ClinVar Miner

List of variants in gene combination ATM, C11orf65

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 2461
Download table as spreadsheet
HGVS dbSNP
GRCh37/hg19 11q22.3(chr11:108206156-108276555)x1
NC_000011.9:g.(?_108093559)_(108239826_?)del
NC_000011.9:g.(?_108098342)_(108236245_?)del
NC_000011.9:g.(?_108098342)_(108236245_?)dup
NC_000011.9:g.(?_108098346)_(108236241_?)dup
NC_000011.9:g.(?_108114670)_(108225611_?)dup
NC_000011.9:g.(?_108114670)_(108236245_?)del
NC_000011.9:g.(?_108114674)_(108225607_?)dup
NC_000011.9:g.(?_108114680)_(108239826_?)del
NC_000011.9:g.(?_108115509)_(108236241_?)dup
NC_000011.9:g.(?_108126936)_(108236241_?)dup
NC_000011.9:g.(?_108137878)_(108236255_?)del
NC_000011.9:g.(?_108137888)_(108225611_?)del
NC_000011.9:g.(?_108137888)_(108225611_?)dup
NC_000011.9:g.(?_108137888)_(108236245_?)del
NC_000011.9:g.(?_108137888)_(108236245_?)dup
NC_000011.9:g.(?_108137892)_(108236241_?)del
NC_000011.9:g.(?_108151712)_(108236245_?)del
NC_000011.9:g.(?_108168014)_(108206688_?)del
NC_000011.9:g.(?_108172365)_(108236245_?)dup
NC_000011.9:g.(?_108188090)_(108188258_?)del
NC_000011.9:g.(?_108196037)_(108239826_?)del
NC_000011.9:g.(?_108198362)_(108202294_?)del
NC_000011.9:g.(?_108198372)_(108202284_?)del
NC_000011.9:g.(?_108198469)_(108225601_?)dup
NC_000011.9:g.(?_108205686)_(108225611_?)del
NC_000011.9:g.(?_108205690)_(108225607_?)del
NC_000011.9:g.(?_108205690)_(108236241_?)dup
NC_000011.9:g.(?_108206566)_(108236241_?)dup
NC_000011.9:g.(?_108206639)_(108211067_?)del
NC_000011.9:g.(?_108213939)_(108236245_?)del
NC_000011.9:g.(?_108213949)_(108239826_?)del
NC_000011.9:g.(?_108217996)_(108225611_?)del
NC_000011.9:g.(?_108234836)_(108236245_?)del
NC_000011.9:g.(?_108234836)_(108236255_?)del
NC_000011.9:g.(?_108235799)_(108236245_?)del
NC_000011.9:g.(?_108235803)_(108236241_?)del
NC_000011.9:g.(?_108235809)_(108236235_?)del
NG_009830.1:g.(41245_49339)_(137044_147250)dup
NM_000051.3(ATM):c.*1272C>G rs376572054
NM_000051.3(ATM):c.*1427T>C rs3092836
NM_000051.3(ATM):c.*1571C>T rs886047621
NM_000051.3(ATM):c.*1604C>T rs227091
NM_000051.3(ATM):c.*1640C>T rs886047622
NM_000051.3(ATM):c.*1670G>A rs886047623
NM_000051.3(ATM):c.*16T>G rs1362987304
NM_000051.3(ATM):c.*17T>G rs746451875
NM_000051.3(ATM):c.*1882C>G rs80226715
NM_000051.3(ATM):c.*1960delT rs886047624
NM_000051.3(ATM):c.*19C>T rs1338371572
NM_000051.3(ATM):c.*1T>A rs757922166
NM_000051.3(ATM):c.*2080C>T rs142456486
NM_000051.3(ATM):c.*2199C>G rs75959910
NM_000051.3(ATM):c.*2220A>G rs75293772
NM_000051.3(ATM):c.*2224C>T rs139245552
NM_000051.3(ATM):c.*222C>T rs760852487
NM_000051.3(ATM):c.*236C>T rs3092834
NM_000051.3(ATM):c.*2479G>A rs778439888
NM_000051.3(ATM):c.*2541_*2543delACA rs886047625
NM_000051.3(ATM):c.*2563C>T rs146547907
NM_000051.3(ATM):c.*2607T>C rs879796523
NM_000051.3(ATM):c.*2714dupT rs532373195
NM_000051.3(ATM):c.*2779delT rs886047627
NM_000051.3(ATM):c.*2865G>A rs568150944
NM_000051.3(ATM):c.*2866T>C rs191399133
NM_000051.3(ATM):c.*2935C>G rs886047628
NM_000051.3(ATM):c.*2957G>C rs770767475
NM_000051.3(ATM):c.*29C>G rs3218711
NM_000051.3(ATM):c.*3022C>G rs145076930
NM_000051.3(ATM):c.*3072C>T rs3092844
NM_000051.3(ATM):c.*3091G>A rs886047629
NM_000051.3(ATM):c.*3093C>T rs79807288
NM_000051.3(ATM):c.*3136A>G rs3092845
NM_000051.3(ATM):c.*3198T>G rs764033869
NM_000051.3(ATM):c.*3325A>G rs886047630
NM_000051.3(ATM):c.*3354T>G rs886047631
NM_000051.3(ATM):c.*3393G>T rs4585
NM_000051.3(ATM):c.*371A>G rs3092835
NM_000051.3(ATM):c.*44A>G rs55900855
NM_000051.3(ATM):c.*521delC rs886047615
NM_000051.3(ATM):c.*540delA rs369583811
NM_000051.3(ATM):c.*540dupA rs369583811
NM_000051.3(ATM):c.*541_*542delCA rs886047618
NM_000051.3(ATM):c.*541delC rs886047619
NM_000051.3(ATM):c.*548G>T rs227092
NM_000051.3(ATM):c.*551T>C rs143531724
NM_000051.3(ATM):c.*684T>G rs3092837
NM_000051.3(ATM):c.*895dupT rs200629108
NM_000051.3(ATM):c.*9del rs1565609967
NM_000051.3(ATM):c.2467-?_8850+?dup6384
NM_000051.3(ATM):c.3403-?_*(1_?)del
NM_000051.3(ATM):c.5129_5763-1060del
NM_000051.3(ATM):c.5763-11T>C rs1057520675
NM_000051.3(ATM):c.5763-12A>G rs1057523388
NM_000051.3(ATM):c.5763-13C>T rs1057522554
NM_000051.3(ATM):c.5763-14_5763-13delTC rs1064794707
NM_000051.3(ATM):c.5763-17_5763-16delAT rs1064793040
NM_000051.3(ATM):c.5763-19A>G rs967402817
NM_000051.3(ATM):c.5763-2A>C rs876659489
NM_000051.3(ATM):c.5763-2A>G rs876659489
NM_000051.3(ATM):c.5763-2A>T rs876659489
NM_000051.3(ATM):c.5763-302A>G rs551916592
NM_000051.3(ATM):c.5763-5T>C rs1555110219
NM_000051.3(ATM):c.5763-7T>C rs1555110216
NM_000051.3(ATM):c.5763A>G (p.Arg1921=) rs1057523784
NM_000051.3(ATM):c.5764C>T (p.Pro1922Ser) rs587781865
NM_000051.3(ATM):c.5765C>A (p.Pro1922His) rs751792004
NM_000051.3(ATM):c.5765del (p.Pro1922fs) rs786202814
NM_000051.3(ATM):c.5766_5768TTC[1] (p.Ser1924del) rs866749094
NM_000051.3(ATM):c.5769T>C (p.Ser1923=) rs1060504280
NM_000051.3(ATM):c.5771C>A (p.Ser1924Ter) rs876658831
NM_000051.3(ATM):c.5771C>T (p.Ser1924Leu) rs876658831
NM_000051.3(ATM):c.5774G>A (p.Gly1925Glu) rs755055090
NM_000051.3(ATM):c.5776A>G (p.Thr1926Ala) rs781448339
NM_000051.3(ATM):c.5776_5790del (p.Thr1926_Asp1930del) rs786203678
NM_000051.3(ATM):c.5777C>T (p.Thr1926Ile) rs876660944
NM_000051.3(ATM):c.5784T>A (p.Phe1928Leu) rs1290871799
NM_000051.3(ATM):c.5784dup (p.Asn1929Ter) rs1131691254
NM_000051.3(ATM):c.5787T>C (p.Asn1929=) rs1057520448
NM_000051.3(ATM):c.5790T>C (p.Asp1930=) rs1555110279
NM_000051.3(ATM):c.5791_5793delinsCCTC (p.Ala1931fs) rs1555110295
