ClinVar Miner

List of variants in gene ARID1B

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 430
Download table as spreadsheet
HGVS dbSNP
GRCh37/hg19 6q25.3(chr6:157119943-157519050)x3
GRCh37/hg19 6q25.3(chr6:157133792-157495187)
GRCh37/hg19 6q25.3(chr6:157431664-157482864)x1
GRCh37/hg19 6q25.3(chr6:157455905-157468896)x0
GRCh38/hg38 6q25.3(chr6:156965417-157093452)x1
GRCh38/hg38 6q25.3(chr6:157179172-157184916)x1
NM_017519.2(ARID1B):c.2130_2149del
NM_017519.2(ARID1B):c.2426_2427insC
NM_020732.3(ARID1B):c.-3A>G rs797045266
NM_020732.3(ARID1B):c.1016_1021dup (p.Val339_Ala340dup) rs759630370
NM_020732.3(ARID1B):c.1017_1019GGC[1] (p.Ala348_Ala350del) rs765410747
NM_020732.3(ARID1B):c.1017_1019GGC[6] (p.Ala349_Ala350dup) rs765410747
NM_020732.3(ARID1B):c.1019C>T (p.Ala340Val) rs878853084
NM_020732.3(ARID1B):c.101T>C (p.Leu34Pro) rs1057520140
NM_020732.3(ARID1B):c.1022C>T (p.Ala341Val) rs1271802085
NM_020732.3(ARID1B):c.1029_1040del (p.Ala347_Ala350del) rs763063242
NM_020732.3(ARID1B):c.1029_1043del (p.Ala346_Ala350del) rs775733700
NM_020732.3(ARID1B):c.1032_1034GGC[5] (p.Ala350dup) rs764418312
NM_020732.3(ARID1B):c.1032_1046del (p.Ala346_Ala350del) rs1457993750
NM_020732.3(ARID1B):c.103_105TCC[6] (p.Ser41del) rs770512547
NM_020732.3(ARID1B):c.103_105TCC[8] (p.Ser41dup) rs770512547
NM_020732.3(ARID1B):c.1041_1046dup (p.Ala349_Ala350dup) rs1562377904
NM_020732.3(ARID1B):c.1043_1045CAG[4] (p.Ala350dup) rs797045267
NM_020732.3(ARID1B):c.1043_1045CAG[5] (p.Ala349_Ala350dup) rs797045267
NM_020732.3(ARID1B):c.1044_1062dup (p.Gly355fs) rs943407609
NM_020732.3(ARID1B):c.1044_1071del (p.Ala349fs) rs1554247989
NM_020732.3(ARID1B):c.1054_1056GGC[4] (p.Gly356_Gly357del) rs797045268
NM_020732.3(ARID1B):c.1054_1056GGC[5] (p.Gly357del) rs797045268
NM_020732.3(ARID1B):c.1054_1056GGC[7] (p.Gly357dup) rs797045268
NM_020732.3(ARID1B):c.1079dup (p.Ser361fs) rs1289468231
NM_020732.3(ARID1B):c.1082C>T (p.Ser361Leu)
NM_020732.3(ARID1B):c.1088C>T (p.Ala363Val)
NM_020732.3(ARID1B):c.1102C>T (p.Leu368=) rs1562378059
NM_020732.3(ARID1B):c.1154G>A (p.Gly385Asp) rs1276959546
NM_020732.3(ARID1B):c.1190C>T (p.Ser397Leu) rs1235258455
NM_020732.3(ARID1B):c.1202del (p.Gly401fs) rs1554248082
NM_020732.3(ARID1B):c.120C>T (p.Ser40=) rs1281627380
NM_020732.3(ARID1B):c.1245del (p.Thr416fs) rs886041707
NM_020732.3(ARID1B):c.124_132GCGGCGGCA[1] (p.Ala45_Ala47del) rs769480864
NM_020732.3(ARID1B):c.1259del (p.Asn420fs)
NM_020732.3(ARID1B):c.1285A>G (p.Met429Val) rs199948752
NM_020732.3(ARID1B):c.1301_1341del (p.Gly434fs) rs1554248137
NM_020732.3(ARID1B):c.1308C>G (p.Ser436Arg)
NM_020732.3(ARID1B):c.1329C>T (p.Pro443=)
NM_020732.3(ARID1B):c.132A>G (p.Ala44=) rs1157661615
NM_020732.3(ARID1B):c.1336_1338CCG[6] (p.Pro450dup) rs572236007
NM_020732.3(ARID1B):c.1349_1350insAAC (p.Ser451_Gln452insThr) rs1562378653
NM_020732.3(ARID1B):c.1360C>T (p.Gln454Ter) rs1057518213
NM_020732.3(ARID1B):c.1370_1372CGG[3] (p.Ala460del) rs757953295
NM_020732.3(ARID1B):c.1370_1372CGG[5] (p.Ala460dup) rs757953295
NM_020732.3(ARID1B):c.1375G>A (p.Ala459Thr) rs587779740
