79779990
NM_000038.6(APC):c.1743+2399T>G rs77263155
NM_000038.6(APC):c.1743+2402T>G rs78786852
NM_000038.6(APC):c.1743+2461T>G rs544243
NM_000038.6(APC):c.1743+2918T>C rs548710
NM_000038.6(APC):c.1743+299T>G rs79697679
NM_000038.6(APC):c.1743+344G>T rs77274836
NM_000038.6(APC):c.1743+347G>T rs77724846
NM_000038.6(APC):c.1743+349G>T rs76101832
NM_000038.6(APC):c.1743+439T>A rs79045815
NM_000038.6(APC):c.1743+442G>C rs79659088
NM_000038.6(APC):c.1743+445C>A rs80164775
NM_000038.6(APC):c.1743+494C>A rs115039927
NM_000038.6(APC):c.1743+527C>A rs76813345
NM_000038.6(APC):c.1743+5C>T rs876658386
NM_000038.6(APC):c.1743+688T>G rs77471185
NM_000038.6(APC):c.1743+690G>C rs75463123
NM_000038.6(APC):c.1743+6T>A
NM_000038.6(APC):c.1743+6T>C rs766973462
NM_000038.6(APC):c.1743+706C>T rs76839155
NM_000038.6(APC):c.1743+78A>G
NM_000038.6(APC):c.1743+959C>T rs56218335
NM_000038.6(APC):c.1743+972G>A rs78514921
NM_000038.6(APC):c.1743+973A>G rs78838474
NM_000038.6(APC):c.1743G>C (p.Lys581Asn) rs1114167592
NM_000038.6(APC):c.1744-1024A>G rs918397
NM_000038.6(APC):c.1744-10T>C rs1554083088
NM_000038.6(APC):c.1744-1123T>A rs2546111
NM_000038.6(APC):c.1744-11_1744-1del rs1064792977
NM_000038.6(APC):c.1744-1262G>T rs77722546
NM_000038.6(APC):c.1744-144A>G rs573935628
NM_000038.6(APC):c.1744-1489T>G rs77700642
NM_000038.6(APC):c.1744-14C>A rs761403505
NM_000038.6(APC):c.1744-1829T>C rs79107355
NM_000038.6(APC):c.1744-1839C>A rs79274032
NM_000038.6(APC):c.1744-1868T>C rs78526835
NM_000038.6(APC):c.1744-1872T>C rs77766685
NM_000038.6(APC):c.1744-1921T>G rs76132650
NM_000038.6(APC):c.1744-19A>G rs762654419
NM_000038.6(APC):c.1744-20C>T rs1554083085
NM_000038.6(APC):c.1744-212G>T rs76836190
NM_000038.6(APC):c.1744-213T>A rs75768637
NM_000038.6(APC):c.1744-2149T>C rs75560534
NM_000038.6(APC):c.1744-2150T>A rs80346480
NM_000038.6(APC):c.1744-2151T>A rs76499197
NM_000038.6(APC):c.1744-2182G>A rs78377209
NM_000038.6(APC):c.1744-2269T>C rs80072625
NM_000038.6(APC):c.1744-2272A>C rs74730413
NM_000038.6(APC):c.1744-2518G>C rs2909787
NM_000038.6(APC):c.1744-2583A>G rs2909786
NM_000038.6(APC):c.1744-2707C>G rs2909958
NM_000038.6(APC):c.1744-2727G>A rs11960216
NM_000038.6(APC):c.1744-2827C>T rs569940
NM_000038.6(APC):c.1744-290G>A rs458967
NM_000038.6(APC):c.1744-2A>G rs587783035
NM_000038.6(APC):c.1744-2A>T rs587783035
NM_000038.6(APC):c.1744-363T>A rs77504726
NM_000038.6(APC):c.1744-3T>C rs760166803
NM_000038.6(APC):c.1744-427T>G rs79826411
NM_000038.6(APC):c.1744-485A>T rs75356316
NM_000038.6(APC):c.1744-486G>T rs75714389
NM_000038.6(APC):c.1744-4C>G rs772745309
NM_000038.6(APC):c.1744-564A>C rs78897872
NM_000038.6(APC):c.1744-566G>C rs77304999
NM_000038.6(APC):c.1744-569C>A rs79561619
NM_000038.6(APC):c.1744-574G>A rs74797473
NM_000038.6(APC):c.1744-577T>G rs77807720
NM_000038.6(APC):c.1744-690A>T rs396971
NM_000038.6(APC):c.1744-6_1744-4delinsAG
NM_000038.6(APC):c.1744-722A>C rs76649307
NM_000038.6(APC):c.1744-725A>C rs76053267
NM_000038.6(APC):c.1744-731T>G rs75015074
NM_000038.6(APC):c.1744-739T>G rs76718657
NM_000038.6(APC):c.1744-758C>G rs76577654
NM_000038.6(APC):c.1744-980T>G rs75549059
NM_000038.6(APC):c.1746A>G (p.Glu582=) rs876658969
NM_000038.6(APC):c.1747T>G (p.Ser583Ala) rs1060503379
NM_000038.6(APC):c.1753del (p.Leu585fs)
NM_000038.6(APC):c.1755C>G (p.Leu585=) rs1366220818
NM_000038.6(APC):c.1757A>G (p.Lys586Arg) rs1554083104
NM_000038.6(APC):c.1759del (p.Ser587fs) rs1554083100
NM_000038.6(APC):c.1759dup (p.Ser587fs) rs1554083100
NM_000038.6(APC):c.175G>A (p.Ala59Thr) rs1554069536
NM_000038.6(APC):c.1761C>T (p.Ser587=) rs370783137
NM_000038.6(APC):c.1762G>A (p.Val588Ile) rs372416031
NM_000038.6(APC):c.1762G>C (p.Val588Leu)
NM_000038.6(APC):c.1763T>C (p.Val588Ala) rs1060503374
NM_000038.6(APC):c.1766_1767dup (p.Ser590Ter) rs1554083122
NM_000038.6(APC):c.1776A>G (p.Leu592=) rs1554083127
NM_000038.6(APC):c.1776A>T (p.Leu592Phe) rs1554083127
NM_000038.6(APC):c.1778G>A (p.Trp593Ter) rs1064794226
NM_000038.6(APC):c.1779G>A (p.Trp593Ter) rs1554083132
NM_000038.6(APC):c.1786T>C (p.Ser596Pro) rs1561568258
NM_000038.6(APC):c.1787C>G (p.Ser596Ter) rs1554083134
NM_000038.6(APC):c.1787C>T (p.Ser596Leu) rs1554083134
NM_000038.6(APC):c.1790C>T (p.Ala597Val) rs1210985696
NM_000038.6(APC):c.1802A>G (p.Glu601Gly) rs1554083140
NM_000038.6(APC):c.1803G>C (p.Glu601Asp) rs1447250546
NM_000038.6(APC):c.180G>A (p.Met60Ile) rs980662480
NM_000038.6(APC):c.1810G>A (p.Ala604Thr) rs1554083143
NM_000038.6(APC):c.1811C>G (p.Ala604Gly) rs370955311
NM_000038.6(APC):c.1811C>T (p.Ala604Val) rs370955311
NM_000038.6(APC):c.1813G>A (p.Asp605Asn) rs1060503278
NM_000038.6(APC):c.1817T>C (p.Ile606Thr) rs781337455
NM_000038.6(APC):c.1819T>C (p.Cys607Arg) rs1554083147
NM_000038.6(APC):c.181G>A (p.Ala61Thr) rs786201989
NM_000038.6(APC):c.1820G>C (p.Cys607Ser) rs1554083153
NM_000038.6(APC):c.1824T>A (p.Ala608=) rs1455415709
NM_000038.6(APC):c.1825G>A (p.Val609Ile) rs147863331
NM_000038.6(APC):c.1828G>T (p.Asp610Tyr)
NM_000038.6(APC):c.1829A>G (p.Asp610Gly) rs756090401
NM_000038.6(APC):c.1829del (p.Asp610fs) rs1561568510
NM_000038.6(APC):c.1834G>T (p.Ala612Ser) rs1038707565
NM_000038.6(APC):c.1834_1838del (p.Ala612fs) rs1554083160
NM_000038.6(APC):c.1837C>T (p.Leu613Phe)
NM_000038.6(APC):c.1841C>G (p.Ala614Gly)
NM_000038.6(APC):c.1842A>G (p.Ala614=) rs1057520424
NM_000038.6(APC):c.1849G>T (p.Val617Phe)
NM_000038.6(APC):c.184_186TCT[1] (p.Ser63del) rs876660575
NM_000038.6(APC):c.1851T>G (p.Val617=) rs1554083163
NM_000038.6(APC):c.1854C>T (p.Gly618=) rs780188104
NM_000038.6(APC):c.1854_1869del (p.Thr619fs) rs1554083164
NM_000038.6(APC):c.1856C>A (p.Thr619Asn) rs1197473008
NM_000038.6(APC):c.1857T>C (p.Thr619=) rs1554083170
NM_000038.6(APC):c.185C>T (p.Ser62Phe) rs74727182
NM_000038.6(APC):c.1860T>A (p.Leu620=) rs749754970
NM_000038.6(APC):c.1861dup (p.Thr621fs)
NM_000038.6(APC):c.1862C>T (p.Thr621Ile) rs1554083178
NM_000038.6(APC):c.1862del (p.Thr621fs) rs1064795792
NM_000038.6(APC):c.1863T>C (p.Thr621=) rs72541808
NM_000038.6(APC):c.1864T>C (p.Tyr622His) rs1561568794
NM_000038.6(APC):c.1865A>G (p.Tyr622Cys) rs1554083183
NM_000038.6(APC):c.1865A>T (p.Tyr622Phe) rs1554083183
NM_000038.6(APC):c.1866C>A (p.Tyr622Ter) rs876658355
NM_000038.6(APC):c.1866C>G (p.Tyr622Ter) rs876658355
NM_000038.6(APC):c.1866C>T (p.Tyr622=) rs876658355
NM_000038.6(APC):c.1866_1867delinsAT (p.Tyr622_Arg623delinsTer) rs878853419
NM_000038.6(APC):c.1867C>T (p.Arg623Trp) rs730881238
NM_000038.6(APC):c.1868G>A (p.Arg623Gln) rs765557332
NM_000038.6(APC):c.1870A>C (p.Ser624Arg) rs1437351234
NM_000038.6(APC):c.1871G>C (p.Ser624Thr) rs1463809433
NM_000038.6(APC):c.1872C>T (p.Ser624=) rs748550745
NM_000038.6(APC):c.1873C>T (p.Gln625Ter) rs876659517
NM_000038.6(APC):c.1875G>A (p.Gln625=) rs750857896
NM_000038.6(APC):c.1875_1878del (p.Asn627fs) rs878853420
NM_000038.6(APC):c.1876A>G (p.Thr626Ala) rs771748555
NM_000038.6(APC):c.1879A>C (p.Asn627His)
NM_000038.6(APC):c.1879_1882del (p.Asn627fs) rs1060503360
NM_000038.6(APC):c.1880A>G (p.Asn627Ser) rs1561569016
NM_000038.6(APC):c.1885_1886insA (p.Leu629fs) rs387906233
NM_000038.6(APC):c.1886T>A (p.Leu629Ter)
NM_000038.6(APC):c.1886T>G (p.Leu629Ter) rs1019221239
NM_000038.6(APC):c.1886del (p.Thr628_Leu629insTer) rs863224817
NM_000038.6(APC):c.1886dup (p.Leu629fs) rs863224817
NM_000038.6(APC):c.1892T>C (p.Ile631Thr)
NM_000038.6(APC):c.1892_1904delinsAAT (p.Ile631fs) rs863225319
NM_000038.6(APC):c.1895T>C (p.Ile632Thr) rs587781360
NM_000038.6(APC):c.1895_1958+28del rs1561569140
NM_000038.6(APC):c.18T>C (p.Tyr6=) rs786202301
NM_000038.6(APC):c.1902T>G (p.Ser634Arg) rs876659460
NM_000038.6(APC):c.1903G>T (p.Gly635Ter) rs1554083205
NM_000038.6(APC):c.1904G>A (p.Gly635Glu) rs730881239
NM_000038.6(APC):c.1904G>C (p.Gly635Ala) rs730881239
NM_000038.6(APC):c.1906G>A (p.Gly636Ser) rs1554083224
NM_000038.6(APC):c.1908T>C (p.Gly636=) rs79015778
NM_000038.6(APC):c.1908T>G (p.Gly636=) rs79015778
NM_000038.6(APC):c.1909G>A (p.Gly637Arg) rs1554083227
NM_000038.6(APC):c.190G>T (p.Gly64Ter) rs79323615
NM_000038.6(APC):c.1912A>C (p.Ile638Leu) rs75117039
NM_000038.6(APC):c.1912A>G (p.Ile638Val) rs75117039
NM_000038.6(APC):c.1912A>T (p.Ile638Leu) rs75117039
NM_000038.6(APC):c.1914A>G (p.Ile638Met) rs587781405
NM_000038.6(APC):c.1917dup (p.Arg640fs) rs397515732
NM_000038.6(APC):c.1918C>T (p.Arg640Trp) rs1114167575
NM_000038.6(APC):c.1919G>A (p.Arg640Gln) rs1273594465
NM_000038.6(APC):c.191G>A (p.Gly64Glu) rs878853421
NM_000038.6(APC):c.1923T>C (p.Asn641=) rs1554083238
NM_000038.6(APC):c.1925T>C (p.Val642Ala) rs759528091
NM_000038.6(APC):c.1927T>C (p.Ser643Pro) rs78349383
NM_000038.6(APC):c.1928C>T (p.Ser643Phe) rs1060503291
NM_000038.6(APC):c.1936A>G (p.Ile646Val)
NM_000038.6(APC):c.1937T>G (p.Ile646Arg) rs1554083243
NM_000038.6(APC):c.193C>A (p.Gln65Lys) rs863225320
NM_000038.6(APC):c.1941T>C (p.Ala647=) rs1554083247
NM_000038.6(APC):c.1951dup (p.Asp651fs) rs1554083255
NM_000038.6(APC):c.1952A>G (p.Asp651Gly) rs1554083260
NM_000038.6(APC):c.1953C>A (p.Asp651Glu) rs765308810
NM_000038.6(APC):c.1953C>G (p.Asp651Glu) rs765308810
NM_000038.6(APC):c.1956C>T (p.His652=) rs1064793716
NM_000038.6(APC):c.1957A>C (p.Arg653=) rs1114167580
NM_000038.6(APC):c.1957A>G (p.Arg653Gly) rs1114167580
NM_000038.6(APC):c.1958+1012C>T rs80012665
NM_000038.6(APC):c.1958+1013C>T rs74983686
NM_000038.6(APC):c.1958+1015G>A rs2545154
NM_000038.6(APC):c.1958+10G>T rs375175370
NM_000038.6(APC):c.1958+1133T>G rs75499375
NM_000038.6(APC):c.1958+126G>T rs368368751
NM_000038.6(APC):c.1958+17A>G rs753968575
NM_000038.6(APC):c.1958+1G>A rs1114167569
NM_000038.6(APC):c.1958+1_1958+2dup rs1561569606
NM_000038.6(APC):c.1958+1_1958+4dup rs1060503356
NM_000038.6(APC):c.1958+235A>G rs6899169
NM_000038.6(APC):c.1958+378C>A rs80253473
NM_000038.6(APC):c.1958+388C>T rs74735048
NM_000038.6(APC):c.1958+392G>T rs79726949
NM_000038.6(APC):c.1958+397C>A rs76757140
NM_000038.6(APC):c.1958+3A>G rs879254032
NM_000038.6(APC):c.1958+3A>T rs879254032
NM_000038.6(APC):c.1958+423T>G rs75350935
NM_000038.6(APC):c.1958+5A>C
NM_000038.6(APC):c.1958+5A>G rs762899641
NM_000038.6(APC):c.1958+632T>C rs79823354
NM_000038.6(APC):c.1958+637G>C rs77305982
NM_000038.6(APC):c.1958+689T>G rs77211497
NM_000038.6(APC):c.1958+692G>C rs79080534
NM_000038.6(APC):c.1958+695A>C rs77529757
NM_000038.6(APC):c.1958+6T>C rs368421386
NM_000038.6(APC):c.1958+707C>A rs78477258
NM_000038.6(APC):c.1958+729C>A rs79086002
NM_000038.6(APC):c.1958+730T>A rs77534058
NM_000038.6(APC):c.1958+732A>C rs78859219
NM_000038.6(APC):c.1958+7A>G rs1057524097
NM_000038.6(APC):c.1958+826C>A rs78421859
NM_000038.6(APC):c.1958+829C>A rs76537265
NM_000038.6(APC):c.1958+860T>C rs79031187
NM_000038.6(APC):c.1958+861T>C rs77626458
NM_000038.6(APC):c.1958+8T>C rs62626346