NM_000051.3(ATM):c.5791delinsCCT (p.Ala1931fs) rs587779851
NM_000051.3(ATM):c.5792C>T (p.Ala1931Val) rs1243690083
NM_000051.3(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000051.3(ATM):c.5798G>A (p.Trp1933Ter) rs876658740
NM_000051.3(ATM):c.5803G>A (p.Asp1935Asn)
NM_000051.3(ATM):c.5805_5815delinsATT (p.Asp1935fs)
NM_000051.3(ATM):c.5810A>G (p.Asn1937Ser) rs1555110330
NM_000051.3(ATM):c.5812T>A (p.Tyr1938Asn) rs786203668
NM_000051.3(ATM):c.5816T>A (p.Leu1939Gln) rs1555110340
NM_000051.3(ATM):c.5817A>G (p.Leu1939=) rs749652134
NM_000051.3(ATM):c.5821G>C (p.Val1941Leu) rs147187700
NM_000051.3(ATM):c.5821G>T (p.Val1941Phe)
NM_000051.3(ATM):c.5822T>G (p.Val1941Gly) rs876660334
NM_000051.3(ATM):c.5823T>C (p.Val1941=) rs1555110364
NM_000051.3(ATM):c.5824G>T (p.Ala1942Ser) rs1286443989
NM_000051.3(ATM):c.5825C>T (p.Ala1942Val) rs730881394
NM_000051.3(ATM):c.5828A>G (p.Lys1943Arg) rs746676271
NM_000051.3(ATM):c.5830G>C (p.Val1944Leu) rs1555110379
NM_000051.3(ATM):c.5835T>G (p.Ala1945=) rs768106055
NM_000051.3(ATM):c.5838G>T (p.Gln1946His) rs1060501612
NM_000051.3(ATM):c.5840C>A (p.Ser1947Tyr) rs1555110399
NM_000051.3(ATM):c.5844T>C (p.Cys1948=) rs776150043
NM_000051.3(ATM):c.5845G>T (p.Ala1949Ser) rs1555110401
NM_000051.3(ATM):c.5851C>G (p.His1951Asp) rs1060501673
NM_000051.3(ATM):c.5851C>T (p.His1951Tyr)
NM_000051.3(ATM):c.5852A>C (p.His1951Pro) rs1164569755
NM_000051.3(ATM):c.5853C>T (p.His1951=) rs376169886
NM_000051.3(ATM):c.5853del (p.Phe1952fs) rs1555110418
NM_000051.3(ATM):c.5854T>A (p.Phe1952Ile) rs1555110421
NM_000051.3(ATM):c.5856T>C (p.Phe1952=) rs864622297
NM_000051.3(ATM):c.5858C>G (p.Thr1953Arg)
NM_000051.3(ATM):c.5858C>T (p.Thr1953Ile) rs587781963
NM_000051.3(ATM):c.5859A>G (p.Thr1953=) rs1555110429
NM_000051.3(ATM):c.5861C>G (p.Ala1954Gly) rs1565489916
NM_000051.3(ATM):c.5865A>G (p.Leu1955=) rs1555110432
NM_000051.3(ATM):c.5866C>T (p.Leu1956Phe) rs1565489956
NM_000051.3(ATM):c.5867T>A (p.Leu1956His) rs876658989
NM_000051.3(ATM):c.5868C>T (p.Leu1956=) rs540054724
NM_000051.3(ATM):c.5870_5871del (p.Tyr1957fs) rs1060501657
NM_000051.3(ATM):c.5876A>G (p.Glu1959Gly) rs876660515
NM_000051.3(ATM):c.5879T>A (p.Ile1960Asn) rs587782503
NM_000051.3(ATM):c.5880C>G (p.Ile1960Met) rs1555110464
NM_000051.3(ATM):c.5882A>G (p.Tyr1961Cys) rs56399311
NM_000051.3(ATM):c.5886A>G (p.Ala1962=) rs1057522876
NM_000051.3(ATM):c.5887G>A (p.Asp1963Asn) rs864622148
NM_000051.3(ATM):c.5888A>G (p.Asp1963Gly) rs1555110484
NM_000051.3(ATM):c.5889T>C (p.Asp1963=) rs1555110490
NM_000051.3(ATM):c.5890A>G (p.Lys1964Glu) rs201963507
NM_000051.3(ATM):c.5890A>T (p.Lys1964Ter) rs201963507
NM_000051.3(ATM):c.5891A>G (p.Lys1964Arg) rs1555110503
NM_000051.3(ATM):c.5892G>C (p.Lys1964Asn) rs786202728
NM_000051.3(ATM):c.5893_5897del (p.Lys1965fs) rs587781727
NM_000051.3(ATM):c.5894_5900dup (p.Met1967fs) rs1555110517
NM_000051.3(ATM):c.5895A>T (p.Lys1965Asn) rs1565490147
NM_000051.3(ATM):c.5896dup (p.Ser1966fs) rs1555110514
NM_000051.3(ATM):c.5897G>A (p.Ser1966Asn) rs1555110520
NM_000051.3(ATM):c.5899A>G (p.Met1967Val) rs1060501541
NM_000051.3(ATM):c.5902_5903insSVA (p.Asp1968delinsXaaAsn)
NM_000051.3(ATM):c.5904T>C (p.Asp1968=) rs1555110549
NM_000051.3(ATM):c.5908C>T (p.Gln1970Ter) rs587781722
NM_000051.3(ATM):c.5909A>G (p.Gln1970Arg) rs1555110568
NM_000051.3(ATM):c.5910del (p.Glu1971fs) rs587782198
NM_000051.3(ATM):c.5912A>T (p.Glu1971Val) rs1565490253
NM_000051.3(ATM):c.5914A>G (p.Lys1972Glu) rs1060501652
NM_000051.3(ATM):c.5915A>C (p.Lys1972Thr) rs730881377
NM_000051.3(ATM):c.5917A>G (p.Arg1973Gly) rs786202089
NM_000051.3(ATM):c.5918+103G>A rs45569338
NM_000051.3(ATM):c.5918+16A>G rs3092911
NM_000051.3(ATM):c.5918+1G>A
NM_000051.3(ATM):c.5918+3A>G rs1555110595
NM_000051.3(ATM):c.5918+500T>G rs184838931
NM_000051.3(ATM):c.5918+72A>G rs3218694
NM_000051.3(ATM):c.5918+7G>A rs1423323603
NM_000051.3(ATM):c.5918+8A>C rs1401825950
NM_000051.3(ATM):c.5918G>A (p.Arg1973Lys) rs1555110591
NM_000051.3(ATM):c.5919-10T>C rs1565493312
NM_000051.3(ATM):c.5919-11G>A rs1555111746
NM_000051.3(ATM):c.5919-13T>C rs1555111740
NM_000051.3(ATM):c.5919-18T>G rs113087586
NM_000051.3(ATM):c.5919-2A>C rs746623393
NM_000051.3(ATM):c.5919-2A>G rs746623393
NM_000051.3(ATM):c.5919-8A>G rs1176654682
NM_000051.3(ATM):c.5927C>T (p.Ala1976Val) rs1197973623
NM_000051.3(ATM):c.5930T>C (p.Phe1977Ser) rs780867575
NM_000051.3(ATM):c.5931del (p.Phe1977fs) rs1565493368
NM_000051.3(ATM):c.5932G>T (p.Glu1978Ter) rs587779852
NM_000051.3(ATM):c.5934A>C (p.Glu1978Asp) rs945198632
NM_000051.3(ATM):c.5935G>T (p.Glu1979Ter) rs1555111763
NM_000051.3(ATM):c.5938G>A (p.Gly1980Arg) rs786203765
NM_000051.3(ATM):c.5943C>T (p.Ser1981=) rs769252226
NM_000051.3(ATM):c.5944C>T (p.Gln1982Ter) rs1555111775
NM_000051.3(ATM):c.5945A>G (p.Gln1982Arg) rs543980602
NM_000051.3(ATM):c.5945A>T (p.Gln1982Leu) rs543980602
NM_000051.3(ATM):c.5947dup (p.Ser1983fs) rs879254271
NM_000051.3(ATM):c.5948= (p.Ser1983=) rs659243
NM_000051.3(ATM):c.5948G>A (p.Ser1983Asn) rs659243
NM_000051.3(ATM):c.5950A>T (p.Thr1984Ser) rs1060501603
NM_000051.3(ATM):c.5951C>G (p.Thr1984Arg) rs770722380
NM_000051.3(ATM):c.5953A>G (p.Thr1985Ala) rs879254252
NM_000051.3(ATM):c.5955T>C (p.Thr1985=) rs1555111801
NM_000051.3(ATM):c.5956A>G (p.Ile1986Val) rs876660935
NM_000051.3(ATM):c.5959dup (p.Ser1987fs) rs1555111808
NM_000051.3(ATM):c.5961T>C (p.Ser1987=) rs1060504265
NM_000051.3(ATM):c.5961T>G (p.Ser1987=) rs1060504265
NM_000051.3(ATM):c.5964C>G (p.Ser1988Arg) rs774260725
NM_000051.3(ATM):c.5964C>T (p.Ser1988=) rs774260725