NM_020732.3(ARID1B):c.1379C>T (p.Ala460Val) rs797045270
NM_020732.3(ARID1B):c.1385_1387CGG[4] (p.Ala464dup) rs1367431735
NM_020732.3(ARID1B):c.1389_1398dup (p.Gln467fs) rs1131691339
NM_020732.3(ARID1B):c.1392_1402del (p.Gln467fs) rs1131691706
NM_020732.3(ARID1B):c.1392_1402dup (p.Gln468fs) rs1131691706
NM_020732.3(ARID1B):c.1400_1410del (p.Gln467fs) rs1085307818
NM_020732.3(ARID1B):c.1469_1488dup (p.Ser497fs) rs1554248228
NM_020732.3(ARID1B):c.1471G>A (p.Ala491Thr) rs1296293849
NM_020732.3(ARID1B):c.1471_1472delinsAA (p.Ala491Lys) rs1562378975
NM_020732.3(ARID1B):c.1483C>T (p.Gln495Ter) rs1554248236
NM_020732.3(ARID1B):c.1524_1525dup (p.Thr509fs) rs1554248273
NM_020732.3(ARID1B):c.1542+19G>C rs374013482
NM_020732.3(ARID1B):c.1592T>C (p.Met531Thr) rs141260832
NM_020732.3(ARID1B):c.1612C>T (p.Gln538Ter) rs1057518951
NM_020732.3(ARID1B):c.1618C>T (p.Gln540Ter) rs1554256703
NM_020732.3(ARID1B):c.1632G>A (p.Pro544=)
NM_020732.3(ARID1B):c.1678A>G (p.Ile560Val) rs17318151
NM_020732.3(ARID1B):c.1685T>A (p.Ile562Asn) rs1057522610
NM_020732.3(ARID1B):c.168C>G (p.Gly56=) rs555625059
NM_020732.3(ARID1B):c.1714G>A (p.Gly572Arg)
NM_020732.3(ARID1B):c.1735C>T (p.Gln579Ter) rs1060499668
NM_020732.3(ARID1B):c.1737+28T>C rs73572289
NM_020732.3(ARID1B):c.1762G>T (p.Glu588Ter) rs201653711
NM_020732.3(ARID1B):c.17G>A (p.Gly6Asp) rs1057518648
NM_020732.3(ARID1B):c.17_25dup (p.Gly6_Ala8dup) rs777784233
NM_020732.3(ARID1B):c.1828C>T (p.Gln610Ter) rs1554265271
NM_020732.3(ARID1B):c.1836del
NM_020732.3(ARID1B):c.1837T>C (p.Tyr613His)
NM_020732.3(ARID1B):c.1841dup (p.Tyr614Ter) rs1554265275
NM_020732.3(ARID1B):c.1872A>C (p.Pro624=) rs756099753
NM_020732.3(ARID1B):c.1899dup (p.Ser634fs) rs1554265319
NM_020732.3(ARID1B):c.1903C>T (p.Gln635Ter) rs387907142
NM_020732.3(ARID1B):c.1914C>A (p.Tyr638Ter) rs751192841
NM_020732.3(ARID1B):c.1920G>A (p.Pro640=)
NM_020732.3(ARID1B):c.1927-3T>A rs116661275
NM_020732.3(ARID1B):c.1927-3dup rs541477699
NM_020732.3(ARID1B):c.1932G>A (p.Met644Ile) rs142897795
NM_020732.3(ARID1B):c.1960C>T (p.Gln654Ter) rs1554270809
NM_020732.3(ARID1B):c.1977C>T (p.Pro659=) rs146240413
NM_020732.3(ARID1B):c.197A>G (p.Asn66Ser) rs776745618
NM_020732.3(ARID1B):c.1995A>T (p.Glu665Asp) rs139125255
NM_020732.3(ARID1B):c.2001G>A (p.Leu667=) rs797045271
NM_020732.3(ARID1B):c.2038-35G>A rs3734440
NM_020732.3(ARID1B):c.2070G>A (p.Thr690=)
NM_020732.3(ARID1B):c.2077G>T (p.Glu693Ter) rs1554294593
NM_020732.3(ARID1B):c.2106A>G (p.Ala702=) rs745528262
NM_020732.3(ARID1B):c.2149C>T (p.Gln717Ter) rs753933273
NM_020732.3(ARID1B):c.2169T>C (p.His723=) rs370364530
NM_020732.3(ARID1B):c.2172G>A (p.Ala724=) rs3734441
NM_020732.3(ARID1B):c.2176_2177dup (p.His727fs) rs1554294665
NM_020732.3(ARID1B):c.2195C>A (p.Pro732Gln) rs1318967699
NM_020732.3(ARID1B):c.2200_2201delinsT (p.Gly734fs) rs886041470
NM_020732.3(ARID1B):c.2201dup (p.Ser736fs) rs1554294674
NM_020732.3(ARID1B):c.2242C>T (p.Gln748Ter) rs869312712
NM_020732.3(ARID1B):c.2248C>T (p.Arg750Ter) rs797045272
NM_020732.3(ARID1B):c.2258dup (p.Ile754fs) rs1554294698
