ClinVar Miner

List of variants in gene ARID1B reported as likely benign for History of neurodevelopmental disorder

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 84
Download table as spreadsheet
HGVS dbSNP
NM_020732.3(ARID1B):c.1016_1021dup (p.Val339_Ala340dup) rs759630370
NM_020732.3(ARID1B):c.1017_1019GGC[6] (p.Ala349_Ala350dup) rs765410747
NM_020732.3(ARID1B):c.1029_1040del (p.Ala347_Ala350del) rs763063242
NM_020732.3(ARID1B):c.1032_1034GGC[5] (p.Ala350dup) rs764418312
NM_020732.3(ARID1B):c.103_105TCC[8] (p.Ser41dup) rs770512547
NM_020732.3(ARID1B):c.1041_1046dup (p.Ala349_Ala350dup) rs1562377904
NM_020732.3(ARID1B):c.1043_1045CAG[4] (p.Ala350dup) rs797045267
NM_020732.3(ARID1B):c.1043_1045CAG[5] (p.Ala349_Ala350dup) rs797045267
NM_020732.3(ARID1B):c.1054_1056GGC[5] (p.Gly357del) rs797045268
NM_020732.3(ARID1B):c.1054_1056GGC[7] (p.Gly357dup) rs797045268
NM_020732.3(ARID1B):c.1088C>T (p.Ala363Val)
NM_020732.3(ARID1B):c.1102C>T (p.Leu368=) rs1562378059
NM_020732.3(ARID1B):c.1329C>T (p.Pro443=)
NM_020732.3(ARID1B):c.132A>G (p.Ala44=) rs1157661615
NM_020732.3(ARID1B):c.1370_1372CGG[3] (p.Ala460del) rs757953295
NM_020732.3(ARID1B):c.1385_1387CGG[4] (p.Ala464dup) rs1367431735
NM_020732.3(ARID1B):c.1632G>A (p.Pro544=)
NM_020732.3(ARID1B):c.1714G>A (p.Gly572Arg)
NM_020732.3(ARID1B):c.17_25dup (p.Gly6_Ala8dup) rs777784233
NM_020732.3(ARID1B):c.1920G>A (p.Pro640=)
NM_020732.3(ARID1B):c.1977C>T (p.Pro659=) rs146240413
NM_020732.3(ARID1B):c.2070G>A (p.Thr690=)
NM_020732.3(ARID1B):c.2444C>T (p.Ser815Leu) rs150140314
NM_020732.3(ARID1B):c.252_254CCA[4] (p.His89del) rs752012879
NM_020732.3(ARID1B):c.257_277ACCACCACCATGCCCACCACC[1] (p.86_92HHHHAHH[1]) rs767952510
NM_020732.3(ARID1B):c.270_272CCA[5] (p.His96del) rs754114025
NM_020732.3(ARID1B):c.2862G>C (p.Ala954=)
NM_020732.3(ARID1B):c.2895C>T (p.Pro965=) rs144894118
NM_020732.3(ARID1B):c.2976G>T (p.Thr992=)
NM_020732.3(ARID1B):c.303C>T (p.His101=) rs1562375469
NM_020732.3(ARID1B):c.3120C>T (p.Pro1040=)
NM_020732.3(ARID1B):c.3312C>T (p.Tyr1104=) rs61736269
NM_020732.3(ARID1B):c.3399C>T (p.Thr1133=) rs142391292
NM_020732.3(ARID1B):c.339_365del (p.Phe113_Gln122delinsLeu) rs1321302086
NM_020732.3(ARID1B):c.342_344GCA[5] (p.Gln130_Gln131del) rs587779743
NM_020732.3(ARID1B):c.342_344GCA[8] (p.Gln131dup) rs587779743
NM_020732.3(ARID1B):c.342_344GCA[9] (p.Gln130_Gln131dup) rs587779743
NM_020732.3(ARID1B):c.345_368GCAGCAGCAGCAGCAGCAACAGCA[3] (p.Gln124_Gln131dup) rs770869529
NM_020732.3(ARID1B):c.360_386del (p.Gln123_Gln131del) rs910569810