NM_000051.3(ATM):c.5966T>G (p.Leu1989Trp) rs1565493603
NM_000051.3(ATM):c.5967G>A (p.Leu1989=) rs1555111833
NM_000051.3(ATM):c.5971G>A (p.Glu1991Lys) rs786203404
NM_000051.3(ATM):c.5971G>T (p.Glu1991Ter) rs786203404
NM_000051.3(ATM):c.5971dup (p.Glu1991fs)
NM_000051.3(ATM):c.5972A>G (p.Glu1991Gly)
NM_000051.3(ATM):c.5973A>C (p.Glu1991Asp) rs587782274
NM_000051.3(ATM):c.5975A>C (p.Lys1992Thr) rs150757822
NM_000051.3(ATM):c.5975A>G (p.Lys1992Arg) rs150757822
NM_000051.3(ATM):c.5977A>C (p.Ser1993Arg)
NM_000051.3(ATM):c.5979_5983del (p.Ser1993fs) rs876660134
NM_000051.3(ATM):c.5980A>T (p.Lys1994Ter) rs1565493693
NM_000051.3(ATM):c.5980_5986delinsTAAGAAA (p.Lys1994_Glu1996delinsTer) rs1555111868
NM_000051.3(ATM):c.5982del (p.Glu1995fs) rs1555111855
NM_000051.3(ATM):c.5982dup (p.Glu1995fs) rs1555111855
NM_000051.3(ATM):c.5983G>A (p.Glu1995Lys) rs1555111886
NM_000051.3(ATM):c.5983_5985GAA[1] (p.Glu1996del) rs1555111872
NM_000051.3(ATM):c.5993G>T (p.Gly1998Val) rs1188125296
NM_000051.3(ATM):c.5994A>T (p.Gly1998=) rs56046250
NM_000051.3(ATM):c.5995A>G (p.Ile1999Val) rs1201228506
NM_000051.3(ATM):c.5999G>A (p.Ser2000Asn) rs775921052
NM_000051.3(ATM):c.6002T>C (p.Leu2001Ser) rs1555111910
NM_000051.3(ATM):c.6002T>G (p.Leu2001Ter) rs1555111910
NM_000051.3(ATM):c.6003A>G (p.Leu2001=) rs1057523413
NM_000051.3(ATM):c.6004C>T (p.Gln2002Ter) rs201136510
NM_000051.3(ATM):c.6006+11G>A rs1466545116
NM_000051.3(ATM):c.6006+11G>C rs1466545116
NM_000051.3(ATM):c.6006+13G>C rs368207631
NM_000051.3(ATM):c.6006+1G>A rs786202016
NM_000051.3(ATM):c.6006+1G>C rs786202016
NM_000051.3(ATM):c.6006+4_6006+5delAA rs879254108
NM_000051.3(ATM):c.6006+6T>C rs1565493858
NM_000051.3(ATM):c.6006+7A>G rs1060504289
NM_000051.3(ATM):c.6006+8T>C rs56019194
NM_000051.3(ATM):c.6006G>C (p.Gln2002His)
NM_000051.3(ATM):c.6007-10A>G rs373395916
NM_000051.3(ATM):c.6007-19G>A rs1304200112
NM_000051.3(ATM):c.6007-5T>C rs863224294
NM_000051.3(ATM):c.6007-8G>A rs1057524058
NM_000051.3(ATM):c.6007-9T>C
NM_000051.3(ATM):c.6007G>A (p.Asp2003Asn) rs730881378
NM_000051.3(ATM):c.6007_6029dup rs1565498646
NM_000051.3(ATM):c.6007dup (p.Asp2003Glyfs) rs1555113505
NM_000051.3(ATM):c.6009T>C (p.Asp2003=) rs878853526
NM_000051.3(ATM):c.6009T>G (p.Asp2003Glu) rs878853526
NM_000051.3(ATM):c.6010C>A (p.Leu2004Ile) rs1060501561
NM_000051.3(ATM):c.6010C>T (p.Leu2004Phe) rs1060501561
NM_000051.3(ATM):c.6011T>G (p.Leu2004Arg) rs1064795932
NM_000051.3(ATM):c.6012T>C (p.Leu2004=) rs1324998068
NM_000051.3(ATM):c.6012T>G (p.Leu2004=) rs1324998068
NM_000051.3(ATM):c.6013delinsAA (p.Leu2005fs) rs1555113523
NM_000051.3(ATM):c.6015dup (p.Glu2007fs) rs1438576066
NM_000051.3(ATM):c.6016T>G (p.Leu2006Val) rs1555113531
NM_000051.3(ATM):c.6018A>G (p.Leu2006=) rs876659301
NM_000051.3(ATM):c.6020A>C (p.Glu2007Ala) rs762001297
NM_000051.3(ATM):c.6021A>T (p.Glu2007Asp) rs1555113549
NM_000051.3(ATM):c.6023T>C (p.Ile2008Thr) rs876660227
NM_000051.3(ATM):c.6025T>C (p.Tyr2009His) rs199586999
NM_000051.3(ATM):c.6027C>G (p.Tyr2009Ter) rs1555113567
NM_000051.3(ATM):c.6036A>G (p.Ile2012Met)
NM_000051.3(ATM):c.6040G>C (p.Glu2014Gln) rs375783941
NM_000051.3(ATM):c.6040G>T (p.Glu2014Ter) rs375783941
NM_000051.3(ATM):c.6042G>A (p.Glu2014=) rs138987778
NM_000051.3(ATM):c.6044_6046delinsTTATACTTCTCTTAGAAATCTACAGAAGT (p.Pro2015fs) rs1565498886
NM_000051.3(ATM):c.6047A>G (p.Asp2016Gly) rs587781302
NM_000051.3(ATM):c.6047A>T (p.Asp2016Val) rs587781302
NM_000051.3(ATM):c.6049_6052del (p.Ser2017fs)
NM_000051.3(ATM):c.6049dup (p.Ser2017fs) rs797045030
NM_000051.3(ATM):c.6050_6057delinsTA (p.Ser2017_Tyr2019delinsIle) rs1565498913
NM_000051.3(ATM):c.6053T>C (p.Leu2018Ser) rs755694394
NM_000051.3(ATM):c.6056A>G (p.Tyr2019Cys) rs876658415
NM_000051.3(ATM):c.6057T>C (p.Tyr2019=) rs777534711
NM_000051.3(ATM):c.6059del (p.Gly2020fs) rs1064794166
NM_000051.3(ATM):c.6061T>C (p.Cys2021Arg)
NM_000051.3(ATM):c.6062G>A (p.Cys2021Tyr) rs876660062
NM_000051.3(ATM):c.6067G>A (p.Gly2023Arg) rs11212587
NM_000051.3(ATM):c.6068G>A (p.Gly2023Glu) rs1486220915
NM_000051.3(ATM):c.6070G>A (p.Gly2024Arg) rs1565499041
NM_000051.3(ATM):c.6071G>A (p.Gly2024Glu) rs1060501564
NM_000051.3(ATM):c.6078G>A (p.Met2026Ile) rs369349023
NM_000051.3(ATM):c.6080del (p.Leu2027fs) rs1060501548
NM_000051.3(ATM):c.6082C>A (p.Gln2028Lys) rs876659454
NM_000051.3(ATM):c.6082C>G (p.Gln2028Glu)
NM_000051.3(ATM):c.6082C>T (p.Gln2028Ter) rs876659454
NM_000051.3(ATM):c.6082del (p.Gln2028fs) rs1565499093
NM_000051.3(ATM):c.6086C>T (p.Pro2029Leu) rs863224575
NM_000051.3(ATM):c.6087C>G (p.Pro2029=) rs1060504316
NM_000051.3(ATM):c.6087C>T (p.Pro2029=) rs1060504316
NM_000051.3(ATM):c.6088A>G (p.Ile2030Val) rs145847315
NM_000051.3(ATM):c.6090dup (p.Thr2031fs) rs1565499148
NM_000051.3(ATM):c.6092C>T (p.Thr2031Ile) rs1555113613
NM_000051.3(ATM):c.6095+15T>C rs3212321
NM_000051.3(ATM):c.6095+1G>A rs587781584
NM_000051.3(ATM):c.6095+2T>C rs1057516525
NM_000051.3(ATM):c.6095+4A>C
NM_000051.3(ATM):c.6095+4A>G rs1555113632
NM_000051.3(ATM):c.6095+5A>G rs757328753
NM_000051.3(ATM):c.6095+5delA rs1555113628
NM_000051.3(ATM):c.6095+6T>A rs1057522992
NM_000051.3(ATM):c.6095+6T>C rs1057522992
NM_000051.3(ATM):c.6095+8G>T rs547072690
NM_000051.3(ATM):c.6095G>A (p.Arg2032Lys) rs139770721
NM_000051.3(ATM):c.6096-12C>A rs781200134
NM_000051.3(ATM):c.6096-14A>G rs184029731
NM_000051.3(ATM):c.6096-1G>C
NM_000051.3(ATM):c.6096-20T>C rs746766702
NM_000051.3(ATM):c.6096-2A>G rs1057520704
NM_000051.3(ATM):c.6096-3T>C rs748380897