NM_000038.6(APC):c.1958+8_1958+10del rs749491470
NM_000038.6(APC):c.1958G>A (p.Arg653Lys) rs1060503318
NM_000038.6(APC):c.1958G>T (p.Arg653Met) rs1060503318
NM_000038.6(APC):c.1959-1031G>A rs411356
NM_000038.6(APC):c.1959-121A>T rs140289188
NM_000038.6(APC):c.1959-138A>G rs76565799
NM_000038.6(APC):c.1959-139C>A rs78611569
NM_000038.6(APC):c.1959-144T>A rs75266200
NM_000038.6(APC):c.1959-145T>A rs74571271
NM_000038.6(APC):c.1959-15_1959-14del rs1238699256
NM_000038.6(APC):c.1959-17T>C rs1561573948
NM_000038.6(APC):c.1959-18C>G rs766663675
NM_000038.6(APC):c.1959-1G>A rs863225321
NM_000038.6(APC):c.1959-2A>G rs876658214
NM_000038.6(APC):c.1959-320T>C rs1966476
NM_000038.6(APC):c.1959-464G>T rs1966477
NM_000038.6(APC):c.1959-571T>G rs75824617
NM_000038.6(APC):c.1959-766A>G rs78109460
NM_000038.6(APC):c.1959-837C>T rs77208670
NM_000038.6(APC):c.1959-838T>C rs75760698
NM_000038.6(APC):c.1959-890A>G rs74712350
NM_000038.6(APC):c.1959G>A (p.Arg653=) rs72541809
NM_000038.6(APC):c.195G>C (p.Gln65His) rs1554069548
NM_000038.6(APC):c.1960C>G (p.Gln654Glu) rs755105138
NM_000038.6(APC):c.1962A>G (p.Gln654=) rs1057523515
NM_000038.6(APC):c.1965C>T (p.Ile655=) rs765309567
NM_000038.6(APC):c.1966C>G (p.Leu656Val) rs577466163
NM_000038.6(APC):c.1967_1974del (p.Leu656fs)
NM_000038.6(APC):c.1968_1969del (p.Asn659fs) rs1114167597
NM_000038.6(APC):c.1968_1971del (p.Glu658fs)
NM_000038.6(APC):c.1970_1971GA[1] (p.Glu658fs) rs863225322
NM_000038.6(APC):c.1970_1971GA[2] (p.Asn659fs) rs863225322
NM_000038.6(APC):c.1971A>G (p.Arg657=) rs1561574114
NM_000038.6(APC):c.1972G>C (p.Glu658Gln) rs758972184
NM_000038.6(APC):c.1974G>A (p.Glu658=) rs747442953
NM_000038.6(APC):c.1977C>A (p.Asn659Lys) rs1561574172
NM_000038.6(APC):c.1977_1978insTTTCT (p.Asn660fs)
NM_000038.6(APC):c.1979A>G (p.Asn660Ser) rs1174866478
NM_000038.6(APC):c.1979del (p.Asn660fs)
NM_000038.6(APC):c.197T>C (p.Ile66Thr)
NM_000038.6(APC):c.1980C>T (p.Asn660=) rs1554083856
NM_000038.6(APC):c.1982G>A (p.Cys661Tyr) rs786203018
NM_000038.6(APC):c.1983T>A (p.Cys661Ter) rs1554083862
NM_000038.6(APC):c.1984C>A (p.Leu662Ile) rs756859993
NM_000038.6(APC):c.1987C>T (p.Gln663Ter) rs730881240
NM_000038.6(APC):c.1989A>G (p.Gln663=) rs864622539
NM_000038.6(APC):c.1991C>G (p.Thr664Ser)
NM_000038.6(APC):c.1993_1994del (p.Leu665fs)
NM_000038.6(APC):c.1995A>G (p.Leu665=) rs1023818848
NM_000038.6(APC):c.1997_1999delinsA (p.Leu666_Gln667delinsTer) rs863225323
NM_000038.6(APC):c.1999C>T (p.Gln667Ter) rs876660130
NM_000038.6(APC):c.2001A>G (p.Gln667=)
NM_000038.6(APC):c.2002C>T (p.His668Tyr) rs876660307
NM_000038.6(APC):c.2004C>A (p.His668Gln) rs1380127485
NM_000038.6(APC):c.2004del (p.His668_Leu669insTer) rs587782303
NM_000038.6(APC):c.2008_2014delinsTAGTTTTGTA (p.Lys670_His672delinsTer) rs1554083888
NM_000038.6(APC):c.2016T>C (p.His672=) rs1554083892
NM_000038.6(APC):c.2021T>A (p.Leu674Ter) rs1554083898
NM_000038.6(APC):c.2023A>G (p.Thr675Ala) rs1554083900
NM_000038.6(APC):c.2026A>G (p.Ile676Val) rs745529713
NM_000038.6(APC):c.2031C>T (p.Val677=) rs769363082
NM_000038.6(APC):c.2031_2034del (p.Ser678fs) rs878853422
NM_000038.6(APC):c.2033G>C (p.Ser678Thr) rs1554083916
NM_000038.6(APC):c.2036dup (p.Asn679fs) rs1131691140
NM_000038.6(APC):c.203T>G (p.Leu68Ter) rs1554069549
NM_000038.6(APC):c.2040A>G (p.Ala680=) rs1276616448
NM_000038.6(APC):c.2043T>C (p.Cys681=) rs786203136
NM_000038.6(APC):c.2047A>G (p.Thr683Ala) rs749130507
NM_000038.6(APC):c.2057_2058del (p.Asn686fs) rs1561574581
NM_000038.6(APC):c.2060T>G (p.Leu687Arg) rs863225324
NM_000038.6(APC):c.2063C>A (p.Ser688Ter) rs1554083930
NM_000038.6(APC):c.2068A>G (p.Arg690Gly) rs1561574634
NM_000038.6(APC):c.2069G>A (p.Arg690Lys) rs878853423
NM_000038.6(APC):c.2073T>C (p.Asn691=) rs768685742
NM_000038.6(APC):c.2074C>T (p.Pro692Ser) rs1561574669
NM_000038.6(APC):c.2077A>G (p.Lys693Glu) rs773985321
NM_000038.6(APC):c.2077A>T (p.Lys693Ter) rs773985321
NM_000038.6(APC):c.207A>G (p.Leu69=) rs1554069552
NM_000038.6(APC):c.207del (p.Glu70fs) rs863225325
NM_000038.6(APC):c.2083del (p.Gln695fs) rs1554083941
NM_000038.6(APC):c.2090C>T (p.Ala697Val) rs761733547
NM_000038.6(APC):c.2091A>G (p.Ala697=) rs541317651
NM_000038.6(APC):c.2092T>G (p.Leu698Val) rs1060503279
NM_000038.6(APC):c.2093T>A (p.Leu698Ter) rs137854582
NM_000038.6(APC):c.2093T>G (p.Leu698Ter) rs137854582
NM_000038.6(APC):c.2094A>G (p.Leu698=) rs1426881729
NM_000038.6(APC):c.2094A>T (p.Leu698Phe) rs1426881729
NM_000038.6(APC):c.2096G>A (p.Trp699Ter) rs1060503336
NM_000038.6(APC):c.2097G>A (p.Trp699Ter) rs1060503282
NM_000038.6(APC):c.2097G>C (p.Trp699Cys) rs1060503282
NM_000038.6(APC):c.2098del (p.Asp700fs) rs1060503305
NM_000038.6(APC):c.209A>G (p.Glu70Gly) rs863224539
NM_000038.6(APC):c.20A>G (p.Asp7Gly) rs1060503296
NM_000038.6(APC):c.2100dup (p.Met701fs) rs1561574860
NM_000038.6(APC):c.2101A>G (p.Met701Val) rs1561574872
NM_000038.6(APC):c.2101A>T (p.Met701Leu) rs1561574872
NM_000038.6(APC):c.2103G>T (p.Met701Ile) rs1276525166
NM_000038.6(APC):c.2105G>A (p.Gly702Glu) rs876658289
NM_000038.6(APC):c.2107del (p.Ala703fs) rs587783030
NM_000038.6(APC):c.2107dup (p.Ala703fs) rs587783030
NM_000038.6(APC):c.2109A>C (p.Ala703=) rs1561574950
NM_000038.6(APC):c.2110G>A (p.Val704Ile) rs367804502
NM_000038.6(APC):c.2111T>G (p.Val704Gly) rs1554083952
NM_000038.6(APC):c.2114G>A (p.Ser705Asn) rs752874220
NM_000038.6(APC):c.2114G>C (p.Ser705Thr) rs752874220
NM_000038.6(APC):c.211C>A (p.Arg71Ser) rs767741687
NM_000038.6(APC):c.211C>T (p.Arg71Cys) rs767741687
NM_000038.6(APC):c.2123A>G (p.Lys708Arg) rs587778030
NM_000038.6(APC):c.2125A>G (p.Asn709Asp) rs1064793601
NM_000038.6(APC):c.2129del (p.Leu710fs) rs1114167584
NM_000038.6(APC):c.212G>A (p.Arg71His) rs750503329
NM_000038.6(APC):c.2130C>T (p.Leu710=) rs1057521787
NM_000038.6(APC):c.2133del (p.His712fs) rs1060503321
NM_000038.6(APC):c.2135A>G (p.His712Arg) rs1554083961
NM_000038.6(APC):c.2138C>G (p.Ser713Ter) rs137854570
NM_000038.6(APC):c.2139A>G (p.Ser713=) rs1554083964
NM_000038.6(APC):c.2140A>G (p.Lys714Glu) rs1554083965
NM_000038.6(APC):c.2142G>A (p.Lys714=) rs1561575161
NM_000038.6(APC):c.2145C>T (p.His715=) rs1060504877
NM_000038.6(APC):c.2148A>G (p.Lys716=) rs764733890
NM_000038.6(APC):c.2149A>G (p.Met717Val)
NM_000038.6(APC):c.2158A>G (p.Met720Val) rs869025248
NM_000038.6(APC):c.2160G>A (p.Met720Ile) rs1283428855
NM_000038.6(APC):c.2161_2170del (p.Gly721fs) rs1554083981
NM_000038.6(APC):c.2170dup (p.Ala724fs) rs1554083984
NM_000038.6(APC):c.2180G>A (p.Arg727Lys) rs1215349287
NM_000038.6(APC):c.2183del (p.Asn728fs) rs863225326
NM_000038.6(APC):c.2185C>G (p.Leu729Val) rs1554083995
NM_000038.6(APC):c.2185_2336del (p.Leu729fs) rs1554083990
NM_000038.6(APC):c.2186_2187insGCAGCTT (p.Met730fs) rs1554083998
NM_000038.6(APC):c.2190G>A (p.Met730Ile) rs1281171015
NM_000038.6(APC):c.2191G>A (p.Ala731Thr) rs1318557130
NM_000038.6(APC):c.2192C>T (p.Ala731Val) rs1554084002
NM_000038.6(APC):c.2194A>G (p.Asn732Asp) rs876659004
NM_000038.6(APC):c.2196T>C (p.Asn732=) rs781693283
NM_000038.6(APC):c.220+10A>T rs1350313665
NM_000038.6(APC):c.220+124C>G rs76552546
NM_000038.6(APC):c.220+16G>T rs756214797
NM_000038.6(APC):c.220+19T>C rs754354718
NM_000038.6(APC):c.220+1G>A rs1554069570
NM_000038.6(APC):c.220+208C>A rs869312468
NM_000038.6(APC):c.220+229T>G rs75275297
NM_000038.6(APC):c.220+249C>T
NM_000038.6(APC):c.220+28A>G rs200746873
NM_000038.6(APC):c.220+2T>A rs587781809
NM_000038.6(APC):c.220+2T>C rs587781809
NM_000038.6(APC):c.220+38G>T rs74340509
NM_000038.6(APC):c.220+3A>C rs1554069573
NM_000038.6(APC):c.220+4G>A rs973491846
NM_000038.6(APC):c.220+5A>G rs1554069584
NM_000038.6(APC):c.2200C>T (p.Pro734Ser) rs1561575432
NM_000038.6(APC):c.2203G>C (p.Ala735Pro) rs559313229
NM_000038.6(APC):c.2204C>T (p.Ala735Val) rs147655929
NM_000038.6(APC):c.2205G>A (p.Ala735=) rs141001261
NM_000038.6(APC):c.2209T>C (p.Tyr737His) rs748868815
NM_000038.6(APC):c.220G>A (p.Glu74Lys) rs876658941
NM_000038.6(APC):c.220G>C (p.Glu74Gln) rs876658941
NM_000038.6(APC):c.220G>T (p.Glu74Ter) rs876658941
NM_000038.6(APC):c.221-11A>G rs531060253
NM_000038.6(APC):c.221-11A>T rs531060253
NM_000038.6(APC):c.221-16T>C rs1046591128
NM_000038.6(APC):c.221-1G>A rs863225327
NM_000038.6(APC):c.221-1G>C rs863225327
NM_000038.6(APC):c.221-29G>C rs369645686
NM_000038.6(APC):c.221-2A>G rs786201291
NM_000038.6(APC):c.221-344A>G rs80142737
NM_000038.6(APC):c.221-5T>C rs1057524155
NM_000038.6(APC):c.221-5T>G rs1057524155
NM_000038.6(APC):c.2213A>G (p.Lys738Arg) rs1561575511
NM_000038.6(APC):c.2218G>A (p.Ala740Thr) rs587781394
NM_000038.6(APC):c.2218G>C (p.Ala740Pro) rs587781394
NM_000038.6(APC):c.221A>C (p.Glu74Ala) rs773347338
NM_000038.6(APC):c.221A>G (p.Glu74Gly) rs773347338
NM_000038.6(APC):c.2220C>A (p.Ala740=) rs878853424
NM_000038.6(APC):c.2220C>T (p.Ala740=)
NM_000038.6(APC):c.2221A>C (p.Asn741His) rs1554084021
NM_000038.6(APC):c.2221A>G (p.Asn741Asp) rs1554084021
NM_000038.6(APC):c.2222A>G (p.Asn741Ser) rs150209825
NM_000038.6(APC):c.2223T>C (p.Asn741=) rs1554084025
NM_000038.6(APC):c.2228T>C (p.Met743Thr)
NM_000038.6(APC):c.2228T>G (p.Met743Arg) rs878853425
NM_000038.6(APC):c.2229del (p.Met743fs)
NM_000038.6(APC):c.222G>C (p.Glu74Asp) rs1561463688
NM_000038.6(APC):c.2232T>G (p.Ser744=) rs145751759
NM_000038.6(APC):c.2233C>T (p.Pro745Ser)
NM_000038.6(APC):c.2235T>C (p.Pro745=) rs1554084034
NM_000038.6(APC):c.223C>G (p.Leu75Val)
NM_000038.6(APC):c.223C>T (p.Leu75Phe) rs760790156
NM_000038.6(APC):c.2240C>G (p.Ser747Ter) rs773020689
NM_000038.6(APC):c.2240C>T (p.Ser747Leu) rs773020689
NM_000038.6(APC):c.2243G>A (p.Ser748Asn) rs1561575700
NM_000038.6(APC):c.2245T>A (p.Leu749Met) rs976000214
NM_000038.6(APC):c.2245T>C (p.Leu749=) rs976000214
NM_000038.6(APC):c.2249C>T (p.Pro750Leu) rs759703170
NM_000038.6(APC):c.224T>C (p.Leu75Pro) rs995081817
NM_000038.6(APC):c.2250A>T (p.Pro750=) rs376526724
NM_000038.6(APC):c.2252C>T (p.Ser751Phe) rs775429951
NM_000038.6(APC):c.2254C>G (p.Leu752Val) rs1561575778
NM_000038.6(APC):c.2259T>G (p.His753Gln) rs763155470
NM_000038.6(APC):c.2260G>A (p.Val754Ile) rs764099150
NM_000038.6(APC):c.2260G>T (p.Val754Phe) rs764099150
NM_000038.6(APC):c.2262T>C (p.Val754=) rs148987776
NM_000038.6(APC):c.2262T>G (p.Val754=) rs148987776
NM_000038.6(APC):c.2277C>T (p.Ala759=) rs762441650
NM_000038.6(APC):c.2280A>G (p.Leu760=) rs767947015
NM_000038.6(APC):c.228C>T (p.Asn76=) rs766325173
NM_000038.6(APC):c.2292A>G (p.Leu764=) rs1561575949
NM_000038.6(APC):c.2295T>C (p.Asp765=) rs1060504869
NM_000038.6(APC):c.2297C>T (p.Ala766Val) rs200339830
NM_000038.6(APC):c.2299C>T (p.Gln767Ter) rs1561575998
NM_000038.6(APC):c.22C>T (p.Gln8Ter) rs1554067110
NM_000038.6(APC):c.2300A>G (p.Gln767Arg) rs1554084064
NM_000038.6(APC):c.2303A>C (p.His768Pro) rs1060503322