NM_020732.3(ARID1B):c.2306_2308delinsTCCGCAGCCACTCC (p.Pro769fs) rs879253856
NM_020732.3(ARID1B):c.2307C>T (p.Pro769=) rs541757080
NM_020732.3(ARID1B):c.2338G>A (p.Ala780Thr)
NM_020732.3(ARID1B):c.2362C>T (p.Gln788Ter) rs1554298232
NM_020732.3(ARID1B):c.2371+5G>A rs1554298239
NM_020732.3(ARID1B):c.2371G>A (p.Gly791Ser) rs1057518045
NM_020732.3(ARID1B):c.2372-2A>C rs1057524160
NM_020732.3(ARID1B):c.2393_2396del (p.Arg798fs) rs1085307695
NM_020732.3(ARID1B):c.2419C>T (p.Pro807Ser) rs114201726
NM_020732.3(ARID1B):c.2444C>T (p.Ser815Leu) rs150140314
NM_020732.3(ARID1B):c.2465dup (p.Gln823fs) rs1554301230
NM_020732.3(ARID1B):c.252_254CCA[4] (p.His89del) rs752012879
NM_020732.3(ARID1B):c.257_277ACCACCACCATGCCCACCACC[1] (p.86_92HHHHAHH[1]) rs767952510
NM_020732.3(ARID1B):c.2692C>T (p.Arg898Ter) rs794727977
NM_020732.3(ARID1B):c.2697G>A (p.Met899Ile) rs1060499843
NM_020732.3(ARID1B):c.2699C>T (p.Pro900Leu) rs1057521656
NM_020732.3(ARID1B):c.270_272CCA[5] (p.His96del) rs754114025
NM_020732.3(ARID1B):c.2773C>T (p.Gln925Ter) rs1554226097
NM_020732.3(ARID1B):c.2776C>T (p.Gln926Ter) rs1057517704
NM_020732.3(ARID1B):c.278A>T (p.His93Leu) rs587779741
NM_020732.3(ARID1B):c.2799G>A (p.Pro933=) rs587779742
NM_020732.3(ARID1B):c.2828dup (p.Glu944fs) rs1554226131
NM_020732.3(ARID1B):c.2862G>C (p.Ala954=)
NM_020732.3(ARID1B):c.2879+2T>C rs1057518318
NM_020732.3(ARID1B):c.2879+6C>T rs1203684217
NM_020732.3(ARID1B):c.2888G>A (p.Ser963Asn) rs1554228777
NM_020732.3(ARID1B):c.288_311del (p.His98_Ala105del) rs1554247278
NM_020732.3(ARID1B):c.2895C>T (p.Pro965=) rs144894118
NM_020732.3(ARID1B):c.2896G>A (p.Gly966Ser) rs34786733
NM_020732.3(ARID1B):c.2941C>T (p.Gln981Ter) rs879253747
NM_020732.3(ARID1B):c.2946del (p.Pro982_Met983insTer) rs1554228806
NM_020732.3(ARID1B):c.2960C>G (p.Ser987Cys) rs780818465
NM_020732.3(ARID1B):c.2976G>T (p.Thr992=)
NM_020732.3(ARID1B):c.2978A>T (p.Gln993Leu)
NM_020732.3(ARID1B):c.2985G>A (p.Pro995=) rs537901478
NM_020732.3(ARID1B):c.3007A>G (p.Met1003Val) rs764460073
NM_020732.3(ARID1B):c.3016_3020dup (p.Ala1009fs) rs1057518387
NM_020732.3(ARID1B):c.3025+1G>A rs886039679
NM_020732.3(ARID1B):c.3025+21C>T rs9397998
NM_020732.3(ARID1B):c.3025+38C>T rs9384530
NM_020732.3(ARID1B):c.3025+6C>T rs148976215
NM_020732.3(ARID1B):c.3025G>T (p.Ala1009Ser)
NM_020732.3(ARID1B):c.3026-1G>A rs752642190
NM_020732.3(ARID1B):c.303C>T (p.His101=) rs1562375469
NM_020732.3(ARID1B):c.3048G>T (p.Met1016Ile) rs1057518059
NM_020732.3(ARID1B):c.3050T>C (p.Met1017Thr) rs371523255
NM_020732.3(ARID1B):c.3051_3052insGA (p.Ser1018fs) rs1554229912
NM_020732.3(ARID1B):c.3096_3100del (p.Lys1033fs) rs1131692263
NM_020732.3(ARID1B):c.3120C>T (p.Pro1040=)
NM_020732.3(ARID1B):c.3183C>G (p.Tyr1061Ter) rs758570139
NM_020732.3(ARID1B):c.3208_3209del (p.Lys1070fs) rs879253745
NM_020732.3(ARID1B):c.3212_3216delinsCAGA (p.Leu1071fs) rs1562328476
NM_020732.3(ARID1B):c.3219C>T (p.Val1073=) rs371828409
NM_020732.3(ARID1B):c.3223C>T (p.Arg1075Ter) rs387907144
NM_020732.3(ARID1B):c.3228C>G (p.Tyr1076Ter) rs1562328526
NM_020732.3(ARID1B):c.3238A>C (p.Met1080Leu)