NM_000051.3(ATM):c.6096-9_6096-5delTTCTT rs879254095
NM_000051.3(ATM):c.6097C>T (p.Leu2033=) rs769813736
NM_000051.3(ATM):c.6098T>C (p.Leu2033Pro) rs876660681
NM_000051.3(ATM):c.6099A>G (p.Leu2033=) rs1057521275
NM_000051.3(ATM):c.6100C>A (p.Arg2034=) rs532480170
NM_000051.3(ATM):c.6100C>T (p.Arg2034Ter) rs532480170
NM_000051.3(ATM):c.6101G>A (p.Arg2034Gln) rs3218670
NM_000051.3(ATM):c.6103A>G (p.Thr2035Ala) rs876659555
NM_000051.3(ATM):c.6105A>G (p.Thr2035=) rs1555113708
NM_000051.3(ATM):c.6106T>G (p.Tyr2036Asp)
NM_000051.3(ATM):c.6107A>G (p.Tyr2036Cys) rs786204141
NM_000051.3(ATM):c.6108T>A (p.Tyr2036Ter)
NM_000051.3(ATM):c.6108T>C (p.Tyr2036=) rs3092826
NM_000051.3(ATM):c.6108T>G (p.Tyr2036Ter)
NM_000051.3(ATM):c.6112C>A (p.His2038Asn) rs1060501643
NM_000051.3(ATM):c.6114C>A (p.His2038Gln) rs774993357
NM_000051.3(ATM):c.6114C>G (p.His2038Gln) rs774993357
NM_000051.3(ATM):c.6114C>T (p.His2038=) rs774993357
NM_000051.3(ATM):c.6115G>A (p.Glu2039Lys) rs864622251
NM_000051.3(ATM):c.6115G>T (p.Glu2039Ter) rs864622251
NM_000051.3(ATM):c.6116A>G (p.Glu2039Gly) rs876659558
NM_000051.3(ATM):c.6116A>T (p.Glu2039Val) rs876659558
NM_000051.3(ATM):c.6118G>C (p.Ala2040Pro) rs863224576
NM_000051.3(ATM):c.6118_6119delinsAT (p.Ala2040Ile) rs1555113730
NM_000051.3(ATM):c.6119C>T (p.Ala2040Val) rs1299506506
NM_000051.3(ATM):c.6120A>G (p.Ala2040=) rs1565499622
NM_000051.3(ATM):c.6121A>G (p.Met2041Val) rs759753186
NM_000051.3(ATM):c.6122T>C (p.Met2041Thr) rs1000032847
NM_000051.3(ATM):c.6123G>T (p.Met2041Ile) rs1555113740
NM_000051.3(ATM):c.6124T>C (p.Trp2042Arg)
NM_000051.3(ATM):c.6125G>T (p.Trp2042Leu) rs1565499657
NM_000051.3(ATM):c.6127G>A (p.Gly2043Ser) rs767939328
NM_000051.3(ATM):c.6127_6136delinsT (p.Gly2043_Ala2045del) rs1064792941
NM_000051.3(ATM):c.6128G>T (p.Gly2043Val)
NM_000051.3(ATM):c.6133del (p.Ala2045fs) rs1555113762
NM_000051.3(ATM):c.6134C>A (p.Ala2045Asp) rs879254147
NM_000051.3(ATM):c.6135C>T (p.Ala2045=) rs1555113771
NM_000051.3(ATM):c.6136C>G (p.Leu2046Val)
NM_000051.3(ATM):c.6139_6141dup (p.Val2047dup)
NM_000051.3(ATM):c.6140T>G (p.Val2047Gly) rs878853528
NM_000051.3(ATM):c.6141A>G (p.Val2047=) rs978540099
NM_000051.3(ATM):c.6144A>G (p.Thr2048=) rs1201081443
NM_000051.3(ATM):c.6144_6145AT[1] (p.Thr2048_Tyr2049insTer) rs1565499757
NM_000051.3(ATM):c.6145T>G (p.Tyr2049Asp) rs786203767
NM_000051.3(ATM):c.6146A>G (p.Tyr2049Cys)
NM_000051.3(ATM):c.6147T>C (p.Tyr2049=) rs369940136
NM_000051.3(ATM):c.6150C>T (p.Asp2050=) rs1057520805
NM_000051.3(ATM):c.6153C>T (p.Leu2051=) rs876658452
NM_000051.3(ATM):c.6154G>A (p.Glu2052Lys) rs202206540
NM_000051.3(ATM):c.6160G>T (p.Ala2054Ser) rs587779853
NM_000051.3(ATM):c.6163A>G (p.Ile2055Val) rs758038580
NM_000051.3(ATM):c.6163_6165del (p.Ile2055del) rs1565499855
NM_000051.3(ATM):c.6165C>A (p.Ile2055=) rs779848229
NM_000051.3(ATM):c.6167C>T (p.Pro2056Leu) rs1565499875
NM_000051.3(ATM):c.6168C>T (p.Pro2056=) rs1057520449
NM_000051.3(ATM):c.6169_6171TCA[1] (p.Ser2058del) rs1555113809
NM_000051.3(ATM):c.6173C>T (p.Ser2058Leu) rs1555113821
NM_000051.3(ATM):c.6176C>T (p.Thr2059Ile) rs144761622
NM_000051.3(ATM):c.6177dup (p.Arg2060fs)
NM_000051.3(ATM):c.6178C>A (p.Arg2060Ser) rs587778078
NM_000051.3(ATM):c.6178C>T (p.Arg2060Cys) rs587778078
NM_000051.3(ATM):c.6179G>A (p.Arg2060His) rs376521407
NM_000051.3(ATM):c.6179G>C (p.Arg2060Pro) rs376521407
NM_000051.3(ATM):c.6179G>T (p.Arg2060Leu) rs376521407
NM_000051.3(ATM):c.6181C>T (p.Gln2061Ter) rs1555113845
NM_000051.3(ATM):c.6185C>A (p.Ala2062Glu) rs1565499989
NM_000051.3(ATM):c.6188G>A (p.Gly2063Glu) rs866290641
NM_000051.3(ATM):c.6188G>C (p.Gly2063Ala) rs866290641
NM_000051.3(ATM):c.6191T>C (p.Ile2064Thr) rs1555113854
NM_000051.3(ATM):c.6192C>A (p.Ile2064=) rs876659831
NM_000051.3(ATM):c.6194T>C (p.Ile2065Thr) rs372838622
NM_000051.3(ATM):c.6196C>G (p.Gln2066Glu) rs1361215494
NM_000051.3(ATM):c.6197A>G (p.Gln2066Arg) rs1565500074
NM_000051.3(ATM):c.6198+116T>C
NM_000051.3(ATM):c.6198+11T>C rs774664615
NM_000051.3(ATM):c.6198+130G>A
NM_000051.3(ATM):c.6198+1G>A rs778031266
NM_000051.3(ATM):c.6198+2T>C rs1555113882
NM_000051.3(ATM):c.6198+3A>G rs786202092
NM_000051.3(ATM):c.6198+4C>T rs749370650
NM_000051.3(ATM):c.6198+5A>G rs771047560
NM_000051.3(ATM):c.6198G>A (p.Gln2066=) rs786203341
NM_000051.3(ATM):c.6198G>C (p.Gln2066His) rs786203341
NM_000051.3(ATM):c.6199-17A>C rs1555114516
NM_000051.3(ATM):c.6199-18_6199-15delAAAA rs777036353
NM_000051.3(ATM):c.6199-1G>T
NM_000051.3(ATM):c.6199-24_6199-19delAAAAAC rs1360645587
NM_000051.3(ATM):c.6199-2A>T rs1060501570
NM_000051.3(ATM):c.6199-2delA rs1555114545
NM_000051.3(ATM):c.6199-3T>C rs1318760213
NM_000051.3(ATM):c.6199-3delT rs762251357
NM_000051.3(ATM):c.6199-5T>A rs1555114533
NM_000051.3(ATM):c.6199-7T>A rs1060501631
NM_000051.3(ATM):c.6199-9C>A rs1060501611
NM_000051.3(ATM):c.6199G>A (p.Ala2067Thr) rs1555114549
NM_000051.3(ATM):c.6200C>A (p.Ala2067Asp) rs397514577
NM_000051.3(ATM):c.6203T>C (p.Leu2068Ser) rs1555114558
NM_000051.3(ATM):c.6205C>G (p.Gln2069Glu) rs1555114563
NM_000051.3(ATM):c.6211T>C (p.Leu2071=) rs928129862
NM_000051.3(ATM):c.6214G>A (p.Gly2072Arg) rs1555114568
NM_000051.3(ATM):c.6215G>C (p.Gly2072Ala) rs1183544857
NM_000051.3(ATM):c.6217C>G (p.Leu2073Val) rs767406075
NM_000051.3(ATM):c.6217C>T (p.Leu2073Phe) rs767406075
NM_000051.3(ATM):c.6218T>C (p.Leu2073Pro) rs1555114582
NM_000051.3(ATM):c.6219C>G (p.Leu2073=) rs752478345
NM_000051.3(ATM):c.6219C>T (p.Leu2073=) rs752478345
NM_000051.3(ATM):c.6222C>A (p.Cys2074Ter) rs1565502708
NM_000051.3(ATM):c.6224A>G (p.His2075Arg) rs1555114602