NM_000038.6(APC):c.2306T>C (p.Leu769Ser) rs1554084067
NM_000038.6(APC):c.2307A>T (p.Leu769Phe) rs1561576071
NM_000038.6(APC):c.2308T>C (p.Ser770Pro) rs587781419
NM_000038.6(APC):c.2309C>G (p.Ser770Ter) rs1060503310
NM_000038.6(APC):c.2314del (p.Thr772fs) rs878853426
NM_000038.6(APC):c.2320G>C (p.Asp774His) rs1561576132
NM_000038.6(APC):c.2322C>A (p.Asp774Glu) rs145792879
NM_000038.6(APC):c.2322C>T (p.Asp774=) rs145792879
NM_000038.6(APC):c.2323A>G (p.Asn775Asp) rs1554084074
NM_000038.6(APC):c.2325T>C (p.Asn775=) rs779918968
NM_000038.6(APC):c.2325del (p.Asn775fs) rs863225328
NM_000038.6(APC):c.2333A>G (p.Asn778Ser) rs753274177
NM_000038.6(APC):c.2335T>C (p.Leu779=) rs369138788
NM_000038.6(APC):c.2336T>G (p.Leu779Ter) rs1561576302
NM_000038.6(APC):c.2336del (p.Asn778_Leu779insTer)
NM_000038.6(APC):c.2336dup (p.Leu779fs) rs1554084079
NM_000038.6(APC):c.2338del (p.Ser780fs) rs1561576308
NM_000038.6(APC):c.233A>C (p.Asp78Ala) rs562833260
NM_000038.6(APC):c.233_236del (p.Asp78fs) rs1064793020
NM_000038.6(APC):c.2341C>T (p.Pro781Ser) rs1060503302
NM_000038.6(APC):c.2343del (p.Lys782fs) rs1554084080
NM_000038.6(APC):c.2345A>T (p.Lys782Met) rs1554084082
NM_000038.6(APC):c.2346G>A (p.Lys782=) rs1554084084
NM_000038.6(APC):c.2347G>A (p.Ala783Thr) rs587780590
NM_000038.6(APC):c.2347G>T (p.Ala783Ser) rs587780590
NM_000038.6(APC):c.234T>G (p.Asp78Glu) rs765434321
NM_000038.6(APC):c.2353C>T (p.His785Tyr) rs1554084086
NM_000038.6(APC):c.2356C>T (p.Arg786Cys) rs1165139414
NM_000038.6(APC):c.2357G>A (p.Arg786His) rs1554084088
NM_000038.6(APC):c.2359A>G (p.Ser787Gly) rs748075979
NM_000038.6(APC):c.235A>G (p.Ser79Gly) rs1001856924
NM_000038.6(APC):c.2360G>A (p.Ser787Asn) rs910898245
NM_000038.6(APC):c.2361T>C (p.Ser787=) rs1339834096
NM_000038.6(APC):c.2364G>A (p.Lys788=) rs1554084096
NM_000038.6(APC):c.2365C>T (p.Gln789Ter) rs398123117
NM_000038.6(APC):c.2367_2368GA[3] (p.His791fs) rs1554084100
NM_000038.6(APC):c.236G>A (p.Ser79Asn) rs1554069689
NM_000038.6(APC):c.2371C>G (p.His791Asp) rs1060503309
NM_000038.6(APC):c.2372A>G (p.His791Arg) rs1554084104
NM_000038.6(APC):c.2376G>A (p.Lys792=) rs1554084105
NM_000038.6(APC):c.2378A>G (p.Gln793Arg) rs1356210683
NM_000038.6(APC):c.2379A>C (p.Gln793His) rs1554084111
NM_000038.6(APC):c.2379A>G (p.Gln793=) rs1554084111
NM_000038.6(APC):c.2380dup (p.Ser794fs) rs1114167564
NM_000038.6(APC):c.2383C>A (p.Leu795Ile) rs1442780982
NM_000038.6(APC):c.2383C>G (p.Leu795Val)
NM_000038.6(APC):c.2383C>T (p.Leu795Phe) rs1442780982
NM_000038.6(APC):c.2383_2384CT[1] (p.Tyr796fs) rs1561576666
NM_000038.6(APC):c.2385C>T (p.Leu795=) rs80188155
NM_000038.6(APC):c.2386T>C (p.Tyr796His) rs77985571
NM_000038.6(APC):c.2386T>G (p.Tyr796Asp) rs77985571
NM_000038.6(APC):c.2388T>C (p.Tyr796=) rs1554084124
NM_000038.6(APC):c.2390dup (p.Gly797_Asp798insTer) rs1561576755
NM_000038.6(APC):c.2395del (p.Tyr799fs) rs879254110
NM_000038.6(APC):c.2395dup (p.Tyr799fs) rs879254110
NM_000038.6(APC):c.2398G>A (p.Val800Ile) rs1554084131
NM_000038.6(APC):c.239G>A (p.Ser80Asn)
NM_000038.6(APC):c.239G>C (p.Ser80Thr) rs876659390
NM_000038.6(APC):c.2404G>T (p.Asp802Tyr) rs79853077
NM_000038.6(APC):c.2408C>G (p.Thr803Ser) rs587780591
NM_000038.6(APC):c.2408C>T (p.Thr803Ile) rs587780591
NM_000038.6(APC):c.2410A>T (p.Asn804Tyr) rs1382294216
NM_000038.6(APC):c.2411A>G (p.Asn804Ser) rs775727621
NM_000038.6(APC):c.2413C>G (p.Arg805Gly) rs587779783
NM_000038.6(APC):c.2413C>T (p.Arg805Ter) rs587779783
NM_000038.6(APC):c.2414G>A (p.Arg805Gln) rs200593940
NM_000038.6(APC):c.2415A>G (p.Arg805=) rs940992617
NM_000038.6(APC):c.2415dup (p.His806fs) rs1554084141
NM_000038.6(APC):c.2417A>G (p.His806Arg) rs1561576972
NM_000038.6(APC):c.2418T>A (p.His806Gln) rs372917037
NM_000038.6(APC):c.2419_2421GAT[1] (p.Asp808del) rs587781469
NM_000038.6(APC):c.2420A>G (p.Asp807Gly) rs1060503347
NM_000038.6(APC):c.2424T>G (p.Asp808Glu) rs1561577011
NM_000038.6(APC):c.2424_2514dup (p.Gly839Ter)
NM_000038.6(APC):c.2426del (p.Asn809fs) rs1114167573
NM_000038.6(APC):c.2428A>G (p.Arg810Gly)
NM_000038.6(APC):c.2433A>G (p.Ser811=) rs768177978
NM_000038.6(APC):c.2434G>C (p.Asp812His) rs761178697
NM_000038.6(APC):c.2434_2437del (p.Asp812fs) rs1131691136
NM_000038.6(APC):c.2434_2443delinsCC (p.Asp812fs) rs1554084159
NM_000038.6(APC):c.2437A>C (p.Asn813His)
NM_000038.6(APC):c.2438A>G (p.Asn813Ser) rs201522866
NM_000038.6(APC):c.2438A>T (p.Asn813Ile) rs201522866
NM_000038.6(APC):c.2439T>A (p.Asn813Lys) rs1554084165
NM_000038.6(APC):c.2441T>G (p.Phe814Cys) rs864622282
NM_000038.6(APC):c.2442T>G (p.Phe814Leu) rs587782495
NM_000038.6(APC):c.2444A>C (p.Asn815Thr) rs762990578
NM_000038.6(APC):c.2447C>T (p.Thr816Ile)
NM_000038.6(APC):c.244T>A (p.Phe82Ile) rs863225329
NM_000038.6(APC):c.2450G>T (p.Gly817Val)
NM_000038.6(APC):c.2451C>A (p.Gly817=) rs1169381951
NM_000038.6(APC):c.2453A>C (p.Asn818Thr) rs1554084177
NM_000038.6(APC):c.2453A>G (p.Asn818Ser)
NM_000038.6(APC):c.2453A>T (p.Asn818Ile) rs1554084177
NM_000038.6(APC):c.2454C>T (p.Asn818=) rs1554084178
NM_000038.6(APC):c.245T>C (p.Phe82Ser) rs1179254201
NM_000038.6(APC):c.2461G>A (p.Val821Ile) rs138498551
NM_000038.6(APC):c.2463C>T (p.Val821=) rs876658738
NM_000038.6(APC):c.2465T>C (p.Leu822Pro) rs777748272
NM_000038.6(APC):c.2466_2467insA (p.Ser823fs) rs1561577342
NM_000038.6(APC):c.2472A>G (p.Pro824=) rs746965994
NM_000038.6(APC):c.2472A>T (p.Pro824=) rs746965994
NM_000038.6(APC):c.2474A>G (p.Tyr825Cys) rs186641437
NM_000038.6(APC):c.2475T>C (p.Tyr825=) rs1554084195
NM_000038.6(APC):c.2476T>G (p.Leu826Val) rs145245264
NM_000038.6(APC):c.2481T>C (p.Asn827=) rs749477816
NM_000038.6(APC):c.2483C>T (p.Thr828Ile) rs786203696
NM_000038.6(APC):c.2483del (p.Thr828fs) rs886042600
NM_000038.6(APC):c.2485A>G (p.Thr829Ala) rs768810807
NM_000038.6(APC):c.2485del (p.Thr829fs) rs1561577476
NM_000038.6(APC):c.2488G>C (p.Val830Leu) rs1554084209
NM_000038.6(APC):c.2492T>C (p.Leu831Ser) rs878853427
NM_000038.6(APC):c.2494C>A (p.Pro832Thr) rs1554084213
NM_000038.6(APC):c.2494C>G (p.Pro832Ala) rs1554084213
NM_000038.6(APC):c.2494C>T (p.Pro832Ser) rs1554084213
NM_000038.6(APC):c.2495C>G (p.Pro832Arg) rs1554084217
NM_000038.6(APC):c.2496_2502del (p.Ser833fs) rs1114167576
NM_000038.6(APC):c.2497A>C (p.Ser833Arg) rs1331549900
NM_000038.6(APC):c.2498G>C (p.Ser833Thr) rs1218113894
NM_000038.6(APC):c.2499C>G (p.Ser833Arg) rs1554084221
NM_000038.6(APC):c.249del (p.Gly84fs) rs878853428
NM_000038.6(APC):c.2500T>C (p.Ser834Pro) rs786203408
NM_000038.6(APC):c.2501C>T (p.Ser834Phe)
NM_000038.6(APC):c.2503T>C (p.Ser835Pro) rs748302469
NM_000038.6(APC):c.2504C>A (p.Ser835Tyr) rs773796815
NM_000038.6(APC):c.2504C>G (p.Ser835Cys) rs773796815
NM_000038.6(APC):c.2507C>T (p.Ser836Leu)
NM_000038.6(APC):c.2507_2511delinsG (p.Ser835_Ser836insTer) rs1554084228
NM_000038.6(APC):c.2509T>G (p.Ser837Ala) rs79634147
NM_000038.6(APC):c.2510C>A (p.Ser837Ter) rs79512956
NM_000038.6(APC):c.2510C>G (p.Ser837Ter) rs79512956
NM_000038.6(APC):c.2511A>G (p.Ser837=) rs79909810
NM_000038.6(APC):c.2519G>C (p.Ser840Thr)
NM_000038.6(APC):c.251G>T (p.Gly84Val) rs143145868
NM_000038.6(APC):c.2520C>T (p.Ser840=) rs1460612068
NM_000038.6(APC):c.2522del (p.Ser840_Leu841insTer)
NM_000038.6(APC):c.2523A>C (p.Leu841Phe) rs1554084238
NM_000038.6(APC):c.2524G>A (p.Asp842Asn) rs1561577701
NM_000038.6(APC):c.2527A>G (p.Ser843Gly) rs536223189
NM_000038.6(APC):c.2527_2530del (p.Ser843fs) rs879254091
NM_000038.6(APC):c.2530_2531TC[1] (p.Arg845fs)
NM_000038.6(APC):c.2531C>A (p.Ser844Tyr) rs1554084247
NM_000038.6(APC):c.2533C>T (p.Arg845Cys) rs1554084249
NM_000038.6(APC):c.2534G>A (p.Arg845His) rs776878597
NM_000038.6(APC):c.2536del (p.Ser846fs)
NM_000038.6(APC):c.2538T>A (p.Ser846=) rs759201675
NM_000038.6(APC):c.2544A>G (p.Lys848=)
NM_000038.6(APC):c.2545G>A (p.Asp849Asn) rs752193945
NM_000038.6(APC):c.2545G>T (p.Asp849Tyr) rs752193945
NM_000038.6(APC):c.2546A>G (p.Asp849Gly) rs876660629
NM_000038.6(APC):c.2547T>C (p.Asp849=) rs766086010
NM_000038.6(APC):c.2547T>G (p.Asp849Glu) rs766086010
NM_000038.6(APC):c.2547_2550del (p.Asp849fs) rs398123118
NM_000038.6(APC):c.2552G>A (p.Ser851Asn) rs1554084260
NM_000038.6(APC):c.2552G>T (p.Ser851Ile)
NM_000038.6(APC):c.2555T>G (p.Leu852Trp)
NM_000038.6(APC):c.2557G>A (p.Glu853Lys) rs876659738
NM_000038.6(APC):c.2557_2558GA[3] (p.Glu855fs) rs794727160
NM_000038.6(APC):c.2558A>G (p.Glu853Gly) rs1554084263
NM_000038.6(APC):c.2559G>A (p.Glu853=) rs1554084265
NM_000038.6(APC):c.2563G>A (p.Glu855Lys) rs1320581229
NM_000038.6(APC):c.2566C>T (p.Arg856Cys) rs566005215
NM_000038.6(APC):c.2567G>A (p.Arg856His) rs757164742
NM_000038.6(APC):c.2567dup (p.Gly857fs) rs1554084266
NM_000038.6(APC):c.2568C>T (p.Arg856=) rs751433216
NM_000038.6(APC):c.2569G>A (p.Gly857Arg) rs745692178
NM_000038.6(APC):c.2570G>T (p.Gly857Val) rs1554084270
NM_000038.6(APC):c.2570del (p.Gly857fs) rs876658472
NM_000038.6(APC):c.2571A>G (p.Gly857=) rs1561578068
NM_000038.6(APC):c.2575G>C (p.Gly859Arg) rs919202692
NM_000038.6(APC):c.2577T>C (p.Gly859=) rs1561578087
NM_000038.6(APC):c.2581G>A (p.Gly861Ser) rs1554084273
NM_000038.6(APC):c.2584A>G (p.Asn862Asp) rs755221428
NM_000038.6(APC):c.2585A>G (p.Asn862Ser) rs779334785
NM_000038.6(APC):c.2586C>G (p.Asn862Lys) rs147972247
NM_000038.6(APC):c.2587T>A (p.Tyr863Asn) rs1554084288
NM_000038.6(APC):c.2587_2589del (p.Tyr863del) rs1554084281
NM_000038.6(APC):c.2587_2600del (p.Tyr863fs)
NM_000038.6(APC):c.2588A>G (p.Tyr863Cys) rs1561578213
NM_000038.6(APC):c.2589C>A (p.Tyr863Ter) rs1561578229
NM_000038.6(APC):c.258dup (p.Leu87fs) rs1114167546
NM_000038.6(APC):c.2593C>G (p.Pro865Ala) rs192620988
NM_000038.6(APC):c.2593C>T (p.Pro865Ser) rs192620988
NM_000038.6(APC):c.2599A>G (p.Thr867Ala) rs1554084294
NM_000038.6(APC):c.259C>T (p.Leu87=) rs569640184
NM_000038.6(APC):c.2600C>A (p.Thr867Lys)
NM_000038.6(APC):c.2608C>T (p.Pro870Ser) rs33974176
NM_000038.6(APC):c.260T>C (p.Leu87Pro) rs777456713
NM_000038.6(APC):c.2611G>A (p.Gly871Arg) rs1554084297
NM_000038.6(APC):c.2612G>A (p.Gly871Glu) rs948419955
NM_000038.6(APC):c.2612del (p.Gly871fs) rs1554084299
NM_000038.6(APC):c.2613A>C (p.Gly871=) rs36046448
NM_000038.6(APC):c.2614A>C (p.Thr872Pro) rs1060503294
NM_000038.6(APC):c.2614A>G (p.Thr872Ala)
NM_000038.6(APC):c.2614A>T (p.Thr872Ser) rs1060503294
NM_000038.6(APC):c.2615C>G (p.Thr872Ser) rs1554084311
NM_000038.6(APC):c.2616T>C (p.Thr872=) rs555061955
NM_000038.6(APC):c.2616_2617inv (p.Ser873Thr)
NM_000038.6(APC):c.2621C>G (p.Ser874Ter) rs1554084318
NM_000038.6(APC):c.2621C>T (p.Ser874Leu) rs1554084318
NM_000038.6(APC):c.2624dup (p.Arg876fs) rs863225330
NM_000038.6(APC):c.2626C>A (p.Arg876=) rs121913333
NM_000038.6(APC):c.2626C>T (p.Arg876Ter) rs121913333
NM_000038.6(APC):c.2627G>A (p.Arg876Gln) rs373428732
NM_000038.6(APC):c.262C>T (p.Arg88Trp) rs746592911