NM_020732.3(ARID1B):c.3259G>A (p.Val1087Ile) rs758353662
NM_020732.3(ARID1B):c.3263C>G (p.Ser1088Ter) rs886039676
NM_020732.3(ARID1B):c.3286_3287dup (p.Pro1097fs) rs1057519009
NM_020732.3(ARID1B):c.3296A>T (p.Asp1099Val) rs1554231259
NM_020732.3(ARID1B):c.3304C>T (p.Arg1102Ter) rs387907141
NM_020732.3(ARID1B):c.3307_3308CT[1] (p.Tyr1104fs) rs1554231260
NM_020732.3(ARID1B):c.3309C>T (p.Leu1103=) rs111368751
NM_020732.3(ARID1B):c.3312C>T (p.Tyr1104=) rs61736269
NM_020732.3(ARID1B):c.3323_3324del (p.Lys1108fs) rs876657380
NM_020732.3(ARID1B):c.3335G>A (p.Gly1112Asp) rs864309615
NM_020732.3(ARID1B):c.3345+11G>A rs368322992
NM_020732.3(ARID1B):c.3345+1G>A rs1554231278
NM_020732.3(ARID1B):c.3345+2T>G rs1404726383
NM_020732.3(ARID1B):c.3361A>T (p.Lys1121Ter) rs886041623
NM_020732.3(ARID1B):c.3365G>A (p.Trp1122Ter) rs1554231803
NM_020732.3(ARID1B):c.3377del (p.Ala1126fs) rs1554231814
NM_020732.3(ARID1B):c.3399C>T (p.Thr1133=) rs142391292
NM_020732.3(ARID1B):c.339_365del (p.Phe113_Gln122delinsLeu) rs1321302086
NM_020732.3(ARID1B):c.3401C>G (p.Ser1134Ter)
NM_020732.3(ARID1B):c.3428del (p.Lys1143fs) rs1554231830
NM_020732.3(ARID1B):c.342_344GCA[5] (p.Gln130_Gln131del) rs587779743
NM_020732.3(ARID1B):c.342_344GCA[6] (p.Gln131del) rs587779743
NM_020732.3(ARID1B):c.342_344GCA[8] (p.Gln131dup) rs587779743
NM_020732.3(ARID1B):c.342_344GCA[9] (p.Gln130_Gln131dup) rs587779743
NM_020732.3(ARID1B):c.3430C>T (p.Gln1144Ter) rs1554231836
NM_020732.3(ARID1B):c.3445del (p.Leu1149fs) rs1057518918
NM_020732.3(ARID1B):c.3450del (p.Phe1150fs) rs1554231845
NM_020732.3(ARID1B):c.3459G>A (p.Glu1153=) rs61745451
NM_020732.3(ARID1B):c.345_368GCAGCAGCAGCAGCAGCAACAGCA[1] (p.Gln124_Gln131del) rs770869529
NM_020732.3(ARID1B):c.345_368GCAGCAGCAGCAGCAGCAACAGCA[3] (p.Gln124_Gln131dup) rs770869529
NM_020732.3(ARID1B):c.34G>A (p.Gly12Ser) rs797045273
NM_020732.3(ARID1B):c.3520_3521del (p.Lys1174fs) rs886041493
NM_020732.3(ARID1B):c.3535C>T (p.Gln1179Ter) rs1554231904
NM_020732.3(ARID1B):c.3548del (p.Pro1183fs) rs1562331655
NM_020732.3(ARID1B):c.3550+1G>A rs886039699
NM_020732.3(ARID1B):c.3596_3597del (p.Gly1199fs) rs1085307518
NM_020732.3(ARID1B):c.360_386del (p.Gln123_Gln131del) rs910569810
NM_020732.3(ARID1B):c.3628C>G (p.Leu1210Val)
NM_020732.3(ARID1B):c.3632dup (p.Pro1212fs) rs1554232959
NM_020732.3(ARID1B):c.363A>G (p.Gln121=) rs78253128
NM_020732.3(ARID1B):c.363_364insG (p.Gln122fs) rs1554247377
NM_020732.3(ARID1B):c.363_371del (p.Gln129_Gln131del) rs797045274
NM_020732.3(ARID1B):c.363_374del (p.Gln128_Gln131del) rs797045275
NM_020732.3(ARID1B):c.363_377del (p.Gln127_Gln131del) rs774668010
NM_020732.3(ARID1B):c.363_380del (p.Gln126_Gln131del) rs768349133
NM_020732.3(ARID1B):c.363_383del (p.Gln125_Gln131del) rs762617219
NM_020732.3(ARID1B):c.366_368GCA[10] (p.Gln129_Gln131dup) rs587779744
NM_020732.3(ARID1B):c.366_368GCA[11] (p.Gln128_Gln131dup) rs587779744
NM_020732.3(ARID1B):c.366_368GCA[4] (p.Gln129_Gln131del) rs587779744
NM_020732.3(ARID1B):c.366_368GCA[5] (p.Gln130_Gln131del) rs587779744
NM_020732.3(ARID1B):c.366_368GCA[6] (p.Gln131del) rs587779744