NM_000051.3(ATM):c.6226A>G (p.Ile2076Val) rs755973863
NM_000051.3(ATM):c.6228del (p.Leu2077fs) rs786203008
NM_000051.3(ATM):c.6229C>G (p.Leu2077Val)
NM_000051.3(ATM):c.6232T>C (p.Ser2078Pro) rs587779854
NM_000051.3(ATM):c.6233C>T (p.Ser2078Phe) rs786204173
NM_000051.3(ATM):c.6234C>T (p.Ser2078=) rs569483748
NM_000051.3(ATM):c.6235G>A (p.Val2079Ile) rs1800060
NM_000051.3(ATM):c.6235_6236insAAG (p.Val2079_Tyr2080insGlu)
NM_000051.3(ATM):c.6237_6238del (p.Tyr2080fs) rs1555114623
NM_000051.3(ATM):c.6238T>G (p.Tyr2080Asp) rs1064795467
NM_000051.3(ATM):c.6239A>G (p.Tyr2080Cys) rs587779855
NM_000051.3(ATM):c.6239_6240del (p.Tyr2080fs) rs878853529
NM_000051.3(ATM):c.6244A>G (p.Lys2082Glu) rs1239942908
NM_000051.3(ATM):c.6246A>G (p.Lys2082=) rs745977589
NM_000051.3(ATM):c.6246A>T (p.Lys2082Asn)
NM_000051.3(ATM):c.6247G>A (p.Gly2083Arg) rs1060501586
NM_000051.3(ATM):c.6248G>A (p.Gly2083Glu) rs1060501559
NM_000051.3(ATM):c.6250T>C (p.Leu2084=) rs772608345
NM_000051.3(ATM):c.6252G>A (p.Leu2084=) rs876658700
NM_000051.3(ATM):c.6253G>C (p.Asp2085His)
NM_000051.3(ATM):c.6253G>T (p.Asp2085Tyr) rs730881379
NM_000051.3(ATM):c.6255T>A (p.Asp2085Glu) rs376898203
NM_000051.3(ATM):c.6256_6261del (p.Tyr2086_Glu2087del) rs1555114670
NM_000051.3(ATM):c.6257A>G (p.Tyr2086Cys) rs730881380
NM_000051.3(ATM):c.6257A>T (p.Tyr2086Phe) rs730881380
NM_000051.3(ATM):c.6258T>G (p.Tyr2086Ter) rs1565502999
NM_000051.3(ATM):c.6260A>G (p.Glu2087Gly) rs1565503023
NM_000051.3(ATM):c.6262A>G (p.Asn2088Asp) rs1205444700
NM_000051.3(ATM):c.6267A>C (p.Lys2089Asn) rs863224577
NM_000051.3(ATM):c.6268G>A (p.Asp2090Asn) rs915524411
NM_000051.3(ATM):c.6269A>C (p.Asp2090Ala) rs1555114696
NM_000051.3(ATM):c.6270C>A (p.Asp2090Glu) rs1565503097
NM_000051.3(ATM):c.6270delinsTT (p.Trp2091fs) rs1555114702
NM_000051.3(ATM):c.6272G>A (p.Trp2091Ter) rs1060501712
NM_000051.3(ATM):c.6273del (p.Trp2091fs) rs1565503137
NM_000051.3(ATM):c.6274T>G (p.Cys2092Gly) rs1555114711
NM_000051.3(ATM):c.6277C>T (p.Pro2093Ser) rs946942912
NM_000051.3(ATM):c.6280G>T (p.Glu2094Ter) rs1565503182
NM_000051.3(ATM):c.6280del (p.Glu2094fs) rs1565503198
NM_000051.3(ATM):c.6283_6288del (p.Leu2095_Glu2096del) rs1565503206
NM_000051.3(ATM):c.6285A>G (p.Leu2095=) rs1555114732
NM_000051.3(ATM):c.6287A>G (p.Glu2096Gly) rs1565503246
NM_000051.3(ATM):c.6289G>T (p.Glu2097Ter) rs1555114737
NM_000051.3(ATM):c.6291A>T (p.Glu2097Asp) rs1555114739
NM_000051.3(ATM):c.6293T>C (p.Leu2098Pro) rs587780631
NM_000051.3(ATM):c.6293T>G (p.Leu2098Arg)
NM_000051.3(ATM):c.6296A>G (p.His2099Arg) rs587782802
NM_000051.3(ATM):c.6298T>C (p.Tyr2100His) rs1555114752
NM_000051.3(ATM):c.6301C>G (p.Gln2101Glu) rs876660164
NM_000051.3(ATM):c.6302A>C (p.Gln2101Pro) rs1565503316
NM_000051.3(ATM):c.6303A>G (p.Gln2101=) rs876659325
NM_000051.3(ATM):c.6304G>A (p.Ala2102Thr) rs1565503340
NM_000051.3(ATM):c.6304G>C (p.Ala2102Pro) rs1565503340
NM_000051.3(ATM):c.6311G>A (p.Trp2104Ter)
NM_000051.3(ATM):c.6311G>C (p.Trp2104Ser) rs1064794143
NM_000051.3(ATM):c.6312G>A (p.Trp2104Ter) rs1555114766
NM_000051.3(ATM):c.6313A>G (p.Arg2105Gly) rs879253983
NM_000051.3(ATM):c.6313A>T (p.Arg2105Trp) rs879253983
NM_000051.3(ATM):c.6315G>C (p.Arg2105Ser) rs587780632
NM_000051.3(ATM):c.6317A>T (p.Asn2106Ile) rs587780633
NM_000051.3(ATM):c.6318T>C (p.Asn2106=) rs864622730
NM_000051.3(ATM):c.6320T>C (p.Met2107Thr) rs1555114792
NM_000051.3(ATM):c.6323A>C (p.Gln2108Pro)
NM_000051.3(ATM):c.6323A>G (p.Gln2108Arg) rs773891864
NM_000051.3(ATM):c.6325T>G (p.Trp2109Gly) rs1060501654
NM_000051.3(ATM):c.6325dup (p.Trp2109fs) rs1555114812
NM_000051.3(ATM):c.6326G>A (p.Trp2109Ter) rs587782114
NM_000051.3(ATM):c.6327G>A (p.Trp2109Ter) rs867760244
NM_000051.3(ATM):c.6330C>G (p.Asp2110Glu) rs759029705
NM_000051.3(ATM):c.6330C>T (p.Asp2110=) rs759029705
NM_000051.3(ATM):c.6332A>G (p.His2111Arg) rs876658300
NM_000051.3(ATM):c.6333T>C (p.His2111=) rs55756349
NM_000051.3(ATM):c.6335G>T (p.Cys2112Phe)
NM_000051.3(ATM):c.6336C>T (p.Cys2112=) rs755845798
NM_000051.3(ATM):c.6337A>G (p.Thr2113Ala) rs1555114835
NM_000051.3(ATM):c.6338C>G (p.Thr2113Ser) rs573290117
NM_000051.3(ATM):c.6341C>A (p.Ser2114Tyr)
NM_000051.3(ATM):c.6342C>T (p.Ser2114=) rs754020535
NM_000051.3(ATM):c.6343G>A (p.Val2115Ile) rs587780634
NM_000051.3(ATM):c.6343G>C (p.Val2115Leu) rs587780634
NM_000051.3(ATM):c.6347+17G>C rs1263673522
NM_000051.3(ATM):c.6347+1G>A rs1057517120
NM_000051.3(ATM):c.6347+31del rs58978479
NM_000051.3(ATM):c.6347+3A>G rs1555114854
NM_000051.3(ATM):c.6347+4A>G rs1342227995
NM_000051.3(ATM):c.6347+6A>C rs750501197
NM_000051.3(ATM):c.6348-11T>G rs1555116339
NM_000051.3(ATM):c.6348-12C>T rs1057521664
NM_000051.3(ATM):c.6348-1G>A rs1057517302
NM_000051.3(ATM):c.6348-252T>C
NM_000051.3(ATM):c.6348-2A>G rs864622367
NM_000051.3(ATM):c.6348-3C>T rs946541820
NM_000051.3(ATM):c.6348-3_6348-2delCA rs1565508595
NM_000051.3(ATM):c.6348-54T>C
NM_000051.3(ATM):c.6348-8T>C rs730881292
NM_000051.3(ATM):c.6348-9A>T
NM_000051.3(ATM):c.6352del (p.Glu2118fs) rs1555116357
NM_000051.3(ATM):c.6355G>T (p.Val2119Leu) rs1266938537
NM_000051.3(ATM):c.6357A>G (p.Val2119=) rs1060504295
NM_000051.3(ATM):c.6357A>T (p.Val2119=) rs1060504295
NM_000051.3(ATM):c.6360A>T (p.Glu2120Asp) rs1565508657
NM_000051.3(ATM):c.6365C>G (p.Thr2122Ser) rs1555116369
NM_000051.3(ATM):c.6367A>G (p.Ser2123Gly) rs876659773
NM_000051.3(ATM):c.6368G>C (p.Ser2123Thr)
NM_000051.3(ATM):c.6368G>T (p.Ser2123Ile) rs1064794104
NM_000051.3(ATM):c.6369_6370del (p.Ser2123fs) rs1555116381