NM_020732.3(ARID1B):c.3628C>G (p.Leu1210Val)
NM_020732.3(ARID1B):c.363_380del (p.Gln126_Gln131del) rs768349133
NM_020732.3(ARID1B):c.366_368GCA[10] (p.Gln129_Gln131dup) rs587779744
NM_020732.3(ARID1B):c.366_368GCA[11] (p.Gln128_Gln131dup) rs587779744
NM_020732.3(ARID1B):c.366_368GCA[5] (p.Gln130_Gln131del) rs587779744
NM_020732.3(ARID1B):c.366_368GCA[9] (p.Gln130_Gln131dup) rs587779744
NM_020732.3(ARID1B):c.3771C>T (p.Asn1257=)
NM_020732.3(ARID1B):c.3891G>C (p.Thr1297=)
NM_020732.3(ARID1B):c.4071G>A (p.Pro1357=)
NM_020732.3(ARID1B):c.417C>T (p.Ser139=) rs1229372337
NM_020732.3(ARID1B):c.4294A>G (p.Met1432Val)
NM_020732.3(ARID1B):c.4305G>A (p.Pro1435=)
NM_020732.3(ARID1B):c.4659G>A (p.Ala1553=)
NM_020732.3(ARID1B):c.4671G>A (p.Ala1557=)
NM_020732.3(ARID1B):c.5015A>G (p.Asn1672Ser) rs140177120
NM_020732.3(ARID1B):c.5289C>T (p.Ile1763=)
NM_020732.3(ARID1B):c.5307C>T (p.Asp1769=)
NM_020732.3(ARID1B):c.5310C>T (p.Ala1770=)
NM_020732.3(ARID1B):c.5546C>G (p.Pro1849Arg)
NM_020732.3(ARID1B):c.55G>C (p.Gly19Arg) rs1465331796
NM_020732.3(ARID1B):c.5607A>G (p.Gln1869=) rs1303216691
NM_020732.3(ARID1B):c.5694C>T (p.Thr1898=) rs376113162
NM_020732.3(ARID1B):c.5802C>T (p.Ile1934=) rs142499766
NM_020732.3(ARID1B):c.6072G>A (p.Thr2024=)
NM_020732.3(ARID1B):c.6090C>T (p.Asn2030=)
NM_020732.3(ARID1B):c.6294G>C (p.Leu2098=) rs1562354325
NM_020732.3(ARID1B):c.6342A>G (p.Thr2114=)
NM_020732.3(ARID1B):c.6594G>A (p.Ala2198=) rs754242891
NM_020732.3(ARID1B):c.6654C>T (p.His2218=) rs183572405
NM_020732.3(ARID1B):c.679_680delinsCC (p.Val227Pro) rs1554247605
NM_020732.3(ARID1B):c.69G>A (p.Ala23=) rs533182720
NM_020732.3(ARID1B):c.705C>T (p.Gly235=) rs745740327
NM_020732.3(ARID1B):c.714C>T (p.Ala238=) rs533517668
NM_020732.3(ARID1B):c.921_923CGG[10] (p.Gly318_Gly319dup) rs587779747
NM_020732.3(ARID1B):c.921_923CGG[5] (p.Gly317_Gly319del) rs587779747
NM_020732.3(ARID1B):c.921_923CGG[6] (p.Gly318_Gly319del) rs587779747
NM_020732.3(ARID1B):c.921_923CGG[7] (p.Gly319del) rs587779747
NM_020732.3(ARID1B):c.941_942insAGG (p.Gly319dup) rs1562377373
NM_020732.3(ARID1B):c.945A>C (p.Gly315=) rs112474841
NM_020732.3(ARID1B):c.945_947AGG[5] (p.Gly319dup) rs587779748
NM_020732.3(ARID1B):c.962_964GAG[10] (p.Gly327_Gly328dup) rs747790383
NM_020732.3(ARID1B):c.962_964GAG[11] (p.Gly326_Gly328dup) rs747790383
NM_020732.3(ARID1B):c.962_964GAG[9] (p.Gly328dup) rs747790383
NM_020732.3(ARID1B):c.986_991CAGGAG[3] (p.329_330AG[3]) rs747438636
NM_020732.3(ARID1B):c.996_1001AGGAGC[3] (p.333_334GA[4]) rs1323804393

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.