NM_020732.3(ARID1B):c.366_368GCA[8] (p.Gln131dup) rs587779744
NM_020732.3(ARID1B):c.366_368GCA[9] (p.Gln130_Gln131dup) rs587779744
NM_020732.3(ARID1B):c.3676A>T (p.Met1226Leu)
NM_020732.3(ARID1B):c.3689+1G>C rs1057518691
NM_020732.3(ARID1B):c.3737C>A (p.Ser1246Ter)
NM_020732.3(ARID1B):c.3748A>C (p.Lys1250Gln) rs1057522635
NM_020732.3(ARID1B):c.3771C>T (p.Asn1257=)
NM_020732.3(ARID1B):c.3778_3780delinsAG (p.Tyr1260fs) rs1554233122
NM_020732.3(ARID1B):c.3785A>C (p.Gln1262Pro)
NM_020732.3(ARID1B):c.3796A>G (p.Met1266Val) rs773883674
NM_020732.3(ARID1B):c.3823delinsCATGAGCCCA (p.Tyr1275delinsHisGluProAsn) rs1554233151
NM_020732.3(ARID1B):c.3843dup (p.Phe1282fs) rs1554233166
NM_020732.3(ARID1B):c.3851G>T (p.Gly1284Val) rs149389876
NM_020732.3(ARID1B):c.3862+1G>A rs1554233187
NM_020732.3(ARID1B):c.3891G>C (p.Thr1297=)
NM_020732.3(ARID1B):c.3898C>T (p.Gln1300Ter) rs1554234341
NM_020732.3(ARID1B):c.3919C>T (p.Gln1307Ter) rs387907140
NM_020732.3(ARID1B):c.3945C>T (p.Ser1315=) rs371872657
NM_020732.3(ARID1B):c.3946G>A (p.Gly1316Arg) rs199674889
NM_020732.3(ARID1B):c.3993T>A (p.Tyr1331Ter) rs1554234424
NM_020732.3(ARID1B):c.4009C>T (p.Arg1337Ter) rs773740590
NM_020732.3(ARID1B):c.4010G>A (p.Arg1337Gln)
NM_020732.3(ARID1B):c.4014-1G>A rs886044620
NM_020732.3(ARID1B):c.4014-7A>G rs112318565
NM_020732.3(ARID1B):c.4038T>A (p.Tyr1346Ter) rs748363079
NM_020732.3(ARID1B):c.4071G>A (p.Pro1357=)
NM_020732.3(ARID1B):c.4090G>A (p.Gly1364Ser) rs151115781
NM_020732.3(ARID1B):c.4102C>T (p.Gln1368Ter) rs587779745
NM_020732.3(ARID1B):c.4105C>T (p.Gln1369Ter) rs1554235028
NM_020732.3(ARID1B):c.4110+1G>C rs1554235041
NM_020732.3(ARID1B):c.4110G>A (p.Pro1370=) rs797045277
NM_020732.3(ARID1B):c.4136T>C (p.Met1379Thr) rs145012943
NM_020732.3(ARID1B):c.4140C>G (p.Tyr1380Ter)
NM_020732.3(ARID1B):c.4140C>T (p.Tyr1380=) rs377021700
NM_020732.3(ARID1B):c.4152del (p.Lys1385fs) rs886041632
NM_020732.3(ARID1B):c.4171_4172del (p.Met1391fs) rs797044859
NM_020732.3(ARID1B):c.417C>T (p.Ser139=) rs1229372337
NM_020732.3(ARID1B):c.4234T>G (p.Ser1412Ala) rs145516400
NM_020732.3(ARID1B):c.4240C>G (p.Pro1414Ala)
NM_020732.3(ARID1B):c.4241C>T (p.Pro1414Leu)
NM_020732.3(ARID1B):c.4273dup (p.Tyr1425fs) rs879253746
NM_020732.3(ARID1B):c.4294A>G (p.Met1432Val)
NM_020732.3(ARID1B):c.4305G>A (p.Pro1435=)
NM_020732.3(ARID1B):c.4322dup (p.His1441fs) rs886041463
NM_020732.3(ARID1B):c.4324G>T (p.Gly1442Ter) rs779375711
NM_020732.3(ARID1B):c.4336C>T (p.Gln1446Ter) rs797045278
NM_020732.3(ARID1B):c.4345G>A (p.Gly1449Ser) rs141461351
NM_020732.3(ARID1B):c.4365del (p.Ser1456fs) rs1554235699
NM_020732.3(ARID1B):c.4377del (p.Pro1460fs) rs587779746
NM_020732.3(ARID1B):c.4425C>G (p.Tyr1475Ter) rs1562345819
NM_020732.3(ARID1B):c.4440C>T (p.Gly1480=) rs139903653
NM_020732.3(ARID1B):c.4443T>G (p.Pro1481=)
NM_020732.3(ARID1B):c.4456C>T (p.Gln1486Ter) rs1064793482
NM_020732.3(ARID1B):c.4470C>G (p.Tyr1490Ter) rs1554235792
NM_020732.3(ARID1B):c.4474G>A (p.Gly1492Ser) rs1274057762
NM_020732.3(ARID1B):c.4495A>T (p.Met1499Leu) rs34870395
NM_020732.3(ARID1B):c.4524T>C (p.His1508=)