NM_000051.3(ATM):c.6373C>T (p.His2125Tyr) rs1201879809
NM_000051.3(ATM):c.6373del (p.His2125fs) rs878853530
NM_000051.3(ATM):c.6374A>G (p.His2125Arg) rs730881381
NM_000051.3(ATM):c.6374A>T (p.His2125Leu) rs730881381
NM_000051.3(ATM):c.6376G>A (p.Glu2126Lys) rs1555116399
NM_000051.3(ATM):c.6378A>G (p.Glu2126=) rs1060504297
NM_000051.3(ATM):c.6381A>G (p.Ser2127=) rs1555116408
NM_000051.3(ATM):c.6382T>C (p.Leu2128=) rs753646931
NM_000051.3(ATM):c.6383T>C (p.Leu2128Ser) rs1565508867
NM_000051.3(ATM):c.6384G>C (p.Leu2128Phe) rs1060501629
NM_000051.3(ATM):c.6384del (p.Leu2128fs) rs1555116427
NM_000051.3(ATM):c.6385T>C (p.Tyr2129His) rs876658542
NM_000051.3(ATM):c.6385T>G (p.Tyr2129Asp) rs876658542
NM_000051.3(ATM):c.6390T>C (p.Asn2130=) rs1555116433
NM_000051.3(ATM):c.6392C>A (p.Ala2131Asp) rs1060501594
NM_000051.3(ATM):c.6394C>T (p.Leu2132=) rs551408889
NM_000051.3(ATM):c.6396A>G (p.Leu2132=) rs370537345
NM_000051.3(ATM):c.6397C>T (p.Gln2133Ter) rs876658163
NM_000051.3(ATM):c.6399A>G (p.Gln2133=) rs750614487
NM_000051.3(ATM):c.6399del (p.Gln2133fs) rs1555116451
NM_000051.3(ATM):c.6399dup (p.Ser2134fs) rs1555116451
NM_000051.3(ATM):c.6400T>C (p.Ser2134Pro) rs758446561
NM_000051.3(ATM):c.6403_6404insCT (p.Leu2135fs) rs1555116468
NM_000051.3(ATM):c.6404T>C (p.Leu2135Pro)
NM_000051.3(ATM):c.6404_6405insTT (p.Leu2135_Arg2136insTer) rs587782554
NM_000051.3(ATM):c.6404dup (p.Arg2136fs) rs587782554
NM_000051.3(ATM):c.6409G>A (p.Asp2137Asn) rs1389038955
NM_000051.3(ATM):c.6411C>G (p.Asp2137Glu) rs780299607
NM_000051.3(ATM):c.6412A>G (p.Arg2138Gly) rs752069869
NM_000051.3(ATM):c.6413_6414GA[1] (p.Glu2139fs) rs863225466
NM_000051.3(ATM):c.6415G>T (p.Glu2139Ter)
NM_000051.3(ATM):c.6418T>C (p.Phe2140Leu) rs1397647612
NM_000051.3(ATM):c.6419T>G (p.Phe2140Cys) rs1297621371
NM_000051.3(ATM):c.6420C>A (p.Phe2140Leu) rs587780635
NM_000051.3(ATM):c.6424A>G (p.Thr2142Ala) rs1263398076
NM_000051.3(ATM):c.6431A>G (p.Tyr2144Cys) rs1555116507
NM_000051.3(ATM):c.6433_6445del (p.Glu2145fs) rs786202264
NM_000051.3(ATM):c.6434A>C (p.Glu2145Ala) rs1255710647
NM_000051.3(ATM):c.6435_6436del (p.Leu2147fs) rs786202323
NM_000051.3(ATM):c.6436dup (p.Ser2146fs) rs786202323
NM_000051.3(ATM):c.6437G>C (p.Ser2146Thr) rs56815840
NM_000051.3(ATM):c.6438T>A (p.Ser2146Arg) rs748544160
NM_000051.3(ATM):c.6441C>T (p.Leu2147=) rs1292833282
NM_000051.3(ATM):c.6443A>C (p.Lys2148Thr)
NM_000051.3(ATM):c.6443A>G (p.Lys2148Arg) rs730881382
NM_000051.3(ATM):c.6443A>T (p.Lys2148Ile) rs730881382
NM_000051.3(ATM):c.6444dup (p.Tyr2149fs) rs1555116533
NM_000051.3(ATM):c.6447T>C (p.Tyr2149=) rs1057519167
NM_000051.3(ATM):c.6452+13G>A rs760228732
NM_000051.3(ATM):c.6452+17A>C rs371044809
NM_000051.3(ATM):c.6452+17A>G rs371044809
NM_000051.3(ATM):c.6452+1G>T rs1565509194
NM_000051.3(ATM):c.6452+21_6452+22dup rs756886791
NM_000051.3(ATM):c.6452+2T>C rs1064795006
NM_000051.3(ATM):c.6452+5T>A rs533830556
NM_000051.3(ATM):c.6452+6A>G rs878853531
NM_000051.3(ATM):c.6452+6A>T rs878853531
NM_000051.3(ATM):c.6452+7T>C rs1555116551
NM_000051.3(ATM):c.6452+9A>C rs771531015
NM_000051.3(ATM):c.6453-13T>C rs1555117056
NM_000051.3(ATM):c.6453-14T>A rs1380071831
NM_000051.3(ATM):c.6453-15C>A rs763296454
NM_000051.3(ATM):c.6453-15C>T rs763296454
NM_000051.3(ATM):c.6453-17T>G rs1057522251
NM_000051.3(ATM):c.6453-1G>A
NM_000051.3(ATM):c.6453-1G>C rs1555117071
NM_000051.3(ATM):c.6453-3T>C rs768073845
NM_000051.3(ATM):c.6453-5A>G rs755177899
NM_000051.3(ATM):c.6453-8G>C rs751665578
NM_000051.3(ATM):c.6456A>G (p.Val2152=) rs876660014
NM_000051.3(ATM):c.6457A>C (p.Lys2153Gln) rs1386239935
NM_000051.3(ATM):c.6462A>G (p.Glu2154=) rs756453090
NM_000051.3(ATM):c.6463_6478dup (p.Lys2160delinsSerGlyArgAspValTer) rs1555117084
NM_000051.3(ATM):c.6464T>C (p.Val2155Ala) rs1060501532
NM_000051.3(ATM):c.6465G>A (p.Val2155=) rs140423883
NM_000051.3(ATM):c.6466G>A (p.Glu2156Lys) rs1328099740
NM_000051.3(ATM):c.6471G>A (p.Glu2157=) rs1555117097
NM_000051.3(ATM):c.6473T>C (p.Met2158Thr) rs1453101465
NM_000051.3(ATM):c.6474G>A (p.Met2158Ile) rs1565511084
NM_000051.3(ATM):c.6475T>C (p.Cys2159Arg) rs150408832
NM_000051.3(ATM):c.6475T>G (p.Cys2159Gly) rs150408832
NM_000051.3(ATM):c.6477T>G (p.Cys2159Trp) rs587781789
NM_000051.3(ATM):c.6480_6481GC[3] (p.Ser2162fs) rs1057516905
NM_000051.3(ATM):c.6481C>T (p.Arg2161Cys) rs1064793958
NM_000051.3(ATM):c.6482G>A (p.Arg2161His) rs756626462
NM_000051.3(ATM):c.6486C>A (p.Ser2162Arg)
NM_000051.3(ATM):c.6486C>G (p.Ser2162Arg)
NM_000051.3(ATM):c.6486C>T (p.Ser2162=) rs138166710
NM_000051.3(ATM):c.6487C>G (p.Leu2163Val)
NM_000051.3(ATM):c.6490G>A (p.Glu2164Lys) rs1317619286
NM_000051.3(ATM):c.6490G>C (p.Glu2164Gln) rs1317619286
NM_000051.3(ATM):c.6490G>T (p.Glu2164Ter) rs1317619286
NM_000051.3(ATM):c.6491A>T (p.Glu2164Val)
NM_000051.3(ATM):c.6493T>A (p.Ser2165Thr) rs1555117132
NM_000051.3(ATM):c.6496_6497GT[1] (p.Tyr2167fs) rs1060501707
NM_000051.3(ATM):c.6497T>C (p.Val2166Ala) rs1232551114
NM_000051.3(ATM):c.6498G>A (p.Val2166=) rs746514937
NM_000051.3(ATM):c.6500A>G (p.Tyr2167Cys) rs768155385
NM_000051.3(ATM):c.6503C>T (p.Ser2168Leu) rs200431631
NM_000051.3(ATM):c.6504G>A (p.Ser2168=) rs786203522
NM_000051.3(ATM):c.6505C>G (p.Leu2169Val) rs1064794157
NM_000051.3(ATM):c.6505C>T (p.Leu2169Phe) rs1064794157
NM_000051.3(ATM):c.6505_6519del (p.Leu2169_Leu2173del) rs1555117162
NM_000051.3(ATM):c.6506T>C (p.Leu2169Pro)
NM_000051.3(ATM):c.6506T>G (p.Leu2169Arg) rs748054311
NM_000051.3(ATM):c.6507C>G (p.Leu2169=) rs863224295
NM_000051.3(ATM):c.6508T>C (p.Tyr2170His) rs587782327
