ClinVar Miner

List of variants in gene combination ATM, C11orf65 reported as likely pathogenic for Ataxia-telangiectasia syndrome

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 145
Download table as spreadsheet
NM_000051.3(ATM):c.5763-2A>T rs876659489
NM_000051.3(ATM):c.5791delinsCCT (p.Ala1931fs) rs587779851
NM_000051.3(ATM):c.5798G>A (p.Trp1933Ter) rs876658740
NM_000051.3(ATM):c.5890A>T (p.Lys1964Ter) rs201963507
NM_000051.3(ATM):c.5896dup (p.Ser1966fs) rs1555110514
NM_000051.3(ATM):c.5910del (p.Glu1971fs) rs587782198
NM_000051.3(ATM):c.5919-2A>C rs746623393
NM_000051.3(ATM):c.5919-2A>G rs746623393
NM_000051.3(ATM):c.6006+1G>C rs786202016
NM_000051.3(ATM):c.6007dup (p.Asp2003Glyfs) rs1555113505
NM_000051.3(ATM):c.6040G>T (p.Glu2014Ter) rs375783941
NM_000051.3(ATM):c.6047A>G (p.Asp2016Gly) rs587781302
NM_000051.3(ATM):c.6095+1G>A rs587781584
NM_000051.3(ATM):c.6095+2T>C rs1057516525
NM_000051.3(ATM):c.6095G>A (p.Arg2032Lys) rs139770721
NM_000051.3(ATM):c.6115G>A (p.Glu2039Lys) rs864622251
NM_000051.3(ATM):c.6198+2T>C rs1555113882
NM_000051.3(ATM):c.6199-2A>T rs1060501570
NM_000051.3(ATM):c.6199-2delA rs1555114545
NM_000051.3(ATM):c.6280G>T (p.Glu2094Ter) rs1565503182
NM_000051.3(ATM):c.6325dup (p.Trp2109fs) rs1555114812
NM_000051.3(ATM):c.6347+1G>A rs1057517120
NM_000051.3(ATM):c.6348-1G>A rs1057517302
NM_000051.3(ATM):c.6348-2A>G rs864622367
NM_000051.3(ATM):c.6385T>G (p.Tyr2129Asp) rs876658542
NM_000051.3(ATM):c.6404_6405insTT (p.Leu2135_Arg2136insTer) rs587782554
NM_000051.3(ATM):c.6452+2T>C rs1064795006
NM_000051.3(ATM):c.6453-1G>C rs1555117071
NM_000051.3(ATM):c.6480_6481GC[3] (p.Ser2162fs) rs1057516905
NM_000051.3(ATM):c.6572+1G>A rs587779856
NM_000051.3(ATM):c.6573-2A>G rs751168951
NM_000051.3(ATM):c.6586A>T (p.Arg2196Ter) rs1555119011
NM_000051.3(ATM):c.6592_6593CT[2] (p.Leu2198_Ser2199insTer) rs747057367
NM_000051.3(ATM):c.6850del (p.Val2284fs) rs876659569
NM_000051.3(ATM):c.6899G>C (p.Trp2300Ser) rs1555119899
NM_000051.3(ATM):c.6975+1G>T rs1565521129
NM_000051.3(ATM):c.6975G>A (p.Ala2325=) rs556778314
NM_000051.3(ATM):c.6976-10_6989delTCTTATACAGAACAATCCCAGCCT rs587779859
NM_000051.3(ATM):c.6976-2A>C rs587782403
NM_000051.3(ATM):c.6996_6999TACA[1] (p.Tyr2334fs) rs786203421
NM_000051.3(ATM):c.6997dup (p.Thr2333fs) rs587781299
NM_000051.3(ATM):c.7089+2T>G rs1057516235
NM_000051.3(ATM):c.7096G>T (p.Glu2366Ter) rs587781672
NM_000051.3(ATM):c.7141_7151del (p.Asn2381fs) rs1555122030
NM_000051.3(ATM):c.7166C>G (p.Ser2389Ter) rs1018140779
NM_000051.3(ATM):c.7181C>T (p.Ser2394Leu) rs587779861
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7308-2A>C rs1555122938
NM_000051.3(ATM):c.7327C>T (p.Arg2443Ter) rs121434220
NM_000051.3(ATM):c.7408T>G (p.Tyr2470Asp) rs876659365
NM_000051.3(ATM):c.7570G>C (p.Ala2524Pro) rs769142993
NM_000051.3(ATM):c.7629+1G>A rs1565532703
NM_000051.3(ATM):c.7629+2T>C rs786203059
NM_000051.3(ATM):c.7629_7629+4del rs876660041
NM_000051.3(ATM):c.7630-2A>G rs587779866
NM_000051.3(ATM):c.7703_7704GA[1] (p.Arg2568_Asp2569insTer) rs759965045
NM_000051.3(ATM):c.7767del (p.Lys2589fs) rs1057517025
NM_000051.3(ATM):c.7788+1G>T rs1565534524
NM_000051.3(ATM):c.7788G>A (p.Glu2596=) rs587780639
NM_000051.3(ATM):c.7789-3T>G rs864622185
NM_000051.3(ATM):c.7796del (p.Thr2599fs) rs1555125223
NM_000051.3(ATM):c.7836_7837GA[3] (p.Pro2614fs) rs730881293