NM_020732.3(ARID1B):c.4536G>A (p.Trp1512Ter) rs1554235834
NM_020732.3(ARID1B):c.4596C>T (p.Ile1532=)
NM_020732.3(ARID1B):c.4622_4631del (p.Gln1541fs) rs876657382
NM_020732.3(ARID1B):c.4632G>A (p.Pro1544=) rs61738955
NM_020732.3(ARID1B):c.4658C>T (p.Ala1553Val) rs762698567
NM_020732.3(ARID1B):c.4659G>A (p.Ala1553=)
NM_020732.3(ARID1B):c.4671G>A (p.Ala1557=)
NM_020732.3(ARID1B):c.4673C>G (p.Ser1558Cys) rs1562346609
NM_020732.3(ARID1B):c.4700_4701delinsAGT (p.Met1567fs) rs1554235934
NM_020732.3(ARID1B):c.4741C>T (p.Gln1581Ter) rs1554235950
NM_020732.3(ARID1B):c.4780G>A (p.Gly1594Arg) rs1329932861
NM_020732.3(ARID1B):c.4813G>A (p.Glu1605Lys)
NM_020732.3(ARID1B):c.4870C>T (p.Arg1624Ter) rs1554236040
NM_020732.3(ARID1B):c.4871G>A (p.Arg1624Gln) rs762183842
NM_020732.3(ARID1B):c.4878_4890del (p.Thr1627fs) rs1554236045
NM_020732.3(ARID1B):c.4888dup (p.Asp1630fs) rs1554236054
NM_020732.3(ARID1B):c.4889del (p.Asp1630fs) rs1562347066
NM_020732.3(ARID1B):c.4903del (p.Glu1635fs) rs1554236600
NM_020732.3(ARID1B):c.4941T>C (p.Leu1647=) rs372621575
NM_020732.3(ARID1B):c.4956G>T (p.Thr1652=) rs146620657
NM_020732.3(ARID1B):c.5015A>G (p.Asn1672Ser) rs140177120
NM_020732.3(ARID1B):c.5025+1G>A rs1057518984
NM_020732.3(ARID1B):c.5026-2A>C rs1562350940
NM_020732.3(ARID1B):c.5056dup (p.Tyr1686fs) rs797045279
NM_020732.3(ARID1B):c.5099A>G (p.Glu1700Gly)
NM_020732.3(ARID1B):c.5100del (p.Glu1700fs) rs1554237050
NM_020732.3(ARID1B):c.5127A>T (p.Lys1709Asn) rs1362951381
NM_020732.3(ARID1B):c.5151del (p.Lys1718fs) rs797045280
NM_020732.3(ARID1B):c.5153del (p.Lys1718fs) rs797045281
NM_020732.3(ARID1B):c.5207A>C (p.Glu1736Ala) rs149518409
NM_020732.3(ARID1B):c.521C>T (p.Pro174Leu) rs1394730320
NM_020732.3(ARID1B):c.5220_5222CGA[1] (p.Asp1741del) rs113820273
NM_020732.3(ARID1B):c.5289C>T (p.Ile1763=)
NM_020732.3(ARID1B):c.5303C>T (p.Pro1768Leu) rs142466273
NM_020732.3(ARID1B):c.5307C>T (p.Asp1769=)
NM_020732.3(ARID1B):c.5309C>T (p.Ala1770Val) rs201137071
NM_020732.3(ARID1B):c.5310C>T (p.Ala1770=)
NM_020732.3(ARID1B):c.5311G>A (p.Ala1771Thr)
NM_020732.3(ARID1B):c.5329A>T (p.Lys1777Ter) rs387907143
NM_020732.3(ARID1B):c.5338C>T (p.Gln1780Ter) rs750447037
NM_020732.3(ARID1B):c.5357A>G (p.Lys1786Arg)
NM_020732.3(ARID1B):c.5390_5393TGTT[1] (p.Phe1798fs) rs1554237269
NM_020732.3(ARID1B):c.5404C>T (p.Arg1802Ter) rs797045282
NM_020732.3(ARID1B):c.5462_5466del (p.Leu1821fs) rs1131691508
NM_020732.3(ARID1B):c.5482G>A (p.Glu1828Lys) rs1451259945
NM_020732.3(ARID1B):c.5482G>T (p.Glu1828Ter) rs1451259945
NM_020732.3(ARID1B):c.5545C>A (p.Pro1849Thr) rs779490460
NM_020732.3(ARID1B):c.5546C>G (p.Pro1849Arg)
NM_020732.3(ARID1B):c.5547dup (p.Ser1851fs) rs35441529
NM_020732.3(ARID1B):c.5566_5569AAGA[1] (p.Lys1857fs) rs886041706
NM_020732.3(ARID1B):c.5586dup (p.Gly1863fs) rs1562352435
NM_020732.3(ARID1B):c.5599dup (p.Glu1867fs) rs1554237473
NM_020732.3(ARID1B):c.55G>C (p.Gly19Arg) rs1465331796
NM_020732.3(ARID1B):c.5607A>G (p.Gln1869=) rs1303216691
NM_020732.3(ARID1B):c.5632del (p.Asp1878fs) rs876657381
NM_020732.3(ARID1B):c.5650C>T (p.Arg1884Trp) rs1377877762