NM_000038.6(APC):c.2630G>C (p.Gly877Ala) rs558732083
NM_000038.6(APC):c.2631T>A (p.Gly877=) rs762629631
NM_000038.6(APC):c.2632T>C (p.Leu878=) rs1476958808
NM_000038.6(APC):c.2635C>T (p.Gln879Ter) rs1060503287
NM_000038.6(APC):c.263G>A (p.Arg88Gln) rs587780592
NM_000038.6(APC):c.2640C>A (p.Ile880=) rs200184105
NM_000038.6(APC):c.2640C>T (p.Ile880=) rs200184105
NM_000038.6(APC):c.2642C>T (p.Ser881Phe) rs535344579
NM_000038.6(APC):c.2644A>G (p.Thr882Ala)
NM_000038.6(APC):c.2645C>T (p.Thr882Ile) rs786203243
NM_000038.6(APC):c.264G>A (p.Arg88=) rs1554069706
NM_000038.6(APC):c.2650G>A (p.Ala884Thr) rs863224540
NM_000038.6(APC):c.2651C>T (p.Ala884Val) rs750217875
NM_000038.6(APC):c.2652A>C (p.Ala884=) rs1554084343
NM_000038.6(APC):c.2652dup (p.Ala885fs) rs1561578684
NM_000038.6(APC):c.2653G>A (p.Ala885Thr) rs1344158460
NM_000038.6(APC):c.2655C>T (p.Ala885=) rs1554084348
NM_000038.6(APC):c.2656C>T (p.Gln886Ter) rs755806668
NM_000038.6(APC):c.2658G>A (p.Gln886=) rs587780593
NM_000038.6(APC):c.2658G>T (p.Gln886His) rs587780593
NM_000038.6(APC):c.2659A>G (p.Ile887Val) rs730881241
NM_000038.6(APC):c.2662G>T (p.Ala888Ser) rs1554084353
NM_000038.6(APC):c.2666A>G (p.Lys889Arg) rs1350986347
NM_000038.6(APC):c.2669T>G (p.Val890Gly) rs878853429
NM_000038.6(APC):c.266C>A (p.Ser89Ter)
NM_000038.6(APC):c.266C>G (p.Ser89Ter) rs876658846
NM_000038.6(APC):c.2670C>A (p.Val890=) rs1554084362
NM_000038.6(APC):c.2672T>C (p.Met891Thr) rs876660004
NM_000038.6(APC):c.2674G>T (p.Glu892Ter) rs1561578889
NM_000038.6(APC):c.2677G>A (p.Glu893Lys) rs199740875
NM_000038.6(APC):c.2677G>T (p.Glu893Ter) rs199740875
NM_000038.6(APC):c.2678A>T (p.Glu893Val) rs1554084370
NM_000038.6(APC):c.2680_2686dup (p.Ala896fs) rs587781910
NM_000038.6(APC):c.2685A>C (p.Ser895=) rs1554084377
NM_000038.6(APC):c.2686_2689dup (p.Ile897fs) rs1554084375
NM_000038.6(APC):c.2687C>T (p.Ala896Val) rs864622255
NM_000038.6(APC):c.268A>G (p.Lys90Glu) rs763184444
NM_000038.6(APC):c.2692C>T (p.His898Tyr) rs758712508
NM_000038.6(APC):c.2692_2693insT (p.His898fs) rs1561579040
NM_000038.6(APC):c.2693A>C (p.His898Pro)
NM_000038.6(APC):c.2694del (p.His898fs) rs1554084389
NM_000038.6(APC):c.2696C>A (p.Thr899Asn) rs864622670
NM_000038.6(APC):c.2696C>G (p.Thr899Ser) rs864622670
NM_000038.6(APC):c.2697C>T (p.Thr899=) rs1183756347
NM_000038.6(APC):c.2698T>G (p.Ser900Ala)
NM_000038.6(APC):c.26_27insTTTA (p.Leu9fs) rs1561444605
NM_000038.6(APC):c.2700T>C (p.Ser900=) rs1554084399
NM_000038.6(APC):c.2701C>T (p.Gln901Ter) rs1114167559
NM_000038.6(APC):c.2702A>C (p.Gln901Pro) rs747095991
NM_000038.6(APC):c.2707G>A (p.Asp903Asn) rs587782610
NM_000038.6(APC):c.2707G>T (p.Asp903Tyr) rs587782610
NM_000038.6(APC):c.2710A>G (p.Arg904Gly)
NM_000038.6(APC):c.2711_2712del (p.Arg904fs) rs1554084403
NM_000038.6(APC):c.2716T>G (p.Ser906Ala) rs786204146
NM_000038.6(APC):c.2719G>A (p.Gly907Arg) rs771458366
NM_000038.6(APC):c.2719G>C (p.Gly907Arg)
NM_000038.6(APC):c.271del (p.Met91fs) rs1554069710
NM_000038.6(APC):c.2723C>G (p.Ser908Cys) rs746393911
NM_000038.6(APC):c.2725A>G (p.Thr909Ala) rs878853430
NM_000038.6(APC):c.2731G>C (p.Glu911Gln) rs398123119
NM_000038.6(APC):c.2731G>T (p.Glu911Ter) rs398123119
NM_000038.6(APC):c.2733A>T (p.Glu911Asp) rs770018276
NM_000038.6(APC):c.2738A>G (p.His913Arg) rs762572576
NM_000038.6(APC):c.2739T>C (p.His913=) rs553363502
NM_000038.6(APC):c.273G>A (p.Met91Ile) rs745394881
NM_000038.6(APC):c.2740T>G (p.Cys914Gly) rs1554084426
NM_000038.6(APC):c.2743G>A (p.Val915Met) rs1446823177
NM_000038.6(APC):c.2744T>C (p.Val915Ala)
NM_000038.6(APC):c.2745G>A (p.Val915=) rs761286097
NM_000038.6(APC):c.2749G>A (p.Asp917Asn) rs1561579402
NM_000038.6(APC):c.274T>G (p.Ser92Ala) rs1554069716
NM_000038.6(APC):c.2754G>A (p.Glu918=) rs767066195
NM_000038.6(APC):c.2758A>G (p.Asn920Asp) rs1561579442
NM_000038.6(APC):c.2759del (p.Asn920fs) rs863225331
NM_000038.6(APC):c.275C>G (p.Ser92Cys)
NM_000038.6(APC):c.2760T>C (p.Asn920=) rs1554084427
NM_000038.6(APC):c.2763A>G (p.Ala921=) rs750259615
NM_000038.6(APC):c.2764C>T (p.Leu922Phe) rs150543576
NM_000038.6(APC):c.2765T>G (p.Leu922Arg) rs878853431
NM_000038.6(APC):c.2768G>C (p.Arg923Thr) rs1057519194
NM_000038.6(APC):c.2769_2771AAG[1] (p.Arg924del) rs1554084439
NM_000038.6(APC):c.276C>T (p.Ser92=) rs369238363
NM_000038.6(APC):c.2772A>G (p.Arg924=) rs1554084440
NM_000038.6(APC):c.2775C>G (p.Ser925Arg) rs864622701
NM_000038.6(APC):c.2775C>T (p.Ser925=) rs864622701
NM_000038.6(APC):c.2778T>C (p.Ser926=) rs371526966
NM_000038.6(APC):c.277C>G (p.Leu93Val) rs201567345
NM_000038.6(APC):c.2780C>G (p.Ala927Gly) rs587781500
NM_000038.6(APC):c.2782G>A (p.Ala928Thr) rs730881222
NM_000038.6(APC):c.2785C>T (p.His929Tyr) rs1183098771
NM_000038.6(APC):c.2786A>C (p.His929Pro) rs730881242
NM_000038.6(APC):c.2786A>G (p.His929Arg) rs730881242
NM_000038.6(APC):c.278T>A (p.Leu93His) rs876658977
NM_000038.6(APC):c.2790_2791delinsGTGT (p.His931fs) rs1554084454
NM_000038.6(APC):c.2792A>G (p.His931Arg) rs1554084461
NM_000038.6(APC):c.2795C>A (p.Ser932Ter) rs878853432
NM_000038.6(APC):c.2795C>G (p.Ser932Ter) rs878853432
NM_000038.6(APC):c.2797A>G (p.Asn933Asp) rs1060503270
NM_000038.6(APC):c.279C>T (p.Leu93=) rs768492450
NM_000038.6(APC):c.2800A>G (p.Thr934Ala) rs1561579733
NM_000038.6(APC):c.2801C>T (p.Thr934Ile) rs1561579756
NM_000038.6(APC):c.2802_2805del (p.Tyr935fs) rs1131691143
NM_000038.6(APC):c.2804A>G (p.Tyr935Cys) rs1554084481
NM_000038.6(APC):c.2804dup (p.Tyr935Ter) rs863225332
NM_000038.6(APC):c.2805C>A (p.Tyr935Ter) rs137854575
NM_000038.6(APC):c.2805C>G (p.Tyr935Ter) rs137854575
NM_000038.6(APC):c.2805C>T (p.Tyr935=) rs137854575
NM_000038.6(APC):c.2805del (p.Thr934_Tyr935insTer) rs398123120
NM_000038.6(APC):c.2806_2813dup (p.Lys939fs) rs863225333
NM_000038.6(APC):c.2807A>G (p.Asn936Ser) rs878853433
NM_000038.6(APC):c.280C>A (p.Arg94Ser) rs550945533
NM_000038.6(APC):c.280C>G (p.Arg94Gly) rs550945533
NM_000038.6(APC):c.280C>T (p.Arg94Cys) rs550945533
NM_000038.6(APC):c.2812A>G (p.Thr938Ala) rs965844436
NM_000038.6(APC):c.2813C>G (p.Thr938Ser) rs1554084496
NM_000038.6(APC):c.2814T>C (p.Thr938=) rs1554084501
NM_000038.6(APC):c.2819C>G (p.Ser940Trp) rs544709767
NM_000038.6(APC):c.2819C>T (p.Ser940Leu) rs544709767
NM_000038.6(APC):c.2819del (p.Ser940fs) rs1554084508
NM_000038.6(APC):c.281G>A (p.Arg94His) rs774229223
NM_000038.6(APC):c.281_282del (p.Arg94fs) rs1561464190
NM_000038.6(APC):c.2820G>A (p.Ser940=) rs780366551
NM_000038.6(APC):c.2825del (p.Asn942fs) rs1554084511
NM_000038.6(APC):c.2828C>A (p.Ser943Ter) rs1554084512
NM_000038.6(APC):c.282T>C (p.Arg94=) rs1485825595
NM_000038.6(APC):c.2830A>G (p.Asn944Asp) rs749720558
NM_000038.6(APC):c.2834_2835delinsTT (p.Arg945Ile) rs786204162
NM_000038.6(APC):c.2837del (p.Thr946fs) rs1554084529
NM_000038.6(APC):c.2838A>G (p.Thr946=) rs142835322
NM_000038.6(APC):c.2840G>A (p.Cys947Tyr) rs997271472
NM_000038.6(APC):c.2840G>T (p.Cys947Phe) rs997271472
NM_000038.6(APC):c.2840_2841del (p.Cys947fs) rs1554084531
NM_000038.6(APC):c.2842T>C (p.Ser948Pro) rs1554084533
NM_000038.6(APC):c.2843C>G (p.Ser948Cys) rs1064793776
NM_000038.6(APC):c.2844_2847dup (p.Pro950fs)
NM_000038.6(APC):c.2845A>G (p.Met949Val) rs587781348
NM_000038.6(APC):c.2845A>T (p.Met949Leu) rs587781348
NM_000038.6(APC):c.2847G>T (p.Met949Ile) rs147394539
NM_000038.6(APC):c.2848C>T (p.Pro950Ser) rs1114167581
NM_000038.6(APC):c.284C>T (p.Ser95Phe) rs146221748
NM_000038.6(APC):c.2850T>G (p.Pro950=) rs1561580310
NM_000038.6(APC):c.2853T>C (p.Tyr951=) rs575406600
NM_000038.6(APC):c.2853del (p.Pro950_Tyr951insTer) rs1554084541
NM_000038.6(APC):c.2855C>A (p.Ala952Asp) rs776560257
NM_000038.6(APC):c.2855C>T (p.Ala952Val) rs776560257
NM_000038.6(APC):c.2859A>G (p.Lys953=) rs759348312
NM_000038.6(APC):c.2859dup (p.Leu954fs) rs1554084547
NM_000038.6(APC):c.2860T>C (p.Leu954=) rs863224278
NM_000038.6(APC):c.2863del (p.Glu955fs) rs1554084553
NM_000038.6(APC):c.2866T>C (p.Tyr956His) rs765131179
NM_000038.6(APC):c.2867A>G (p.Tyr956Cys) rs1554084554
NM_000038.6(APC):c.2870A>G (p.Lys957Arg) rs777881096
NM_000038.6(APC):c.2876C>T (p.Ser959Phe) rs757526267
NM_000038.6(APC):c.2879_2883del (p.Ser959_Ser960insTer) rs876660496
NM_000038.6(APC):c.287A>G (p.Tyr96Cys) rs760770847
NM_000038.6(APC):c.287A>T (p.Tyr96Phe)
NM_000038.6(APC):c.2882A>G (p.Asn961Ser) rs1554084564
NM_000038.6(APC):c.2883T>C (p.Asn961=) rs1060503367
NM_000038.6(APC):c.2883T>G (p.Asn961Lys) rs1060503367
NM_000038.6(APC):c.2884G>A (p.Asp962Asn) rs1554084565
NM_000038.6(APC):c.2884del (p.Asp962fs) rs1561580546
NM_000038.6(APC):c.2886del (p.Asp962fs) rs863225334
NM_000038.6(APC):c.288T>A (p.Tyr96Ter) rs376213437
NM_000038.6(APC):c.288T>C (p.Tyr96=) rs376213437
NM_000038.6(APC):c.288T>G (p.Tyr96Ter) rs376213437
NM_000038.6(APC):c.2892A>C (p.Leu964Phe) rs1554084570
NM_000038.6(APC):c.2894del (p.Asn965fs) rs1554084575
NM_000038.6(APC):c.2895_2896del (p.Asn965fs) rs1554084576
NM_000038.6(APC):c.2898T>A (p.Ser966Arg) rs876660579
NM_000038.6(APC):c.2898T>C (p.Ser966=) rs876660579
NM_000038.6(APC):c.2901C>A (p.Val967=) rs1060504876
NM_000038.6(APC):c.2902_2904AGT[2] (p.Ser970del)
NM_000038.6(APC):c.2903G>A (p.Ser968Asn) rs1554084581
NM_000038.6(APC):c.2904T>A (p.Ser968Arg) rs1554084582
NM_000038.6(APC):c.2905_2906insC (p.Ser969fs) rs1131691139
NM_000038.6(APC):c.2909G>A (p.Ser970Asn) rs767473403
NM_000038.6(APC):c.2909G>C (p.Ser970Thr) rs767473403
NM_000038.6(APC):c.2910_2911del (p.Ser970fs) rs1060503307
NM_000038.6(APC):c.2914G>A (p.Gly972Ser)
NM_000038.6(APC):c.2919T>C (p.Tyr973=) rs756609845
NM_000038.6(APC):c.2920G>T (p.Gly974Cys) rs74561014
NM_000038.6(APC):c.2923A>G (p.Lys975Glu) rs780597635
NM_000038.6(APC):c.2925A>T (p.Lys975Asn)
NM_000038.6(APC):c.2926A>G (p.Arg976Gly) rs587782846
NM_000038.6(APC):c.2926dup (p.Arg976fs) rs1554084587
NM_000038.6(APC):c.2931T>G (p.Gly977=) rs1554084590
NM_000038.6(APC):c.2933A>C (p.Gln978Pro) rs730881223
NM_000038.6(APC):c.2937G>T (p.Met979Ile)
NM_000038.6(APC):c.2938A>T (p.Lys980Ter) rs1554084592
NM_000038.6(APC):c.2939_2941del (p.Lys980_Pro981delinsThr) rs772573597
NM_000038.6(APC):c.2942C>G (p.Pro981Arg) rs587779784
NM_000038.6(APC):c.2945C>T (p.Ser982Leu) rs139773221
NM_000038.6(APC):c.2946G>A (p.Ser982=) rs377384463
NM_000038.6(APC):c.2946G>T (p.Ser982=) rs377384463
NM_000038.6(APC):c.2948T>A (p.Ile983Asn) rs113674464
NM_000038.6(APC):c.2948T>C (p.Ile983Thr) rs113674464
NM_000038.6(APC):c.2950G>T (p.Glu984Ter) rs1254176854
NM_000038.6(APC):c.2952A>G (p.Glu984=) rs772562489
NM_000038.6(APC):c.2957A>G (p.Tyr986Cys) rs730881243
NM_000038.6(APC):c.2958T>C (p.Tyr986=) rs746581330
NM_000038.6(APC):c.295C>A (p.Arg99=) rs139196838
NM_000038.6(APC):c.295C>T (p.Arg99Trp) rs139196838
NM_000038.6(APC):c.2963A>C (p.Glu988Ala) rs1554084609