NM_000051.3(ATM):c.6509A>G (p.Tyr2170Cys) rs1555117171
NM_000051.3(ATM):c.6516A>C (p.Thr2172=) rs576254168
NM_000051.3(ATM):c.6517C>G (p.Leu2173Val) rs1565511354
NM_000051.3(ATM):c.6521G>A (p.Ser2174Asn) rs1470293148
NM_000051.3(ATM):c.6522C>A (p.Ser2174Arg) rs772850740
NM_000051.3(ATM):c.6522C>T (p.Ser2174=)
NM_000051.3(ATM):c.6523dup (p.Arg2175fs)
NM_000051.3(ATM):c.6524G>T (p.Arg2175Met) rs1555117188
NM_000051.3(ATM):c.6525G>A (p.Arg2175=) rs1555117190
NM_000051.3(ATM):c.6526T>C (p.Leu2176=) rs143715818
NM_000051.3(ATM):c.6527T>G (p.Leu2176Trp) rs1555117194
NM_000051.3(ATM):c.6530A>C (p.Gln2177Pro) rs1060501573
NM_000051.3(ATM):c.6534C>T (p.Ala2178=) rs1555117210
NM_000051.3(ATM):c.6536T>C (p.Ile2179Thr) rs878853532
NM_000051.3(ATM):c.6537T>G (p.Ile2179Met) rs146243469
NM_000051.3(ATM):c.6540A>G (p.Gly2180=) rs767516615
NM_000051.3(ATM):c.6543G>T (p.Glu2181Asp) rs138828590
NM_000051.3(ATM):c.6545T>C (p.Leu2182Pro) rs1555117233
NM_000051.3(ATM):c.6550A>G (p.Ser2184Gly) rs764713766
NM_000051.3(ATM):c.6551G>C (p.Ser2184Thr) rs374551964
NM_000051.3(ATM):c.6552C>T (p.Ser2184=) rs565124064
NM_000051.3(ATM):c.6554T>C (p.Ile2185Thr) rs779611511
NM_000051.3(ATM):c.6554T>G (p.Ile2185Ser)
NM_000051.3(ATM):c.6555dup (p.Gly2186fs) rs1565511585
NM_000051.3(ATM):c.6557_6559del (p.Gly2186del) rs1555117257
NM_000051.3(ATM):c.6558G>A (p.Gly2186=) rs1555117263
NM_000051.3(ATM):c.6562C>A (p.Leu2188Ile) rs1060501682
NM_000051.3(ATM):c.6571A>G (p.Arg2191Gly) rs587781861
NM_000051.3(ATM):c.6572+11C>T rs368049107
NM_000051.3(ATM):c.6572+12G>A rs3218677
NM_000051.3(ATM):c.6572+12G>T rs3218677
NM_000051.3(ATM):c.6572+12delG rs1555117290
NM_000051.3(ATM):c.6572+17A>C rs1555117296
NM_000051.3(ATM):c.6572+1G>A rs587779856
NM_000051.3(ATM):c.6572+20_6572+21delTT rs1064793041
NM_000051.3(ATM):c.6572+4T>C rs587780636
NM_000051.3(ATM):c.6572G>C (p.Arg2191Thr) rs1196814221
NM_000051.3(ATM):c.6573-11G>A rs375599653
NM_000051.3(ATM):c.6573-124T>A
NM_000051.3(ATM):c.6573-12C>T rs1057521666
NM_000051.3(ATM):c.6573-16A>G rs764506673
NM_000051.3(ATM):c.6573-16_6573-15delAT rs1064794351
NM_000051.3(ATM):c.6573-17dup rs1565517900
NM_000051.3(ATM):c.6573-2A>G rs751168951
NM_000051.3(ATM):c.6573-41delC
NM_000051.3(ATM):c.6573-8G>A rs1555118989
NM_000051.3(ATM):c.6573-9G>A
NM_000051.3(ATM):c.6573-9G>C
NM_000051.3(ATM):c.6573A>G (p.Arg2191=) rs1565518004
NM_000051.3(ATM):c.6577G>A (p.Val2193Ile) rs754555043
NM_000051.3(ATM):c.6581C>T (p.Thr2194Ile) rs1476384636
NM_000051.3(ATM):c.6583C>T (p.His2195Tyr) rs780946471
NM_000051.3(ATM):c.6584A>G (p.His2195Arg) rs1565518051
NM_000051.3(ATM):c.6585T>C (p.His2195=) rs786203401
NM_000051.3(ATM):c.6585_6586del (p.His2195fs) rs1555119004
NM_000051.3(ATM):c.6586A>T (p.Arg2196Ter) rs1555119011
NM_000051.3(ATM):c.6591A>G (p.Gln2197=) rs863224296
NM_000051.3(ATM):c.6592_6593CT[2] (p.Leu2198_Ser2199insTer) rs747057367
NM_000051.3(ATM):c.6596C>A (p.Ser2199Tyr)
NM_000051.3(ATM):c.6602T>C (p.Val2201Ala) rs876658435
NM_000051.3(ATM):c.6603A>G (p.Val2201=) rs863224297
NM_000051.3(ATM):c.6604T>G (p.Tyr2202Asp) rs730881311
NM_000051.3(ATM):c.6612G>A (p.Lys2204=) rs876660650
NM_000051.3(ATM):c.6613T>C (p.Trp2205Arg) rs755656958
NM_000051.3(ATM):c.6615G>A (p.Trp2205Ter) rs1555119041
NM_000051.3(ATM):c.6615G>T (p.Trp2205Cys) rs1555119041
NM_000051.3(ATM):c.6620A>G (p.Lys2207Arg) rs1565518213
NM_000051.3(ATM):c.6622C>T (p.His2208Tyr) rs1060501641
NM_000051.3(ATM):c.6628del (p.Gln2210fs) rs886039616
NM_000051.3(ATM):c.6629A>C (p.Gln2210Pro) rs1252127806
NM_000051.3(ATM):c.6630G>A (p.Gln2210=) rs777515589
NM_000051.3(ATM):c.6631C>T (p.Leu2211Phe) rs1555119051
NM_000051.3(ATM):c.6633_6634delinsAA (p.Leu2212Ile) rs1555119055
NM_000051.3(ATM):c.6636C>T (p.Leu2212=) rs876659563
NM_000051.3(ATM):c.6639G>A (p.Lys2213=) rs1555119063
NM_000051.3(ATM):c.6643A>G (p.Ser2215Gly) rs730881312
NM_000051.3(ATM):c.6644G>C (p.Ser2215Thr)
NM_000051.3(ATM):c.6645T>G (p.Ser2215Arg) rs1064794485
NM_000051.3(ATM):c.6650T>A (p.Phe2217Tyr) rs876659101
NM_000051.3(ATM):c.6650_6657del (p.Phe2217fs) rs864622326
NM_000051.3(ATM):c.6650_6664del (p.Phe2217_Pro2222delinsSer) rs1555119092
NM_000051.3(ATM):c.6652A>C (p.Ser2218Arg) rs749261367
NM_000051.3(ATM):c.6657del (p.Gln2220fs) rs876658603
NM_000051.3(ATM):c.6658C>T (p.Gln2220Ter) rs1060501536
NM_000051.3(ATM):c.6661G>A (p.Glu2221Lys)
NM_000051.3(ATM):c.6665C>A (p.Pro2222His) rs997021874
NM_000051.3(ATM):c.6667A>G (p.Ile2223Val)
NM_000051.3(ATM):c.6667del (p.Ile2223fs) rs878853533
NM_000051.3(ATM):c.6670A>C (p.Met2224Leu)
NM_000051.3(ATM):c.6670A>G (p.Met2224Val) rs545873723
NM_000051.3(ATM):c.6671T>C (p.Met2224Thr) rs730881313
NM_000051.3(ATM):c.6673G>A (p.Ala2225Thr) rs1555119121
NM_000051.3(ATM):c.6673dup (p.Ala2225fs) rs587781872
NM_000051.3(ATM):c.6677T>C (p.Leu2226Pro) rs1565518489
NM_000051.3(ATM):c.6678A>G (p.Leu2226=) rs772173373
NM_000051.3(ATM):c.6679C>A (p.Arg2227Ser) rs564652222
NM_000051.3(ATM):c.6679C>T (p.Arg2227Cys) rs564652222
NM_000051.3(ATM):c.6680G>A (p.Arg2227His) rs879254132
NM_000051.3(ATM):c.6681C>A (p.Arg2227=) rs775850434
NM_000051.3(ATM):c.6681C>T (p.Arg2227=) rs775850434
NM_000051.3(ATM):c.6681_6682CA[1] (p.Thr2228fs) rs1565518539
NM_000051.3(ATM):c.6686T>A (p.Val2229Asp) rs1555119144
NM_000051.3(ATM):c.6686T>G (p.Val2229Gly) rs1555119144
NM_000051.3(ATM):c.6689T>C (p.Ile2230Thr) rs587781562
NM_000051.3(ATM):c.6697A>C (p.Ile2233Leu)
NM_000051.3(ATM):c.6699C>T (p.Ile2233=) rs1555119149
NM_000051.3(ATM):c.6700C>T (p.Leu2234=) rs760602228