NM_020732.3(ARID1B):c.5680C>T (p.Pro1894Ser) rs774509236
NM_020732.3(ARID1B):c.5694C>T (p.Thr1898=) rs376113162
NM_020732.3(ARID1B):c.5703dup (p.Lys1902Ter) rs886041878
NM_020732.3(ARID1B):c.5722C>T (p.Gln1908Ter) rs1554237606
NM_020732.3(ARID1B):c.5741G>A (p.Arg1914Gln)
NM_020732.3(ARID1B):c.5755C>A (p.Leu1919Met) rs1562352930
NM_020732.3(ARID1B):c.5776C>T (p.Arg1926Ter) rs1554237658
NM_020732.3(ARID1B):c.5802C>T (p.Ile1934=) rs142499766
NM_020732.3(ARID1B):c.5811G>A (p.Trp1937Ter) rs886041819
NM_020732.3(ARID1B):c.5830C>T (p.Arg1944Ter) rs1028186690
NM_020732.3(ARID1B):c.5885A>G (p.Asp1962Gly)
NM_020732.3(ARID1B):c.5889C>G (p.Ala1963=) rs781082506
NM_020732.3(ARID1B):c.5922C>T (p.Ile1974=) rs112703040
NM_020732.3(ARID1B):c.5949C>T (p.His1983=) rs142416998
NM_020732.3(ARID1B):c.5950G>T (p.Glu1984Ter) rs786205584
NM_020732.3(ARID1B):c.5965_5966del (p.Lys1989fs) rs1554237785
NM_020732.3(ARID1B):c.5968C>T (p.Arg1990Ter) rs797045283
NM_020732.3(ARID1B):c.6035G>A (p.Trp2012Ter) rs1554237845
NM_020732.3(ARID1B):c.6039G>A (p.Trp2013Ter) rs1554237848
NM_020732.3(ARID1B):c.6072G>A (p.Thr2024=)
NM_020732.3(ARID1B):c.6090C>T (p.Asn2030=)
NM_020732.3(ARID1B):c.6095C>T (p.Ser2032Phe) rs886039594
NM_020732.3(ARID1B):c.6100C>T (p.Gln2034Ter) rs869312697
NM_020732.3(ARID1B):c.6120_6130delinsGACTTG (p.Tyr2040_Ile2044delinsTer) rs886041665
NM_020732.3(ARID1B):c.6124G>A (p.Glu2042Lys) rs1064794799
NM_020732.3(ARID1B):c.6218A>C (p.Asn2073Thr) rs1430704414
NM_020732.3(ARID1B):c.6254_6281dup (p.Asn2095_Val2096insProLeuTer) rs1554237992
NM_020732.3(ARID1B):c.6255_6256del (p.Leu2086_Cys2087insTer) rs886040958
NM_020732.3(ARID1B):c.6257T>G (p.Leu2086Arg) rs1554237999
NM_020732.3(ARID1B):c.6272T>C (p.Ile2091Thr) rs878852997
NM_020732.3(ARID1B):c.6294G>C (p.Leu2098=) rs1562354325
NM_020732.3(ARID1B):c.6322C>T (p.Gln2108Ter) rs1554238035
NM_020732.3(ARID1B):c.6342A>G (p.Thr2114=)
NM_020732.3(ARID1B):c.6357del (p.Asp2121fs) rs1057519002
NM_020732.3(ARID1B):c.637C>T (p.Pro213Ser) rs797045284
NM_020732.3(ARID1B):c.6382C>T (p.Arg2128Ter) rs1554238072
NM_020732.3(ARID1B):c.6406T>C (p.Ser2136Pro) rs1057521854
NM_020732.3(ARID1B):c.640C>T (p.Pro214Ser) rs1301993972
NM_020732.3(ARID1B):c.6427G>A (p.Ala2143Thr) rs530084903
NM_020732.3(ARID1B):c.6454C>T (p.Gln2152Ter) rs1554238093
NM_020732.3(ARID1B):c.6463_6473del (p.Ser2155fs) rs876657379
NM_020732.3(ARID1B):c.6473del (p.Asn2158fs) rs1562354784
NM_020732.3(ARID1B):c.6498_6508del (p.Val2167fs) rs1064793899
NM_020732.3(ARID1B):c.6504G>A (p.Thr2168=) rs377350616
NM_020732.3(ARID1B):c.6519G>C (p.Gln2173His) rs1057522604
NM_020732.3(ARID1B):c.6526C>T (p.Gln2176Ter) rs758120346
NM_020732.3(ARID1B):c.652C>G (p.Pro218Ala) rs1044746171
NM_020732.3(ARID1B):c.652C>T (p.Pro218Ser)
NM_020732.3(ARID1B):c.6547C>T (p.Gln2183Ter) rs1308155037
NM_020732.3(ARID1B):c.6594G>A (p.Ala2198=) rs754242891
NM_020732.3(ARID1B):c.6629_6651del (p.Glu2210fs) rs886041804
NM_020732.3(ARID1B):c.6642A>G (p.Glu2214=) rs756043689
NM_020732.3(ARID1B):c.6654C>T (p.His2218=) rs183572405