NM_000038.6(APC):c.2964_2965delinsT (p.Glu988fs) rs1064795724
NM_000038.6(APC):c.2966A>G (p.Asp989Gly) rs770976457
NM_000038.6(APC):c.2969A>G (p.Asp990Gly)
NM_000038.6(APC):c.296G>A (p.Arg99Gln) rs199842850
NM_000038.6(APC):c.2970T>G (p.Asp990Glu)
NM_000038.6(APC):c.2971G>T (p.Glu991Ter) rs786202995
NM_000038.6(APC):c.2975G>C (p.Ser992Thr) rs864622328
NM_000038.6(APC):c.2976T>C (p.Ser992=) rs776646018
NM_000038.6(APC):c.2978A>C (p.Lys993Thr) rs1554084627
NM_000038.6(APC):c.2985C>T (p.Cys995=)
NM_000038.6(APC):c.2986A>G (p.Ser996Gly) rs1554084628
NM_000038.6(APC):c.298G>A (p.Glu100Lys) rs1561464319
NM_000038.6(APC):c.298del (p.Glu100fs) rs1064794224
NM_000038.6(APC):c.2991T>C (p.Tyr997=) rs864622629
NM_000038.6(APC):c.2991T>G (p.Tyr997Ter) rs864622629
NM_000038.6(APC):c.2991_2996del (p.Tyr997_Gln999delinsTer) rs1114167562
NM_000038.6(APC):c.2993G>T (p.Gly998Val) rs759579036
NM_000038.6(APC):c.2995C>A (p.Gln999Lys) rs75239284
NM_000038.6(APC):c.2995C>G (p.Gln999Glu)
NM_000038.6(APC):c.2995C>T (p.Gln999Ter) rs75239284
NM_000038.6(APC):c.2997A>G (p.Gln999=) rs1554084635
NM_000038.6(APC):c.2999A>G (p.Tyr1000Cys)
NM_000038.6(APC):c.2999_3005del (p.Tyr1000fs) rs1561581273
NM_000038.6(APC):c.3002del (p.Pro1001fs) rs1114167586
NM_000038.6(APC):c.3006C>T (p.Ala1002=) rs72541810
NM_000038.6(APC):c.3007G>A (p.Asp1003Asn) rs564314108
NM_000038.6(APC):c.300A>G (p.Glu100=) rs1060504888
NM_000038.6(APC):c.3010C>G (p.Leu1004Val)
NM_000038.6(APC):c.3013_3019del (p.Ala1005fs) rs1057517553
NM_000038.6(APC):c.3014C>T (p.Ala1005Val) rs876660427
NM_000038.6(APC):c.3016C>A (p.His1006Asn) rs879253876
NM_000038.6(APC):c.3016C>T (p.His1006Tyr) rs879253876
NM_000038.6(APC):c.301G>T (p.Gly101Ter) rs863225335
NM_000038.6(APC):c.3021A>G (p.Lys1007=) rs876660904
NM_000038.6(APC):c.3022A>G (p.Ile1008Val) rs1561581407
NM_000038.6(APC):c.3025C>T (p.His1009Tyr) rs750459690
NM_000038.6(APC):c.3027T>C (p.His1009=) rs938418357
NM_000038.6(APC):c.3028A>G (p.Ser1010Gly) rs1253051713
NM_000038.6(APC):c.3028del (p.Ser1010fs) rs1554084648
NM_000038.6(APC):c.3029G>A (p.Ser1010Asn) rs864622584
NM_000038.6(APC):c.302G>A (p.Gly101Glu)
NM_000038.6(APC):c.3035A>G (p.Asn1012Ser)
NM_000038.6(APC):c.3035_3037delinsT (p.Asn1012fs) rs1554084650
NM_000038.6(APC):c.3038A>G (p.His1013Arg) rs1554084653
NM_000038.6(APC):c.3040A>G (p.Met1014Val) rs1554084654
NM_000038.6(APC):c.3045T>C (p.Asp1015=) rs1554084657
NM_000038.6(APC):c.3047A>T (p.Asp1016Val) rs1554084658
NM_000038.6(APC):c.3049_3051del (p.Asn1017del) rs730881229
NM_000038.6(APC):c.304T>C (p.Ser102Pro) rs753302494
NM_000038.6(APC):c.3050A>T (p.Asn1017Ile) rs753314927
NM_000038.6(APC):c.3051T>C (p.Asn1017=) rs1561581624
NM_000038.6(APC):c.3052G>A (p.Asp1018Asn) rs587778038
NM_000038.6(APC):c.3052G>C (p.Asp1018His) rs587778038
NM_000038.6(APC):c.3054_3063del (p.Asp1018fs) rs863225336
NM_000038.6(APC):c.3060A>G (p.Glu1020=) rs1057522595
NM_000038.6(APC):c.3067dup (p.Thr1023fs) rs876658724
NM_000038.6(APC):c.3068C>T (p.Thr1023Ile) rs1561581690
NM_000038.6(APC):c.3070C>T (p.Pro1024Ser) rs587779785
NM_000038.6(APC):c.3073A>G (p.Ile1025Val) rs370591349
NM_000038.6(APC):c.3077A>C (p.Asn1026Thr) rs1114167603
NM_000038.6(APC):c.3079T>C (p.Tyr1027His) rs587781605
NM_000038.6(APC):c.3079T>G (p.Tyr1027Asp) rs587781605
NM_000038.6(APC):c.3079dup (p.Tyr1027fs) rs863225337
NM_000038.6(APC):c.307G>C (p.Val103Leu) rs758995578
NM_000038.6(APC):c.307G>T (p.Val103Leu) rs758995578
NM_000038.6(APC):c.3080A>G (p.Tyr1027Cys) rs869312784
NM_000038.6(APC):c.3081T>C (p.Tyr1027=) rs878853434
NM_000038.6(APC):c.3083G>A (p.Ser1028Asn) rs1114167617
NM_000038.6(APC):c.3083G>T (p.Ser1028Ile) rs1114167617
NM_000038.6(APC):c.3084T>A (p.Ser1028Arg) rs876660265
NM_000038.6(APC):c.3088A>C (p.Lys1030Gln) rs587779786
NM_000038.6(APC):c.3088A>T (p.Lys1030Ter) rs587779786
NM_000038.6(APC):c.3090dup (p.Tyr1031fs) rs1554084685
NM_000038.6(APC):c.3097G>T (p.Asp1033Tyr) rs1554084686
NM_000038.6(APC):c.309A>G (p.Val103=) rs863224279
NM_000038.6(APC):c.3101A>T (p.Glu1034Val) rs1554084689
NM_000038.6(APC):c.3104A>C (p.Gln1035Pro) rs1060503303
NM_000038.6(APC):c.3105G>T (p.Gln1035His) rs878853435
NM_000038.6(APC):c.3113C>T (p.Ser1038Phe) rs1375326078
NM_000038.6(APC):c.3114_3115del (p.Gly1039fs) rs1554084698
NM_000038.6(APC):c.3115_3116delinsCT (p.Gly1039Leu) rs1554084704
NM_000038.6(APC):c.3118A>T (p.Arg1040Trp) rs587782306
NM_000038.6(APC):c.311C>A (p.Ser104Ter) rs74953290
NM_000038.6(APC):c.311C>G (p.Ser104Ter) rs74953290
NM_000038.6(APC):c.311C>T (p.Ser104Leu)
NM_000038.6(APC):c.3122A>C (p.Gln1041Pro) rs1554084709
NM_000038.6(APC):c.3122A>G (p.Gln1041Arg) rs1554084709
NM_000038.6(APC):c.3123A>G (p.Gln1041=) rs537501804
NM_000038.6(APC):c.3123_3124del (p.Pro1043fs) rs1554084712
NM_000038.6(APC):c.3125G>C (p.Ser1042Thr) rs786203919
NM_000038.6(APC):c.3125del (p.Ser1042fs) rs863225338
NM_000038.6(APC):c.3127C>T (p.Pro1043Ser) rs1561582049
NM_000038.6(APC):c.3128C>T (p.Pro1043Leu) rs1030285956
NM_000038.6(APC):c.3131C>T (p.Ser1044Leu) rs1554084719
NM_000038.6(APC):c.3134A>G (p.Gln1045Arg) rs1554084722
NM_000038.6(APC):c.3135_3136del (p.Gln1045_Asn1046insTer) rs863225339
NM_000038.6(APC):c.3136A>G (p.Asn1046Asp) rs755493779
NM_000038.6(APC):c.3137del (p.Asn1046fs)
NM_000038.6(APC):c.3139G>T (p.Glu1047Ter) rs568149455
NM_000038.6(APC):c.313A>G (p.Ser105Gly) rs776242276
NM_000038.6(APC):c.3140A>G (p.Glu1047Gly) rs1292530466
NM_000038.6(APC):c.3144A>G (p.Arg1048=) rs1561582170
NM_000038.6(APC):c.3145T>C (p.Trp1049Arg) rs587779787
NM_000038.6(APC):c.3145T>G (p.Trp1049Gly)
NM_000038.6(APC):c.3146G>A (p.Trp1049Ter) rs876658667
NM_000038.6(APC):c.3147G>A (p.Trp1049Ter) rs863225340
NM_000038.6(APC):c.3147G>C (p.Trp1049Cys) rs863225340
NM_000038.6(APC):c.3149C>G (p.Ala1050Gly) rs753145833
NM_000038.6(APC):c.3149del (p.Ala1050fs) rs730882135
NM_000038.6(APC):c.314G>A (p.Ser105Asn)
NM_000038.6(APC):c.3150A>G (p.Ala1050=) rs1554084742
NM_000038.6(APC):c.3151A>C (p.Arg1051=) rs757981620
NM_000038.6(APC):c.3152G>C (p.Arg1051Thr) rs1554084748
NM_000038.6(APC):c.3154C>G (p.Pro1052Ala) rs1060503258
NM_000038.6(APC):c.3155C>T (p.Pro1052Leu) rs1060503371
NM_000038.6(APC):c.3157A>G (p.Lys1053Glu) rs1554084758
NM_000038.6(APC):c.315_318delinsA (p.Ser105del) rs879254143
NM_000038.6(APC):c.3160C>T (p.His1054Tyr) rs1195583636
NM_000038.6(APC):c.3161A>C (p.His1054Pro) rs777538550
NM_000038.6(APC):c.3162C>T (p.His1054=) rs1554084767
NM_000038.6(APC):c.3162del (p.His1054fs) rs397515733
NM_000038.6(APC):c.3163A>G (p.Ile1055Val)
NM_000038.6(APC):c.3164T>G (p.Ile1055Arg) rs1554084780
NM_000038.6(APC):c.3164_3168del (p.Ile1055fs) rs1554084772
NM_000038.6(APC):c.3165A>T (p.Ile1055=) rs61734287
NM_000038.6(APC):c.3166A>G (p.Ile1056Val) rs770526770
NM_000038.6(APC):c.3167T>C (p.Ile1056Thr) rs1554084790
NM_000038.6(APC):c.316C>T (p.Arg106Cys) rs1554069763
NM_000038.6(APC):c.3173A>G (p.Asp1058Gly) rs148725540
NM_000038.6(APC):c.3174T>G (p.Asp1058Glu) rs1561582572
NM_000038.6(APC):c.3179_3183del (p.Ile1060fs) rs1554084794
NM_000038.6(APC):c.3179_3184del (p.Ile1060_Gln1062delinsLys) rs1057517624
NM_000038.6(APC):c.317G>A (p.Arg106His) rs201764637
NM_000038.6(APC):c.3182A>G (p.Lys1061Arg) rs769814905
NM_000038.6(APC):c.3183_3187del (p.Lys1061_Gln1062insTer) rs587779352
NM_000038.6(APC):c.3183dup (p.Gln1062fs) rs1114167582
NM_000038.6(APC):c.3184C>T (p.Gln1062Ter) rs1554084818
NM_000038.6(APC):c.3184_3187del (p.Gln1062fs) rs1114167551
NM_000038.6(APC):c.3186A>C (p.Gln1062His) rs1554084821
NM_000038.6(APC):c.3186_3187del (p.Gln1062_Ser1063insTer) rs1060503362
NM_000038.6(APC):c.3189T>C (p.Ser1063=) rs1554084833
NM_000038.6(APC):c.3189_3192del (p.Glu1064fs)
NM_000038.6(APC):c.3190G>T (p.Glu1064Ter) rs1462312032
NM_000038.6(APC):c.3193C>A (p.Gln1065Lys) rs1330361513
NM_000038.6(APC):c.3195A>G (p.Gln1065=) rs1554084837
NM_000038.6(APC):c.3196del (p.Arg1066fs) rs878853436
NM_000038.6(APC):c.3197G>A (p.Arg1066Lys) rs587778039
NM_000038.6(APC):c.3199C>T (p.Gln1067Ter) rs137854571
NM_000038.6(APC):c.319T>G (p.Ser107Ala) rs1485866385
NM_000038.6(APC):c.3200A>C (p.Gln1067Pro) rs1561582871
NM_000038.6(APC):c.3202_3205del (p.Ser1068fs) rs587779353
NM_000038.6(APC):c.3203C>A (p.Ser1068Ter) rs1554084848
NM_000038.6(APC):c.3203C>G (p.Ser1068Ter) rs1554084848
NM_000038.6(APC):c.3205A>G (p.Arg1069Gly) rs375408871
NM_000038.6(APC):c.3207G>A (p.Arg1069=) rs762867687
NM_000038.6(APC):c.3207G>T (p.Arg1069Ser)
NM_000038.6(APC):c.3209A>T (p.Asn1070Ile) rs1315959337
NM_000038.6(APC):c.320C>G (p.Ser107Cys) rs774416950
NM_000038.6(APC):c.3210T>C (p.Asn1070=) rs886059794
NM_000038.6(APC):c.3211C>T (p.Gln1071Ter) rs876659539
NM_000038.6(APC):c.3211_3212del (p.Gln1071fs)
NM_000038.6(APC):c.3214A>C (p.Ser1072Arg) rs1554084854
NM_000038.6(APC):c.3218C>T (p.Thr1073Ile) rs773354366
NM_000038.6(APC):c.3220A>C (p.Thr1074Pro) rs962456431
NM_000038.6(APC):c.3220A>G (p.Thr1074Ala) rs962456431
NM_000038.6(APC):c.3221C>T (p.Thr1074Ile) rs1554084865
NM_000038.6(APC):c.3225T>C (p.Tyr1075=) rs768123840
NM_000038.6(APC):c.3227C>G (p.Pro1076Arg) rs766394131
NM_000038.6(APC):c.3229G>C (p.Val1077Leu) rs1332655563
NM_000038.6(APC):c.3239_3240AG[1] (p.Ser1081fs) rs1060503327
NM_000038.6(APC):c.323G>A (p.Gly108Glu) rs1114167456
NM_000038.6(APC):c.3242G>A (p.Ser1081Asn) rs374380039
NM_000038.6(APC):c.3242G>T (p.Ser1081Ile) rs374380039
NM_000038.6(APC):c.3243C>T (p.Ser1081=) rs1561583244
NM_000038.6(APC):c.3245C>G (p.Thr1082Ser) rs730881244
NM_000038.6(APC):c.3245C>T (p.Thr1082Ile) rs730881244
NM_000038.6(APC):c.3249T>G (p.Asp1083Glu) rs201629780
NM_000038.6(APC):c.3251A>T (p.Asp1084Val) rs201904856
NM_000038.6(APC):c.3254A>C (p.Lys1085Thr) rs1561583350
NM_000038.6(APC):c.3258C>T (p.His1086=) rs778031876
NM_000038.6(APC):c.325G>T (p.Glu109Ter) rs1414406816
NM_000038.6(APC):c.3260_3261del (p.Leu1087fs) rs587782305
NM_000038.6(APC):c.3262A>C (p.Lys1088Gln) rs1554084883
NM_000038.6(APC):c.3263A>C (p.Lys1088Thr)
NM_000038.6(APC):c.3264G>A (p.Lys1088=) rs114774495
NM_000038.6(APC):c.3264del (p.Lys1088fs) rs1554084885
NM_000038.6(APC):c.3270A>C (p.Gln1090His)
NM_000038.6(APC):c.3270A>G (p.Gln1090=) rs780818655
NM_000038.6(APC):c.3274C>T (p.His1092Tyr) rs1561583516
NM_000038.6(APC):c.3275A>C (p.His1092Pro) rs587779788
NM_000038.6(APC):c.3279T>G (p.Phe1093Leu) rs199539973
NM_000038.6(APC):c.3281G>T (p.Gly1094Val) rs1554084898
NM_000038.6(APC):c.3282A>T (p.Gly1094=) rs1060503290
NM_000038.6(APC):c.3286C>T (p.Gln1096Ter) rs587783029
NM_000038.6(APC):c.3289G>A (p.Glu1097Lys) rs1060503312
NM_000038.6(APC):c.3289G>C (p.Glu1097Gln) rs1060503312
NM_000038.6(APC):c.328T>C (p.Cys110Arg)
NM_000038.6(APC):c.3293G>A (p.Cys1098Tyr) rs1561583695
NM_000038.6(APC):c.3293_3294GT[1] (p.Val1099fs) rs1064794228
NM_000038.6(APC):c.3295G>A (p.Val1099Ile) rs730881245