NM_000051.3(ATM):c.7858del (p.Val2620fs) rs1555125349
NM_000051.3(ATM):c.7875_7876delTGinsGC (p.Asp2625_Ala2626delinsGluPro) rs267606668
NM_000051.3(ATM):c.7880del (p.Tyr2627fs) rs1057516599
NM_000051.3(ATM):c.7913G>A (p.Trp2638Ter) rs377349459
NM_000051.3(ATM):c.7926A>C (p.Arg2642Ser) rs863224440
NM_000051.3(ATM):c.7927+1G>C rs1555125532
NM_000051.3(ATM):c.7927+5delG rs786204437
NM_000051.3(ATM):c.7928-1G>A rs1555126163
NM_000051.3(ATM):c.7928-2A>T rs864622610
NM_000051.3(ATM):c.7951C>T (p.Gln2651Ter) rs587781994
NM_000051.3(ATM):c.7985T>A (p.Val2662Asp) rs863224463
NM_000051.3(ATM):c.7998dup (p.Met2667fs) rs587779869
NM_000051.3(ATM):c.8010+1delG rs876659350
NM_000051.3(ATM):c.8011-1G>T rs1555127017
NM_000051.3(ATM):c.8098A>T (p.Lys2700Ter) rs758588019
NM_000051.3(ATM):c.8106dup (p.Asp2703fs) rs1555127231
NM_000051.3(ATM):c.8122G>A (p.Asp2708Asn) rs587782719
NM_000051.3(ATM):c.8147T>C (p.Val2716Ala) rs587782652
NM_000051.3(ATM):c.8148_8151+2delTAAGGT rs1565541335
NM_000051.3(ATM):c.8185C>T (p.Gln2729Ter) rs587781967
NM_000051.3(ATM):c.8189A>C (p.Gln2730Pro)
NM_000051.3(ATM):c.8266A>T (p.Lys2756Ter) rs371638537
NM_000051.3(ATM):c.8293G>A (p.Gly2765Ser) rs748634900
NM_000051.3(ATM):c.8307G>A (p.Trp2769Ter) rs778269655
NM_000051.3(ATM):c.8385_8394TTTCAGTGCC[1] (p.Phe2799fs) rs786202800
NM_000051.3(ATM):c.8418+1G>A rs766533795
NM_000051.3(ATM):c.8418+2T>C rs1060501713
NM_000051.3(ATM):c.8419-2A>G rs1555137917
NM_000051.3(ATM):c.8480T>G (p.Phe2827Cys) rs121434216
NM_000051.3(ATM):c.8494C>T (p.Arg2832Cys) rs587779872
NM_000051.3(ATM):c.8535G>A (p.Trp2845Ter) rs1555138291
NM_000051.3(ATM):c.8546G>C (p.Arg2849Pro) rs587782202
NM_000051.3(ATM):c.8549T>A (p.Leu2850Ter) rs876658716
NM_000051.3(ATM):c.8565_8566delinsAA (p.Ser2855_Val2856delinsArgIle) rs587781353
NM_000051.3(ATM):c.8584+1G>A rs876658182
NM_000051.3(ATM):c.8584+2T>C rs730881326
NM_000051.3(ATM):c.8585-2A>C rs1060501700
NM_000051.3(ATM):c.8585-2A>G rs1060501700
NM_000051.3(ATM):c.8586del (p.Gly2863fs) rs1555139467
NM_000051.3(ATM):c.8671+1G>T rs1555139694
NM_000051.3(ATM):c.8671+2T>C rs1057516229
NM_000051.3(ATM):c.8711A>G (p.Glu2904Gly) rs786202826
NM_000051.3(ATM):c.8725A>T (p.Arg2909Ter) rs1555142845
NM_000051.3(ATM):c.8737G>T (p.Asp2913Tyr) rs756899044
NM_000051.3(ATM):c.8786+1G>A rs17174393
NM_000051.3(ATM):c.8786+1G>T rs17174393
NM_000051.3(ATM):c.8786+2T>A rs1555142918
NM_000051.3(ATM):c.8802del (p.Met2935fs) rs876660567
NM_000051.3(ATM):c.8814_8824del (p.Met2938fs) rs758814126
NM_000051.3(ATM):c.8851-1G>T rs1057516537
NM_000051.3(ATM):c.8876_8879del (p.Asp2959fs) rs786204726
NM_000051.3(ATM):c.8977C>T (p.Arg2993Ter) rs770641163
NM_000051.3(ATM):c.8988-1G>A rs730881386
NM_000051.3(ATM):c.8988-2A>C rs786202087
NM_000051.3(ATM):c.8988-2A>G rs786202087
NM_000051.3(ATM):c.8998C>T (p.Gln3000Ter) rs587781698
NM_000051.3(ATM):c.9022C>T (p.Arg3008Cys) rs587782292
NM_000051.3(ATM):c.9023G>A (p.Arg3008His) rs587781894
NM_000051.3(ATM):c.9050_9051insTTCA (p.Lys3018fs) rs1555151854
NM_000051.3(ATM):c.9064dup (p.Glu3022fs) rs1057516282
NM_000051.3(ATM):c.9079dup (p.Ser3027fs) rs587780645
NM_000051.3(ATM):c.9109C>T (p.Gln3037Ter) rs1555152009
NM_000051.3(ATM):c.9145_9146del (p.Phe3049fs) rs1555152058
NM_000051.3(ATM):c.9146del (p.Phe3049fs) rs1555152058

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.