NM_020732.3(ARID1B):c.6662G>A (p.Arg2221Gln) rs1302430069
NM_020732.3(ARID1B):c.6700del (p.Leu2234fs) rs1562355401
NM_020732.3(ARID1B):c.678C>T (p.Ala226=) rs1450163641
NM_020732.3(ARID1B):c.679G>C (p.Val227Leu) rs777266582
NM_020732.3(ARID1B):c.679_680delinsCC (p.Val227Pro) rs1554247605
NM_020732.3(ARID1B):c.69G>A (p.Ala23=) rs533182720
NM_020732.3(ARID1B):c.705C>T (p.Gly235=) rs745740327
NM_020732.3(ARID1B):c.712G>T (p.Ala238Ser) rs1268089519
NM_020732.3(ARID1B):c.714C>T (p.Ala238=) rs533517668
NM_020732.3(ARID1B):c.717_730delinsG (p.Ala240fs) rs1554247637
NM_020732.3(ARID1B):c.736G>A (p.Gly246Ser) rs375160616
NM_020732.3(ARID1B):c.751T>G (p.Cys251Gly) rs1276300860
NM_020732.3(ARID1B):c.760C>T (p.Gln254Ter) rs1554247662
NM_020732.3(ARID1B):c.769G>T (p.Gly257Ter) rs1057518256
NM_020732.3(ARID1B):c.76A>C (p.Lys26Gln) rs1475208851
NM_020732.3(ARID1B):c.850C>T (p.Gln284Ter)
NM_020732.3(ARID1B):c.887A>C (p.Asn296Thr) rs797045285
NM_020732.3(ARID1B):c.917C>G (p.Ala306Gly) rs1168284939
NM_020732.3(ARID1B):c.921_923CGG[10] (p.Gly318_Gly319dup) rs587779747
NM_020732.3(ARID1B):c.921_923CGG[3] (p.Gly315_Gly319del) rs587779747
NM_020732.3(ARID1B):c.921_923CGG[4] (p.Gly316_Gly319del) rs587779747
NM_020732.3(ARID1B):c.921_923CGG[5] (p.Gly317_Gly319del) rs587779747
NM_020732.3(ARID1B):c.921_923CGG[6] (p.Gly318_Gly319del) rs587779747
NM_020732.3(ARID1B):c.921_923CGG[7] (p.Gly319del) rs587779747
NM_020732.3(ARID1B):c.921_923CGG[9] (p.Gly319dup) rs587779747
NM_020732.3(ARID1B):c.941_942insAGG (p.Gly319dup) rs1562377373
NM_020732.3(ARID1B):c.942C>A (p.Gly314=) rs184815562
NM_020732.3(ARID1B):c.945A>C (p.Gly315=) rs112474841
NM_020732.3(ARID1B):c.945_947AGG[3] (p.Gly319del) rs587779748
NM_020732.3(ARID1B):c.945_947AGG[5] (p.Gly319dup) rs587779748
NM_020732.3(ARID1B):c.957_974del (p.Ser320_Gly325del) rs755976776
NM_020732.3(ARID1B):c.957_974dup (p.Ser320_Gly325dup)
NM_020732.3(ARID1B):c.958_981dup (p.Ser320_Gly327dup) rs1215031054
NM_020732.3(ARID1B):c.962_964GAG[10] (p.Gly327_Gly328dup) rs747790383
NM_020732.3(ARID1B):c.962_964GAG[11] (p.Gly326_Gly328dup) rs747790383
NM_020732.3(ARID1B):c.962_964GAG[4] (p.Gly325_Gly328del) rs747790383
NM_020732.3(ARID1B):c.962_964GAG[5] (p.Gly326_Gly328del) rs747790383
NM_020732.3(ARID1B):c.962_964GAG[6] (p.Gly327_Gly328del) rs747790383
NM_020732.3(ARID1B):c.962_964GAG[7] (p.Gly328del) rs747790383
NM_020732.3(ARID1B):c.962_964GAG[9] (p.Gly328dup) rs747790383
NM_020732.3(ARID1B):c.971G>C (p.Gly324Ala) rs1057522183
NM_020732.3(ARID1B):c.978_992AGGAGGAGCAGGAGC[1] (p.328_332GAGAG[1]) rs773423003
NM_020732.3(ARID1B):c.980G>C (p.Gly327Ala) rs1455234951
NM_020732.3(ARID1B):c.986_991CAGGAG[1] (p.329_330AG[1]) rs747438636
NM_020732.3(ARID1B):c.986_991CAGGAG[3] (p.329_330AG[3]) rs747438636
NM_020732.3(ARID1B):c.986_994del (p.Ala329_Ala331del) rs1562377638
NM_020732.3(ARID1B):c.989G>C (p.Gly330Ala) rs749315126
NM_020732.3(ARID1B):c.989_997GAGCAGGAG[1] (p.330_332GAG[1]) rs771557031
NM_020732.3(ARID1B):c.996_1001AGGAGC[3] (p.333_334GA[4]) rs1323804393
t(1;6)(p31;q25)dn

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.