NM_000038.6(APC):c.3298_3301del (p.Ser1100fs) rs863225341
NM_000038.6(APC):c.3299C>T (p.Ser1100Phe) rs863224541
NM_000038.6(APC):c.32dup (p.Gln12fs) rs1561444620
NM_000038.6(APC):c.3300dup (p.Pro1101fs) rs1114167609
NM_000038.6(APC):c.3301C>T (p.Pro1101Ser) rs878853437
NM_000038.6(APC):c.3303A>G (p.Pro1101=) rs587780594
NM_000038.6(APC):c.3304_3307del (p.Tyr1102fs) rs863225342
NM_000038.6(APC):c.3305A>G (p.Tyr1102Cys) rs769608546
NM_000038.6(APC):c.3306C>A (p.Tyr1102Ter) rs879254092
NM_000038.6(APC):c.3306C>G (p.Tyr1102Ter) rs879254092
NM_000038.6(APC):c.3306C>T (p.Tyr1102=) rs879254092
NM_000038.6(APC):c.3307A>T (p.Arg1103Trp) rs1057521600
NM_000038.6(APC):c.3308G>A (p.Arg1103Lys)
NM_000038.6(APC):c.3308G>C (p.Arg1103Thr) rs200371555
NM_000038.6(APC):c.330C>T (p.Cys110=) rs1060504887
NM_000038.6(APC):c.3311C>G (p.Ser1104Ter)
NM_000038.6(APC):c.3313C>T (p.Arg1105Trp) rs768454793
NM_000038.6(APC):c.3314G>A (p.Arg1105Gln) rs548176472
NM_000038.6(APC):c.3314G>C (p.Arg1105Pro) rs548176472
NM_000038.6(APC):c.3316G>T (p.Gly1106Ter) rs1554084921
NM_000038.6(APC):c.3317G>A (p.Gly1106Glu) rs1410671834
NM_000038.6(APC):c.3317del (p.Gly1106fs) rs1561583917
NM_000038.6(APC):c.3319G>T (p.Ala1107Ser) rs1060503283
NM_000038.6(APC):c.3323A>G (p.Asn1108Ser) rs151286353
NM_000038.6(APC):c.3325G>C (p.Gly1109Arg) rs587778040
NM_000038.6(APC):c.3325G>T (p.Gly1109Cys) rs587778040
NM_000038.6(APC):c.3329C>T (p.Ser1110Leu)
NM_000038.6(APC):c.332G>A (p.Ser111Asn) rs786202322
NM_000038.6(APC):c.3335C>G (p.Thr1112Arg) rs146007372
NM_000038.6(APC):c.3335_3336del (p.Thr1112fs) rs1064793778
NM_000038.6(APC):c.3340C>T (p.Arg1114Ter) rs121913331
NM_000038.6(APC):c.3341G>A (p.Arg1114Gln) rs753209586
NM_000038.6(APC):c.3342A>G (p.Arg1114=) rs786201145
NM_000038.6(APC):c.3343G>A (p.Val1115Met) rs763392909
NM_000038.6(APC):c.3343del (p.Val1115fs) rs1554084945
NM_000038.6(APC):c.3345G>T (p.Val1115=) rs1561584130
NM_000038.6(APC):c.3347G>A (p.Gly1116Asp) rs730881224
NM_000038.6(APC):c.3347del (p.Gly1116fs) rs1114167554
NM_000038.6(APC):c.334C>A (p.Pro112Thr)
NM_000038.6(APC):c.3352A>G (p.Asn1118Asp) rs140493115
NM_000038.6(APC):c.3353A>C (p.Asn1118Thr)
NM_000038.6(APC):c.3353A>G (p.Asn1118Ser) rs752011683
NM_000038.6(APC):c.3355C>G (p.His1119Asp) rs1266515539
NM_000038.6(APC):c.3355C>T (p.His1119Tyr) rs1266515539
NM_000038.6(APC):c.3356A>T (p.His1119Leu) rs1554084962
NM_000038.6(APC):c.3357T>C (p.His1119=) rs1554084963
NM_000038.6(APC):c.3359G>A (p.Gly1120Glu) rs28933379
NM_000038.6(APC):c.335C>G (p.Pro112Arg) rs1060503357
NM_000038.6(APC):c.3364A>C (p.Asn1122His) rs1554084967
NM_000038.6(APC):c.3365A>G (p.Asn1122Ser) rs372855304
NM_000038.6(APC):c.3368A>C (p.Gln1123Pro) rs587779789
NM_000038.6(APC):c.3368A>G (p.Gln1123Arg) rs587779789
NM_000038.6(APC):c.336T>A (p.Pro112=) rs886059793
NM_000038.6(APC):c.3371A>G (p.Asn1124Ser) rs1554084970
NM_000038.6(APC):c.3374T>C (p.Val1125Ala) rs377278397
NM_000038.6(APC):c.3374dup (p.Ser1126fs) rs1561584336
NM_000038.6(APC):c.3376A>T (p.Ser1126Cys) rs1561584350
NM_000038.6(APC):c.3377G>A (p.Ser1126Asn) rs767339739
NM_000038.6(APC):c.3377G>T (p.Ser1126Ile) rs767339739
NM_000038.6(APC):c.3378C>G (p.Ser1126Arg) rs149353082
NM_000038.6(APC):c.3381G>C (p.Gln1127His) rs1554084977
NM_000038.6(APC):c.3381G>T (p.Gln1127His) rs1554084977
NM_000038.6(APC):c.3383C>G (p.Ser1128Cys) rs755586334
NM_000038.6(APC):c.3386T>C (p.Leu1129Ser) rs143638171
NM_000038.6(APC):c.3386del (p.Leu1129fs) rs1114167616
NM_000038.6(APC):c.3387G>T (p.Leu1129Phe) rs730881225
NM_000038.6(APC):c.338T>C (p.Val113Ala) rs863224542
NM_000038.6(APC):c.3391C>T (p.Gln1131Ter) rs878853438
NM_000038.6(APC):c.3393A>G (p.Gln1131=) rs545574962
NM_000038.6(APC):c.3393_3395AGA[1] (p.Glu1132del) rs1554084984
NM_000038.6(APC):c.3396A>T (p.Glu1132Asp) rs1561584490
NM_000038.6(APC):c.3397G>A (p.Asp1133Asn) rs1354436128
NM_000038.6(APC):c.3399T>A (p.Asp1133Glu) rs1561584518
NM_000038.6(APC):c.3401A>G (p.Asp1134Gly) rs1561584535
NM_000038.6(APC):c.3403T>C (p.Tyr1135His) rs876660502
NM_000038.6(APC):c.3404A>G (p.Tyr1135Cys) rs754916822
NM_000038.6(APC):c.3404_3405del (p.Asp1134_Tyr1135insTer) rs864622086
NM_000038.6(APC):c.3407A>C (p.Glu1136Ala) rs878853439
NM_000038.6(APC):c.3412G>C (p.Asp1138His) rs587781452
NM_000038.6(APC):c.3415A>C (p.Lys1139Gln) rs201550951
NM_000038.6(APC):c.3419C>G (p.Pro1140Arg) rs1060503351
NM_000038.6(APC):c.341del (p.Pro114fs) rs1064793021
NM_000038.6(APC):c.3421A>C (p.Thr1141Pro)
NM_000038.6(APC):c.3421A>T (p.Thr1141Ser)
NM_000038.6(APC):c.3425A>C (p.Asn1142Thr) rs138410865
NM_000038.6(APC):c.3425A>G (p.Asn1142Ser) rs138410865
NM_000038.6(APC):c.3426T>A (p.Asn1142Lys) rs375478525
NM_000038.6(APC):c.3427_3428TA[3] (p.Ser1144fs) rs879254148
NM_000038.6(APC):c.3428A>G (p.Tyr1143Cys) rs1419180532
NM_000038.6(APC):c.3429T>C (p.Tyr1143=) rs1554084999
NM_000038.6(APC):c.3433G>C (p.Glu1145Gln) rs1060503375
NM_000038.6(APC):c.3436C>T (p.Arg1146Cys) rs202168805
NM_000038.6(APC):c.3437G>A (p.Arg1146His) rs763486328
NM_000038.6(APC):c.343A>G (p.Met115Val) rs1060503276
NM_000038.6(APC):c.3440A>C (p.Tyr1147Ser)
NM_000038.6(APC):c.3444_3447del (p.Glu1149fs) rs1554085005
NM_000038.6(APC):c.3445G>A (p.Glu1149Lys)
NM_000038.6(APC):c.3445G>C (p.Glu1149Gln) rs371117193
NM_000038.6(APC):c.3445_3447GAA[2] (p.Glu1151del) rs761327787
NM_000038.6(APC):c.3451G>C (p.Glu1151Gln) rs1554085013
NM_000038.6(APC):c.3454C>G (p.Gln1152Glu) rs1064795228
NM_000038.6(APC):c.3454C>T (p.Gln1152Ter) rs1064795228
NM_000038.6(APC):c.3458A>G (p.His1153Arg) rs1554085017
NM_000038.6(APC):c.3462_3464AGA[2] (p.Glu1157del) rs386833391
NM_000038.6(APC):c.3462_3464AGA[4] (p.Glu1157dup) rs386833391
NM_000038.6(APC):c.3463G>A (p.Glu1155Lys) rs774847322
NM_000038.6(APC):c.3463_3467del (p.Glu1155fs) rs1114167589
NM_000038.6(APC):c.3465A>G (p.Glu1155=) rs1554085027
NM_000038.6(APC):c.3467_3470del (p.Glu1156fs) rs1554085029
NM_000038.6(APC):c.3468A>G (p.Glu1156=) rs878853440
NM_000038.6(APC):c.3469G>C (p.Glu1157Gln) rs1554085038
NM_000038.6(APC):c.3469_3470GA[1] (p.Glu1157fs) rs786203020
NM_000038.6(APC):c.3469_3470GA[2] (p.Arg1158fs) rs786203020
NM_000038.6(APC):c.3469_3470GA[4] (p.Pro1159fs) rs786203020
NM_000038.6(APC):c.346G>T (p.Gly116Cys) rs142637152
NM_000038.6(APC):c.346_359del (p.Gly116fs) rs1554069805
NM_000038.6(APC):c.3471G>A (p.Glu1157=) rs143927847
NM_000038.6(APC):c.3472A>T (p.Arg1158Ter) rs587779790
NM_000038.6(APC):c.3473_3474insGA (p.Pro1159fs) rs730881272
NM_000038.6(APC):c.3476C>A (p.Pro1159Gln) rs1554085046
NM_000038.6(APC):c.3476C>G (p.Pro1159Arg) rs1554085046
NM_000038.6(APC):c.3478A>G (p.Thr1160Ala) rs750054763
NM_000038.6(APC):c.3479C>A (p.Thr1160Lys) rs201004111
NM_000038.6(APC):c.3479C>T (p.Thr1160Ile) rs201004111
NM_000038.6(APC):c.347G>A (p.Gly116Asp) rs369999291
NM_000038.6(APC):c.3484T>C (p.Tyr1162His)
NM_000038.6(APC):c.3484T>G (p.Tyr1162Asp) rs1210397302
NM_000038.6(APC):c.3484_3485TA[1] (p.Tyr1162_Ser1163delinsTer) rs786202348
NM_000038.6(APC):c.3485A>G (p.Tyr1162Cys) rs1289027772
NM_000038.6(APC):c.3488_3492del (p.Ser1163fs) rs1561585111
NM_000038.6(APC):c.3490A>G (p.Ile1164Val) rs1554085052
NM_000038.6(APC):c.3494A>T (p.Lys1165Ile) rs765887499
NM_000038.6(APC):c.3497_3501del (p.Lys1165_Tyr1166insTer) rs1554085053
NM_000038.6(APC):c.3499_3501del (p.Asn1167del) rs879254285
NM_000038.6(APC):c.3501T>C (p.Asn1167=) rs1561585194
NM_000038.6(APC):c.3504_3506del (p.Glu1169del) rs750693695
NM_000038.6(APC):c.3506A>C (p.Glu1169Ala) rs1554085069
NM_000038.6(APC):c.3506A>G (p.Glu1169Gly) rs1554085069
NM_000038.6(APC):c.3507G>A (p.Glu1169=) rs1561585269
NM_000038.6(APC):c.3509A>G (p.Lys1170Arg) rs753325428
NM_000038.6(APC):c.350C>A (p.Ser117Ter) rs1064793535
NM_000038.6(APC):c.3510A>G (p.Lys1170=) rs786203746
NM_000038.6(APC):c.3511C>T (p.Arg1171Cys) rs201830995
NM_000038.6(APC):c.3512G>A (p.Arg1171His) rs372481703
NM_000038.6(APC):c.3523C>T (p.Gln1175Ter) rs1554085081
NM_000038.6(APC):c.3526C>T (p.Pro1176Ser) rs1554085083
NM_000038.6(APC):c.3527del (p.Pro1176fs) rs1554085084
NM_000038.6(APC):c.3529A>G (p.Ile1177Val) rs369834416
NM_000038.6(APC):c.3534T>C (p.Asp1178=) rs1554085088
NM_000038.6(APC):c.3535T>A (p.Tyr1179Asn) rs751249843
NM_000038.6(APC):c.3535T>C (p.Tyr1179His) rs751249843
NM_000038.6(APC):c.3535T>G (p.Tyr1179Asp) rs751249843
NM_000038.6(APC):c.3535dup (p.Tyr1179fs) rs863225343
NM_000038.6(APC):c.3536A>G (p.Tyr1179Cys) rs777568434
NM_000038.6(APC):c.3537T>C (p.Tyr1179=) rs1384420589
NM_000038.6(APC):c.3542T>A (p.Leu1181Ter) rs1554085102
NM_000038.6(APC):c.3543A>G (p.Leu1181=) rs746082418
NM_000038.6(APC):c.3546A>C (p.Lys1182Asn) rs769950725
NM_000038.6(APC):c.3548A>G (p.Tyr1183Cys) rs587782689
NM_000038.6(APC):c.3549T>G (p.Tyr1183Ter) rs1561585641
NM_000038.6(APC):c.3552C>T (p.Ala1184=) rs759407858
NM_000038.6(APC):c.3554C>T (p.Thr1185Ile) rs587780595
NM_000038.6(APC):c.3555A>G (p.Thr1185=) rs786201125
NM_000038.6(APC):c.3557A>G (p.Asp1186Gly) rs1060503280
NM_000038.6(APC):c.3557A>T (p.Asp1186Val) rs1060503280
NM_000038.6(APC):c.3559A>G (p.Ile1187Val) rs1554085107
NM_000038.6(APC):c.3560T>C (p.Ile1187Thr) rs730881246
NM_000038.6(APC):c.3562C>A (p.Pro1188Thr) rs1554085113
NM_000038.6(APC):c.3563C>T (p.Pro1188Leu) rs786203540
NM_000038.6(APC):c.3567A>G (p.Ser1189=) rs774935084
NM_000038.6(APC):c.3567dup (p.Ser1190fs) rs1554085117
NM_000038.6(APC):c.3568T>G (p.Ser1190Ala)
NM_000038.6(APC):c.3569C>A (p.Ser1190Ter) rs886039618
NM_000038.6(APC):c.3571C>T (p.Gln1191Ter) rs1114167547
NM_000038.6(APC):c.3577C>T (p.Gln1193Ter) rs1554085128
NM_000038.6(APC):c.3577_3578del (p.Gln1193fs) rs1060503326
NM_000038.6(APC):c.3578A>G (p.Gln1193Arg) rs1060503260
NM_000038.6(APC):c.3578del (p.Gln1193fs) rs1554085131
NM_000038.6(APC):c.3584T>C (p.Phe1195Ser) rs386833392
NM_000038.6(APC):c.3587C>T (p.Ser1196Leu) rs1554085141
NM_000038.6(APC):c.3589T>C (p.Phe1197Leu) rs1399846917
NM_000038.6(APC):c.358A>C (p.Arg120=) rs876659470
NM_000038.6(APC):c.358A>G (p.Arg120Gly) rs876659470
NM_000038.6(APC):c.3592T>G (p.Ser1198Ala) rs1561586013
NM_000038.6(APC):c.3593C>G (p.Ser1198Ter) rs879254089
NM_000038.6(APC):c.3595A>G (p.Lys1199Glu) rs1561586087
NM_000038.6(APC):c.3595_3596del (p.Lys1199fs) rs864622106
NM_000038.6(APC):c.3596dup (p.Ser1200fs) rs864622106
NM_000038.6(APC):c.3601T>C (p.Ser1201Pro) rs1554085162
NM_000038.6(APC):c.3602C>A (p.Ser1201Ter) rs730881247
NM_000038.6(APC):c.3602C>G (p.Ser1201Ter) rs730881247
NM_000038.6(APC):c.3604_3607del (p.Ser1202fs) rs1408646734
NM_000038.6(APC):c.3605C>G (p.Ser1202Cys)
NM_000038.6(APC):c.3606T>C (p.Ser1202=) rs864622117
NM_000038.6(APC):c.3607G>C (p.Gly1203Arg) rs1057518472
NM_000038.6(APC):c.3607G>T (p.Gly1203Ter) rs1057518472
NM_000038.6(APC):c.3608G>T (p.Gly1203Val) rs141444802
NM_000038.6(APC):c.3609A>T (p.Gly1203=) rs1554085177
NM_000038.6(APC):c.3611A>G (p.Gln1204Arg) rs1561586313
NM_000038.6(APC):c.3612A>G (p.Gln1204=) rs864622196
NM_000038.6(APC):c.3614G>A (p.Ser1205Asn) rs1338663112
NM_000038.6(APC):c.3616A>G (p.Ser1206Gly) rs901866497
NM_000038.6(APC):c.3623C>T (p.Thr1208Ile) rs752590375
NM_000038.6(APC):c.3624C>T (p.Thr1208=) rs730882125
NM_000038.6(APC):c.3625G>A (p.Glu1209Lys) rs201185479
NM_000038.6(APC):c.3628C>T (p.His1210Tyr) rs145181563
NM_000038.6(APC):c.3629A>G (p.His1210Arg) rs756346998
NM_000038.6(APC):c.3629A>T (p.His1210Leu) rs756346998
NM_000038.6(APC):c.3629_3630AT[1] (p.Met1211fs) rs1554085190
NM_000038.6(APC):c.362G>T (p.Arg121Ile) rs193049694
NM_000038.6(APC):c.3631A>G (p.Met1211Val) rs780084585
NM_000038.6(APC):c.3632T>C (p.Met1211Thr) rs575268622
NM_000038.6(APC):c.3632T>G (p.Met1211Arg) rs575268622
NM_000038.6(APC):c.3638C>T (p.Ser1213Leu) rs1554085199
NM_000038.6(APC):c.3639A>G (p.Ser1213=) rs1060504882
NM_000038.6(APC):c.3642C>A (p.Ser1214Arg) rs1554085201
NM_000038.6(APC):c.3644G>A (p.Ser1215Asn) rs587778041
NM_000038.6(APC):c.3650A>C (p.Asn1217Thr) rs138933660
NM_000038.6(APC):c.3653C>T (p.Thr1218Met) rs377640390
NM_000038.6(APC):c.3654G>A (p.Thr1218=) rs772743023
NM_000038.6(APC):c.3656C>A (p.Ser1219Tyr) rs1064793930
NM_000038.6(APC):c.3659C>T (p.Thr1220Ile) rs773617726
NM_000038.6(APC):c.365G>C (p.Gly122Ala)
NM_000038.6(APC):c.365G>T (p.Gly122Val) rs755660899
NM_000038.6(APC):c.3661C>T (p.Pro1221Ser)
NM_000038.6(APC):c.3662C>G (p.Pro1221Arg)
NM_000038.6(APC):c.3663T>C (p.Pro1221=) rs587780541
NM_000038.6(APC):c.3665C>A (p.Ser1222Ter) rs1114167614
NM_000038.6(APC):c.3666A>T (p.Ser1222=) rs1131691141
NM_000038.6(APC):c.366del (p.Phe123fs)
NM_000038.6(APC):c.3670_3671dup (p.Asn1224fs) rs1561586671
NM_000038.6(APC):c.3674C>A (p.Ala1225Asp) rs1554085218
NM_000038.6(APC):c.3674C>G (p.Ala1225Gly) rs1554085218
NM_000038.6(APC):c.3675C>G (p.Ala1225=) rs759214956
NM_000038.6(APC):c.3677A>G (p.Lys1226Arg) rs786203802
NM_000038.6(APC):c.3679A>G (p.Arg1227Gly) rs1554085225
NM_000038.6(APC):c.3682C>T (p.Gln1228Ter) rs1554085227
NM_000038.6(APC):c.3688C>T (p.Gln1230Ter) rs863225344
NM_000038.6(APC):c.3689A>G (p.Gln1230Arg) rs764706774
NM_000038.6(APC):c.3691C>G (p.Leu1231Val) rs573020080
NM_000038.6(APC):c.3691C>T (p.Leu1231Phe) rs573020080
NM_000038.6(APC):c.3693C>T (p.Leu1231=) rs1554085234
NM_000038.6(APC):c.3695A>G (p.His1232Arg) rs1554085236
NM_000038.6(APC):c.3696T>C (p.His1232=) rs1060504897
NM_000038.6(APC):c.3698C>T (p.Pro1233Leu) rs1060503331
NM_000038.6(APC):c.36A>G (p.Gln12=) rs864622288
NM_000038.6(APC):c.3700A>T (p.Ser1234Cys) rs876659366
NM_000038.6(APC):c.3701G>C (p.Ser1234Thr) rs751533193
NM_000038.6(APC):c.3704C>A (p.Ser1235Tyr) rs1554085244
NM_000038.6(APC):c.3704C>T (p.Ser1235Phe) rs1554085244
NM_000038.6(APC):c.3707_3708CA[1] (p.Gln1237fs) rs1554085246
NM_000038.6(APC):c.3708A>G (p.Ala1236=) rs864622694
NM_000038.6(APC):c.370G>A (p.Val124Ile) rs779945112
NM_000038.6(APC):c.3710A>G (p.Gln1237Arg) rs1554085251
NM_000038.6(APC):c.3711G>A (p.Gln1237=) rs756939805
NM_000038.6(APC):c.3713G>C (p.Ser1238Thr)
NM_000038.6(APC):c.3716G>A (p.Arg1239Lys) rs754067085
NM_000038.6(APC):c.3718A>G (p.Ser1240Gly) rs1554085252
NM_000038.6(APC):c.3721G>A (p.Gly1241Ser) rs1561587077
NM_000038.6(APC):c.3722G>A (p.Gly1241Asp) rs1554085255
NM_000038.6(APC):c.3724C>G (p.Gln1242Glu) rs1460397656
NM_000038.6(APC):c.3725A>G (p.Gln1242Arg) rs1554085257
NM_000038.6(APC):c.3725del (p.Gln1242fs) rs1554085258
NM_000038.6(APC):c.372A>G (p.Val124=) rs749179034
NM_000038.6(APC):c.3730C>A (p.Gln1244Lys) rs79122263
NM_000038.6(APC):c.3730C>G (p.Gln1244Glu) rs79122263
NM_000038.6(APC):c.3730C>T (p.Gln1244Ter) rs79122263
NM_000038.6(APC):c.3732A>G (p.Gln1244=) rs74380081
NM_000038.6(APC):c.3734dup (p.Ala1246fs) rs1114167595
NM_000038.6(APC):c.3739G>A (p.Ala1247Thr) rs148223181
NM_000038.6(APC):c.3743C>T (p.Thr1248Ile) rs878853441
NM_000038.6(APC):c.3744T>A (p.Thr1248=) rs1561587287
NM_000038.6(APC):c.3745T>A (p.Cys1249Ser) rs1417740204
NM_000038.6(APC):c.3749A>G (p.Lys1250Arg) rs771159136
NM_000038.6(APC):c.3749_3750del (p.Lys1250fs) rs1114167583
NM_000038.6(APC):c.3750A>G (p.Lys1250=) rs142728143
NM_000038.6(APC):c.3750A>T (p.Lys1250Asn)
NM_000038.6(APC):c.3754T>G (p.Ser1252Ala) rs1561587386
NM_000038.6(APC):c.3755C>T (p.Ser1252Phe) rs1554085281
NM_000038.6(APC):c.3757del (p.Ser1253fs) rs1114167571
NM_000038.6(APC):c.3759T>C (p.Ser1253=) rs1214264655
NM_000038.6(APC):c.3760A>G (p.Ile1254Val) rs769504783
NM_000038.6(APC):c.3761T>C (p.Ile1254Thr) rs1554085289
NM_000038.6(APC):c.3762T>C (p.Ile1254=) rs1561587458
NM_000038.6(APC):c.3765C>A (p.Asn1255Lys) rs876659957
NM_000038.6(APC):c.3766C>A (p.Gln1256Lys) rs77056664
NM_000038.6(APC):c.3766C>T (p.Gln1256Ter) rs77056664
NM_000038.6(APC):c.3768A>G (p.Gln1256=) rs1561587488
NM_000038.6(APC):c.3771A>G (p.Glu1257=) rs1554085294
NM_000038.6(APC):c.3772A>C (p.Thr1258Pro) rs774968240
NM_000038.6(APC):c.3772A>G (p.Thr1258Ala)
NM_000038.6(APC):c.3772A>T (p.Thr1258Ser)
NM_000038.6(APC):c.3774A>G (p.Thr1258=) rs542928573
NM_000038.6(APC):c.3775A>G (p.Ile1259Val)
NM_000038.6(APC):c.3775A>T (p.Ile1259Leu) rs762391822
NM_000038.6(APC):c.3780G>C (p.Gln1260His) rs763668164
NM_000038.6(APC):c.3780G>T (p.Gln1260His)
NM_000038.6(APC):c.3782C>T (p.Thr1261Ile) rs1064794636
NM_000038.6(APC):c.3782del (p.Thr1261fs) rs1561587604
NM_000038.6(APC):c.3783_3784del (p.Tyr1262fs) rs1554085303
NM_000038.6(APC):c.3785dup (p.Tyr1262Ter) rs863225345
NM_000038.6(APC):c.3786T>C (p.Tyr1262=) rs147411334
NM_000038.6(APC):c.3786T>G (p.Tyr1262Ter) rs147411334
NM_000038.6(APC):c.3786_3787del (p.Tyr1262_Cys1263delinsTer) rs1554085307
NM_000038.6(APC):c.3788G>A (p.Cys1263Tyr) rs1554085309
NM_000038.6(APC):c.3791dup (p.Glu1265fs) rs863225346
NM_000038.6(APC):c.3793_3794insCTT (p.Glu1265delinsAlaTer)
NM_000038.6(APC):c.3795A>G (p.Glu1265=) rs1554085311
NM_000038.6(APC):c.3797A>T (p.Asp1266Val)
NM_000038.6(APC):c.3798T>C (p.Asp1266=) rs1488397941
NM_000038.6(APC):c.379A>G (p.Ser127Gly) rs200089324
NM_000038.6(APC):c.3804A>G (p.Pro1268=) rs878853442
NM_000038.6(APC):c.3805_3806AT[1] (p.Ile1269fs) rs786203760
NM_000038.6(APC):c.3807A>G (p.Ile1269Met) rs876658536
NM_000038.6(APC):c.3809G>T (p.Cys1270Phe) rs750280766
NM_000038.6(APC):c.380G>A (p.Ser127Asn) rs1414642619
NM_000038.6(APC):c.3810T>A (p.Cys1270Ter) rs863225347
NM_000038.6(APC):c.3811T>C (p.Phe1271Leu)
NM_000038.6(APC):c.3814del (p.Ser1272fs) rs587783033
NM_000038.6(APC):c.3815C>G (p.Ser1272Ter) rs863225348
NM_000038.6(APC):c.3821G>A (p.Cys1274Tyr)
NM_000038.6(APC):c.3822T>C (p.Cys1274=) rs1554085326
NM_000038.6(APC):c.3824G>C (p.Ser1275Thr) rs587781637
NM_000038.6(APC):c.3827C>A (p.Ser1276Ter) rs1060503299
NM_000038.6(APC):c.3827C>G (p.Ser1276Ter) rs1060503299
NM_000038.6(APC):c.3827_3829delinsA (p.Ser1276fs) rs1554085335
NM_000038.6(APC):c.3830T>G (p.Leu1277Ter) rs786204169
NM_000038.6(APC):c.3837T>G (p.Ser1279=) rs1057522493
NM_000038.6(APC):c.3837_3845dup (p.1277_1279LSS[3]) rs1561587936
NM_000038.6(APC):c.3838T>G (p.Leu1280Val) rs1554085343
NM_000038.6(APC):c.3847G>A (p.Ala1283Thr) rs1428789824
NM_000038.6(APC):c.3847G>C (p.Ala1283Pro) rs1428789824
NM_000038.6(APC):c.384A>G (p.Arg128=) rs876659284
NM_000038.6(APC):c.3853G>A (p.Asp1285Asn) rs1554085350
NM_000038.6(APC):c.3854_3855dup (p.Glu1286fs) rs1561588017
NM_000038.6(APC):c.385G>C (p.Glu129Gln) rs376628500
NM_000038.6(APC):c.3860T>C (p.Ile1287Thr) rs876660170
NM_000038.6(APC):c.3860_3872dup (p.Gln1291delinsHisArgMetTer)
NM_000038.6(APC):c.3867T>A (p.Cys1289Ter) rs1554085355
NM_000038.6(APC):c.3868A>G (p.Asn1290Asp) rs752977559
NM_000038.6(APC):c.3869A>C (p.Asn1290Thr) rs1554085358
NM_000038.6(APC):c.386A>G (p.Glu129Gly)
NM_000038.6(APC):c.386_387insT (p.Glu129fs) rs1554069831
NM_000038.6(APC):c.3871C>T (p.Gln1291Ter) rs1561588104
NM_000038.6(APC):c.3873_3875GAC[1] (p.Thr1293del) rs1554085362
NM_000038.6(APC):c.3875C>T (p.Thr1292Met) rs371113837
NM_000038.6(APC):c.3876G>A (p.Thr1292=) rs377494451
NM_000038.6(APC):c.3877dup (p.Thr1293fs)
NM_000038.6(APC):c.387A>G (p.Glu129=) rs1554069832
NM_000038.6(APC):c.3880C>T (p.Gln1294Ter) rs1554085373
NM_000038.6(APC):c.3881A>C (p.Gln1294Pro) rs1561588178
NM_000038.6(APC):c.3882G>T (p.Gln1294His) rs1457219504
NM_000038.6(APC):c.3887C>T (p.Ala1296Val) rs1291513037
NM_000038.6(APC):c.388A>G (p.Ser130Gly) rs150973053
NM_000038.6(APC):c.388del (p.Ser130fs) rs1554069828
NM_000038.6(APC):c.3891T>G (p.Asp1297Glu)
NM_000038.6(APC):c.3892T>A (p.Ser1298Thr) rs1060503316
NM_000038.6(APC):c.3897T>A (p.Ala1299=) rs1057521474
NM_000038.6(APC):c.3898A>G (p.Asn1300Asp) rs1554085380
NM_000038.6(APC):c.3901A>G (p.Thr1301Ala) rs587780596
NM_000038.6(APC):c.3901dup (p.Thr1301fs) rs1554085382
NM_000038.6(APC):c.3904del (p.Leu1302fs) rs1064794042
NM_000038.6(APC):c.3906G>A (p.Leu1302=) rs756366532
NM_000038.6(APC):c.3909A>G (p.Gln1303=) rs746289994
NM_000038.6(APC):c.390T>C (p.Ser130=) rs1561464982
NM_000038.6(APC):c.3910A>G (p.Ile1304Val) rs770157475
NM_000038.6(APC):c.3911T>C (p.Ile1304Thr) rs1561588370
NM_000038.6(APC):c.3912A>G (p.Ile1304Met) rs1064795120
NM_000038.6(APC):c.3914C>G (p.Ala1305Gly) rs1554085389
NM_000038.6(APC):c.3916G>T (p.Glu1306Ter) rs121913462
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.3920_3924del (p.Ile1307fs) rs1064794229
NM_000038.6(APC):c.3921_3924del (p.Ile1307fs) rs863224457
NM_000038.6(APC):c.3922_3926AAAGA[1] (p.Glu1309fs) rs121913224
NM_000038.6(APC):c.3925G>A (p.Glu1309Lys) rs1321583762
NM_000038.6(APC):c.3925_3928del (p.Glu1309fs) rs876659647
NM_000038.6(APC):c.3926A>C (p.Glu1309Ala)
NM_000038.6(APC):c.3926A>G (p.Glu1309Gly) rs775060363
NM_000038.6(APC):c.3928_3938del (p.Glu1309_Lys1310insTer) rs1057519843
NM_000038.6(APC):c.3928_3947del (p.Glu1309_Lys1310insTer) rs1057519844
NM_000038.6(APC):c.392C>G (p.Thr131Ser) rs1387998721
NM_000038.6(APC):c.3932T>C (p.Ile1311Thr) rs876659190
NM_000038.6(APC):c.3932T>G (p.Ile1311Ser) rs876659190
NM_000038.6(APC):c.3933T>C (p.Ile1311=) rs201706728
NM_000038.6(APC):c.3935G>C (p.Gly1312Ala) rs587779791
NM_000038.6(APC):c.3935del (p.Gly1312fs)
NM_000038.6(APC):c.3937A>G (p.Thr1313Ala) rs863225349
NM_000038.6(APC):c.3939T>C (p.Thr1313=) rs1561588697
NM_000038.6(APC):c.3939_3940dup (p.Arg1314fs) rs863225350
NM_000038.6(APC):c.393T>C (p.Thr131=) rs775742850
NM_000038.6(APC):c.3943T>A (p.Ser1315Thr)
NM_000038.6(APC):c.3943T>C (p.Ser1315Pro) rs773963355
NM_000038.6(APC):c.3948T>C (p.Ala1316=) rs943596772
NM_000038.6(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.6(APC):c.3956del (p.Pro1319fs) rs1057517558
NM_000038.6(APC):c.3958G>A (p.Val1320Met)
NM_000038.6(APC):c.3959T>A (p.Val1320Glu) rs760485028
NM_000038.6(APC):c.3962G>A (p.Ser1321Asn) rs1554085421
NM_000038.6(APC):c.3963C>T (p.Ser1321=) rs150595875
NM_000038.6(APC):c.3964G>A (p.Glu1322Lys) rs752926571
NM_000038.6(APC):c.3969T>A (p.Val1323=) rs1465937926
NM_000038.6(APC):c.396A>C (p.Gly132=) rs1060504884
NM_000038.6(APC):c.3970C>G (p.Pro1324Ala) rs587779792
NM_000038.6(APC):c.3970C>T (p.Pro1324Ser) rs587779792
NM_000038.6(APC):c.397T>G (p.Tyr133Asp) rs763487503
NM_000038.6(APC):c.3980C>G (p.Ser1327Ter) rs1554085429
NM_000038.6(APC):c.3980C>T (p.Ser1327Leu) rs1554085429
NM_000038.6(APC):c.3981A>T (p.Ser1327=) rs1554085433
NM_000038.6(APC):c.3982C>T (p.Gln1328Ter) rs398123121
NM_000038.6(APC):c.3984G>A (p.Gln1328=) rs1561588983
NM_000038.6(APC):c.398A>G (p.Tyr133Cys) rs1561465075
NM_000038.6(APC):c.3990T>A (p.Pro1330=) rs758667746
NM_000038.6(APC):c.3994dup (p.Thr1332fs) rs1114167544
NM_000038.6(APC):c.4001C>G (p.Ser1334Cys) rs764056593
NM_000038.6(APC):c.4003A>G (p.Ser1335Gly) rs1554085442
NM_000038.6(APC):c.4005C>T (p.Ser1335=) rs751729992
NM_000038.6(APC):c.4006A>G (p.Arg1336Gly)
NM_000038.6(APC):c.4006A>T (p.Arg1336Ter)
NM_000038.6(APC):c.4009C>A (p.Leu1337Met) rs1554085448
NM_000038.6(APC):c.4009_4010dup (p.Gln1338fs) rs1554085450
NM_000038.6(APC):c.4010_4013dup (p.Gln1338fs) rs1131691256
NM_000038.6(APC):c.4012C>T (p.Gln1338Ter) rs121913327
NM_000038.6(APC):c.4013A>G (p.Gln1338Arg) rs757693603
NM_000038.6(APC):c.4015G>A (p.Gly1339Ser) rs876658310
NM_000038.6(APC):c.4015G>C (p.Gly1339Arg) rs876658310
NM_000038.6(APC):c.4015G>T (p.Gly1339Cys)
NM_000038.6(APC):c.4016G>A (p.Gly1339Asp) rs781621926
NM_000038.6(APC):c.4017T>A (p.Gly1339=) rs1554085461
NM_000038.6(APC):c.4017T>C (p.Gly1339=) rs1554085461
NM_000038.6(APC):c.4018_4020dup (p.Ser1341dup) rs864622376
NM_000038.6(APC):c.4019C>G (p.Ser1340Cys) rs1280622194
NM_000038.6(APC):c.4020T>C (p.Ser1340=) rs746379898
NM_000038.6(APC):c.4025T>G (p.Leu1342Ter)
NM_000038.6(APC):c.4025dup (p.Leu1342fs) rs863225351
NM_000038.6(APC):c.4029T>A (p.Ser1343=) rs1114167618
NM_000038.6(APC):c.4031C>G (p.Ser1344Ter) rs1114167578
NM_000038.6(APC):c.4033G>T (p.Glu1345Ter) rs1211642532
NM_000038.6(APC):c.4035A>G (p.Glu1345=) rs1060504886
NM_000038.6(APC):c.4038A>C (p.Ser1346=) rs1554085473
NM_000038.6(APC):c.4039G>C (p.Ala1347Pro) rs1561589368
NM_000038.6(APC):c.4042A>G (p.Arg1348Gly) rs1561589381
NM_000038.6(APC):c.4043G>C (p.Arg1348Thr) rs876658599
NM_000038.6(APC):c.4046A>G (p.His1349Arg)
NM_000038.6(APC):c.4047C>G (p.His1349Gln) rs1561589419
NM_000038.6(APC):c.4053T>C (p.Ala1351=) rs773727399
NM_000038.6(APC):c.4054_4063del (p.Val1352fs) rs1561589459
NM_000038.6(APC):c.4054del (p.Val1352fs) rs1114167566
NM_000038.6(APC):c.4055T>C (p.Val1352Ala) rs528724202
NM_000038.6(APC):c.4057G>T (p.Glu1353Ter) rs1114167568
NM_000038.6(APC):c.4059_4060insG (p.Phe1354fs) rs1064795861
NM_000038.6(APC):c.405A>G (p.Glu135=) rs1554069842
NM_000038.6(APC):c.4060delinsAA (p.Phe1354fs) rs1554085479
NM_000038.6(APC):c.4063T>C (p.Ser1355Pro) rs730881248
NM_000038.6(APC):c.4067C>G (p.Ser1356Ter) rs1554085480
NM_000038.6(APC):c.4069G>A (p.Gly1357Arg) rs771718185
NM_000038.6(APC):c.4070G>A (p.Gly1357Glu) rs1561589588
NM_000038.6(APC):c.4072G>A (p.Ala1358Thr) rs139618756
NM_000038.6(APC):c.4073C>T (p.Ala1358Val) rs730881249
NM_000038.6(APC):c.4074G>A (p.Ala1358=) rs149782464
NM_000038.6(APC):c.4074G>T (p.Ala1358=) rs149782464
NM_000038.6(APC):c.4075A>T (p.Lys1359Ter) rs863225352
NM_000038.6(APC):c.4076A>G (p.Lys1359Arg)
NM_000038.6(APC):c.4082C>T (p.Pro1361Leu) rs1060503264
NM_000038.6(APC):c.4086C>G (p.Ser1362=) rs763053012
NM_000038.6(APC):c.4088A>G (p.Lys1363Arg) rs373607243
NM_000038.6(APC):c.4088A>T (p.Lys1363Ile) rs373607243
NM_000038.6(APC):c.4091G>A (p.Ser1364Asn)
NM_000038.6(APC):c.4091_4093GTG[1] (p.Gly1365del)
NM_000038.6(APC):c.4094G>A (p.Gly1365Asp) rs1554085511
NM_000038.6(APC):c.4096G>T (p.Ala1366Ser)
NM_000038.6(APC):c.4097C>T (p.Ala1366Val) rs1561589807
NM_000038.6(APC):c.4099C>T (p.Gln1367Ter) rs121913328
NM_000038.6(APC):c.4100A>G (p.Gln1367Arg) rs1399790840
NM_000038.6(APC):c.4100A>T (p.Gln1367Leu) rs1399790840
NM_000038.6(APC):c.4101G>C (p.Gln1367His) rs761886683
NM_000038.6(APC):c.4109A>C (p.Lys1370Thr) rs1365778107
NM_000038.6(APC):c.4109A>G (p.Lys1370Arg) rs1365778107
NM_000038.6(APC):c.4110A>T (p.Lys1370Asn) rs876660867
NM_000038.6(APC):c.4114C>A (p.Pro1372Thr)
NM_000038.6(APC):c.4119T>A (p.Pro1373=) rs1248565162
NM_000038.6(APC):c.4119T>G (p.Pro1373=) rs1248565162
NM_000038.6(APC):c.4120G>A (p.Glu1374Lys) rs876659156
NM_000038.6(APC):c.4124A>C (p.His1375Pro)
NM_000038.6(APC):c.4124A>G (p.His1375Arg) rs750884499
NM_000038.6(APC):c.4125C>G (p.His1375Gln)
NM_000038.6(APC):c.4125C>T (p.His1375=) rs1060504880
NM_000038.6(APC):c.4127A>G (p.Tyr1376Cys) rs756664931
NM_000038.6(APC):c.4127_4128del (p.Tyr1376fs) rs1554085533
NM_000038.6(APC):c.4128T>C (p.Tyr1376=) rs1554085539
NM_000038.6(APC):c.4132C>T (p.Gln1378Ter) rs121913329
NM_000038.6(APC):c.4134G>A (p.Gln1378=) rs780368623
NM_000038.6(APC):c.4135G>T (p.Glu1379Ter) rs121913326
NM_000038.6(APC):c.4136A>G (p.Glu1379Gly) rs1561590131
NM_000038.6(APC):c.4139C>T (p.Thr1380Ile) rs876660713
NM_000038.6(APC):c.4141C>A (p.Pro1381Thr) rs730881250
NM_000038.6(APC):c.4141C>G (p.Pro1381Ala)
NM_000038.6(APC):c.4141_4142insGGTC (p.Pro1381fs) rs1554085560
NM_000038.6(APC):c.4143A>C (p.Pro1381=) rs778565823
NM_000038.6(APC):c.4146C>G (p.Leu1382=) rs876658384
NM_000038.6(APC):c.4147A>G (p.Met1383Val) rs1064793836
NM_000038.6(APC):c.414G>A (p.Glu138=) rs1554069845
NM_000038.6(APC):c.4155C>T (p.Ser1385=) rs1554085568
NM_000038.6(APC):c.4160G>A (p.Cys1387Tyr) rs786201834
NM_000038.6(APC):c.4162A>T (p.Thr1388Ser)
NM_000038.6(APC):c.4164T>G (p.Thr1388=) rs878853443
NM_000038.6(APC):c.4166del (p.Ser1389fs) rs863225353
NM_000038.6(APC):c.4167T>C (p.Ser1389=) rs747757364
NM_000038.6(APC):c.4167del (p.Val1390fs) rs1561590380
NM_000038.6(APC):c.4167dup (p.Val1390fs) rs1131691146
NM_000038.6(APC):c.4170C>T (p.Val1390=) rs876659338
NM_000038.6(APC):c.4171A>G (p.Ser1391Gly) rs587781885
NM_000038.6(APC):c.4175C>A (p.Ser1392Ter) rs786204170
NM_000038.6(APC):c.417A>G (p.Lys139=) rs1554069848
NM_000038.6(APC):c.417_418AG[2] (p.Arg141fs) rs1554069850
NM_000038.6(APC):c.4181A>G (p.Asp1394Gly)
NM_000038.6(APC):c.4183A>T (p.Ser1395Cys) rs137854578
NM_000038.6(APC):c.4185T>C (p.Ser1395=) rs1561590472
NM_000038.6(APC):c.4188T>A (p.Phe1396Leu) rs1554085596
NM_000038.6(APC):c.4193G>A (p.Ser1398Asn) rs1561590497
NM_000038.6(APC):c.4198T>C (p.Ser1400Pro) rs1561590556
NM_000038.6(APC):c.4199C>T (p.Ser1400Leu) rs267600319
NM_000038.6(APC):c.4200G>A (p.Ser1400=) rs367782881
NM_000038.6(APC):c.4200G>C (p.Ser1400=) rs367782881
NM_000038.6(APC):c.4201A>G (p.Ile1401Val) rs1554085612
NM_000038.6(APC):c.4207A>G (p.Ser1403Gly) rs759317924
NM_000038.6(APC):c.4209C>T (p.Ser1403=) rs1554085619
NM_000038.6(APC):c.420G>C (p.Glu140Asp) rs202161017
NM_000038.6(APC):c.4212C>A (p.Ser1404=) rs144655979
NM_000038.6(APC):c.4212C>T (p.Ser1404=) rs144655979
NM_000038.6(APC):c.4213G>A (p.Val1405Ile) rs761966904
NM_000038.6(APC):c.4216C>G (p.Gln1406Glu) rs587782518
NM_000038.6(APC):c.4216C>T (p.Gln1406Ter) rs587782518
NM_000038.6(APC):c.4217A>G (p.Gln1406Arg) rs372241082
NM_000038.6(APC):c.421A>C (p.Arg141=)
NM_000038.6(APC):c.422+1015G>T rs79520514
NM_000038.6(APC):c.422+1016A>C rs77664494
NM_000038.6(APC):c.422+1096C>A rs75166185
NM_000038.6(APC):c.422+10C>T rs899376835
NM_000038.6(APC):c.422+1113T>A rs78572209
NM_000038.6(APC):c.422+1210A>G rs35414976
NM_000038.6(APC):c.422+1477A>G rs75734746
NM_000038.6(APC):c.422+148T>C
NM_000038.6(APC):c.422+1575T>G rs79896273
NM_000038.6(APC):c.422+1584T>C rs76318041
NM_000038.6(APC):c.422+1672T>G rs77262082
NM_000038.6(APC):c.422+16A>G rs751855793
NM_000038.6(APC):c.422+16A>T rs751855793
NM_000038.6(APC):c.422+17T>C rs1554069858
NM_000038.6(APC):c.422+1806A>C rs75110922
NM_000038.6(APC):c.422+1942T>G rs74789138
NM_000038.6(APC):c.422+19G>C rs767046355
NM_000038.6(APC):c.422+2121T>G rs77010277
NM_000038.6(APC):c.422+2131G>T rs62364016
NM_000038.6(APC):c.422+2136A>T rs77552656
NM_000038.6(APC):c.422+2447G>A rs75372333
NM_000038.6(APC):c.422+2773C>T rs548786690
NM_000038.6(APC):c.422+2T>C rs879254169
NM_000038.6(APC):c.422+2T>G rs879254169
NM_000038.6(APC):c.422+3192G>T rs76617755
NM_000038.6(APC):c.422+3533G>T rs78837782
NM_000038.6(APC):c.422+365C>A rs75602292
NM_000038.6(APC):c.422+3687G>C rs77732176
NM_000038.6(APC):c.422+3971G>A rs11241185
NM_000038.6(APC):c.422+3986T>G rs80156934
NM_000038.6(APC):c.422+3997C>A rs6876867
NM_000038.6(APC):c.422+3A>G rs1561465237
NM_000038.6(APC):c.422+655T>C rs75297307
NM_000038.6(APC):c.422+6T>C rs864622442
NM_000038.6(APC):c.422+75T>C rs112114081
NM_000038.6(APC):c.422+876C>G rs2546117
NM_000038.6(APC):c.422+919T>C rs77088725
NM_000038.6(APC):c.422+974A>C rs78035234
NM_000038.6(APC):c.422+975A>C rs78594849
NM_000038.6(APC):c.4222G>A (p.Glu1408Lys) rs1554085632
NM_000038.6(APC):c.4225C>A (p.Pro1409Thr) rs1554085637
NM_000038.6(APC):c.4228T>G (p.Cys1410Gly) rs1561590765
NM_000038.6(APC):c.423-1323A>G rs79801520
NM_000038.6(APC):c.423-1511C>A rs79435359
NM_000038.6(APC):c.423-1514T>A rs78800922
NM_000038.6(APC):c.423-1515A>G rs76748553
NM_000038.6(APC):c.423-1547G>C rs1816769
NM_000038.6(APC):c.423-16A>T rs78919815
NM_000038.6(APC):c.423-17T>A rs534684461
NM_000038.6(APC):c.423-1G>A rs397514031
NM_000038.6(APC):c.423-1G>C rs397514031
NM_000038.6(APC):c.423-2361C>A rs79736637
NM_000038.6(APC):c.423-2364T>A rs75582423
NM_000038.6(APC):c.423-2365T>C rs80351787
NM_000038.6(APC):c.423-2396C>A rs75837523
NM_000038.6(APC):c.423-2461T>C rs2707763
NM_000038.6(APC):c.423-256G>A rs392179
NM_000038.6(APC):c.423-2650G>T rs76488927
NM_000038.6(APC):c.423-2719G>T rs77986923
NM_000038.6(APC):c.423-2829A>C rs79915536
NM_000038.6(APC):c.423-28G>T rs570467572
NM_000038.6(APC):c.423-2A>T rs879254087
NM_000038.6(APC):c.423-3029T>C rs75558943
NM_000038.6(APC):c.423-3162A>C rs78112535
NM_000038.6(APC):c.423-3166C>A rs77023098
NM_000038.6(APC):c.423-3167T>A rs78042804
NM_000038.6(APC):c.423-3178T>C rs77756384
NM_000038.6(APC):c.423-3307C>A rs78349576
NM_000038.6(APC):c.423-3313C>A rs78426873
NM_000038.6(APC):c.423-3600C>T rs2439589
NM_000038.6(APC):c.423-3T>A rs587782293
NM_000038.6(APC):c.423-3T>C rs587782293
NM_000038.6(APC):c.423-3_423-2del rs863225354
NM_000038.6(APC):c.423-454G>T rs79829853
NM_000038.6(APC):c.423-455G>T rs75999963
NM_000038.6(APC):c.423-4A>G rs1561477594
NM_000038.6(APC):c.423-4del rs730881230
NM_000038.6(APC):c.423-5_423-3del rs876657408
NM_000038.6(APC):c.423-666G>A rs74639338
NM_000038.6(APC):c.423-677C>T rs77633852
NM_000038.6(APC):c.423-680G>A rs79045800
NM_000038.6(APC):c.423-686G>T rs77983750
NM_000038.6(APC):c.423-690C>G rs76881115
NM_000038.6(APC):c.423-909A>C rs78509108
NM_000038.6(APC):c.423-912T>C