NM_000051.3(ATM):c.6701T>A (p.Leu2234Gln) rs1158183992
NM_000051.3(ATM):c.6703A>G (p.Met2235Val) rs768791795
NM_000051.3(ATM):c.6710A>C (p.Lys2237Thr) rs35118109
NM_000051.3(ATM):c.6717G>T (p.Met2239Ile) rs1555119181
NM_000051.3(ATM):c.6718G>C (p.Asp2240His) rs587782478
NM_000051.3(ATM):c.6722A>C (p.Asn2241Thr)
NM_000051.3(ATM):c.6722A>G (p.Asn2241Ser) rs786202583
NM_000051.3(ATM):c.6723C>T (p.Asn2241=) rs750763671
NM_000051.3(ATM):c.6724T>C (p.Ser2242Pro) rs1309164461
NM_000051.3(ATM):c.6725del (p.Ser2242fs) rs876658394
NM_000051.3(ATM):c.6726A>G (p.Ser2242=) rs878853534
NM_000051.3(ATM):c.6727C>A (p.Gln2243Lys) rs1565518711
NM_000051.3(ATM):c.6728A>C (p.Gln2243Pro) rs1565518723
NM_000051.3(ATM):c.6729_6730del (p.Glu2245fs) rs1060501543
NM_000051.3(ATM):c.6730dup (p.Arg2244fs) rs1060501543
NM_000051.3(ATM):c.6734A>G (p.Glu2245Gly) rs1555119214
NM_000051.3(ATM):c.6736_6755delinsCA (p.Cys2246_Thr2252delinsHis) rs1064794237
NM_000051.3(ATM):c.6739A>C (p.Ile2247Leu) rs587781521
NM_000051.3(ATM):c.6739A>G (p.Ile2247Val) rs587781521
NM_000051.3(ATM):c.6741T>G (p.Ile2247Met) rs876658607
NM_000051.3(ATM):c.6742A>G (p.Lys2248Glu) rs1555119232
NM_000051.3(ATM):c.6743A>C (p.Lys2248Thr)
NM_000051.3(ATM):c.6745G>T (p.Asp2249Tyr) rs1555119235
NM_000051.3(ATM):c.6746A>T (p.Asp2249Val)
NM_000051.3(ATM):c.6747C>T (p.Asp2249=) rs1555119240
NM_000051.3(ATM):c.6748dup (p.Ile2250fs) rs1555119247
NM_000051.3(ATM):c.6752_6755dup (p.Lys2253fs) rs863224461
NM_000051.3(ATM):c.6753C>T (p.Leu2251=) rs1057521515
NM_000051.3(ATM):c.6754del (p.Thr2252fs) rs1064793042
NM_000051.3(ATM):c.6755C>A (p.Thr2252Asn) rs755531586
NM_000051.3(ATM):c.6755C>G (p.Thr2252Ser) rs755531586
NM_000051.3(ATM):c.6757A>C (p.Lys2253Gln) rs863224578
NM_000051.3(ATM):c.6758A>C (p.Lys2253Thr) rs786203332
NM_000051.3(ATM):c.6759A>C (p.Lys2253Asn) rs1060501602
NM_000051.3(ATM):c.6761A>C (p.His2254Pro) rs1565518950
NM_000051.3(ATM):c.6762C>T (p.His2254=) rs563933875
NM_000051.3(ATM):c.6764T>G (p.Leu2255Arg) rs876658966
NM_000051.3(ATM):c.6765T>C (p.Leu2255=) rs587780637
NM_000051.3(ATM):c.6766G>A (p.Val2256Ile) rs1565519006
NM_000051.3(ATM):c.6772_6773CT[2] (p.Ser2259fs) rs1131691156
NM_000051.3(ATM):c.6774C>T (p.Leu2258=) rs1057520450
NM_000051.3(ATM):c.6776C>G (p.Ser2259Cys) rs786202094
NM_000051.3(ATM):c.6777T>C (p.Ser2259=) rs1057522874
NM_000051.3(ATM):c.6778A>G (p.Ile2260Val) rs1365474284
NM_000051.3(ATM):c.6780A>G (p.Ile2260Met) rs1555119325
NM_000051.3(ATM):c.6784G>C (p.Ala2262Pro) rs587781674
NM_000051.3(ATM):c.6785C>A (p.Ala2262Asp) rs876660017
NM_000051.3(ATM):c.6785C>G (p.Ala2262Gly) rs876660017
NM_000051.3(ATM):c.6786_6791del (p.Arg2263_Thr2264del) rs1565519112
NM_000051.3(ATM):c.6792T>A (p.Thr2264=) rs1555119347
NM_000051.3(ATM):c.6794T>G (p.Phe2265Cys) rs1179172483
NM_000051.3(ATM):c.6795C>A (p.Phe2265Leu) rs3218699
NM_000051.3(ATM):c.6795C>G (p.Phe2265Leu) rs3218699
NM_000051.3(ATM):c.6795C>T (p.Phe2265=) rs3218699
NM_000051.3(ATM):c.6797A>G (p.Lys2266Arg)
NM_000051.3(ATM):c.6797_6798delinsC (p.Lys2266fs) rs1555119364
NM_000051.3(ATM):c.6807+10A>G rs924117395
NM_000051.3(ATM):c.6807+20A>G rs369001797
NM_000051.3(ATM):c.6807+20_6807+21delAT rs1555119392
NM_000051.3(ATM):c.6807+238G>C rs609429
NM_000051.3(ATM):c.6807+4A>G rs1555119382
NM_000051.3(ATM):c.6807+8C>A rs1565519254
NM_000051.3(ATM):c.6807+8delC rs1555119385
NM_000051.3(ATM):c.6807G>A (p.Gln2269=) rs587780638
NM_000051.3(ATM):c.6808-18A>T rs1166582977
NM_000051.3(ATM):c.6808-20A>G rs1240565463
NM_000051.3(ATM):c.6808-22C>A rs3218700
NM_000051.3(ATM):c.6808-242_7516-275del
NM_000051.3(ATM):c.6808-60_6808-58delATT rs3212322
NM_000051.3(ATM):c.6808-6T>C rs995574419
NM_000051.3(ATM):c.6810C>T (p.Leu2270=) rs1060504305
NM_000051.3(ATM):c.6813T>C (p.Pro2271=) rs1555119714
NM_000051.3(ATM):c.6814G>A (p.Glu2272Lys) rs886039471
NM_000051.3(ATM):c.6814delinsCA (p.Glu2272fs) rs1565520117
NM_000051.3(ATM):c.6815A>C (p.Glu2272Ala)
NM_000051.3(ATM):c.6815A>G (p.Glu2272Gly) rs1565520129
NM_000051.3(ATM):c.6816A>G (p.Glu2272=) rs1555119726
NM_000051.3(ATM):c.6820G>A (p.Ala2274Thr) rs567060474
NM_000051.3(ATM):c.6820G>T (p.Ala2274Ser) rs567060474
NM_000051.3(ATM):c.6823A>C (p.Ile2275Leu) rs587779857
NM_000051.3(ATM):c.6823A>G (p.Ile2275Val) rs587779857
NM_000051.3(ATM):c.6824T>C (p.Ile2275Thr) rs1283858462
NM_000051.3(ATM):c.6827T>G (p.Phe2276Cys) rs753389616
NM_000051.3(ATM):c.6829C>G (p.Gln2277Glu) rs1252906835
NM_000051.3(ATM):c.6831A>G (p.Gln2277=) rs1339794219
NM_000051.3(ATM):c.6831A>T (p.Gln2277His) rs1339794219
NM_000051.3(ATM):c.6835A>G (p.Lys2279Glu) rs756898113
NM_000051.3(ATM):c.6838C>T (p.Gln2280Ter) rs1565520246
NM_000051.3(ATM):c.6839A>G (p.Gln2280Arg) rs1555119779
NM_000051.3(ATM):c.6839del (p.Gln2280fs) rs1407907917
NM_000051.3(ATM):c.6841T>C (p.Tyr2281His) rs1291249685
NM_000051.3(ATM):c.6843C>G (p.Tyr2281Ter) rs1555119797
NM_000051.3(ATM):c.6843del (p.Gln2280_Tyr2281insTer) rs1565520291
NM_000051.3(ATM):c.6844A>G (p.Asn2282Asp) rs951881516
NM_000051.3(ATM):c.6845A>G (p.Asn2282Ser) rs863224579
NM_000051.3(ATM):c.6846T>C (p.Asn2282=) rs541718119
NM_000051.3(ATM):c.6848C>T (p.Ser2283Leu) rs876660730
NM_000051.3(ATM):c.6850del (p.Val2284fs) rs876659569
NM_000051.3(ATM):c.6857G>A (p.Cys2286Tyr) rs786203052
NM_000051.3(ATM):c.6859G>A (p.Gly2287Arg) rs1181779478
NM_000051.3(ATM):c.6860G>A (p.Gly2287Glu) rs1800061
NM_000051.3(ATM):c.6860G>C (p.Gly2287Ala) rs1800061
NM_000051.3(ATM):c.6863T>A (p.Val2288Asp)
NM_000051.3(ATM):c.6864_6865CT[1] (p.Val2288_Ser2289insTer) rs886039701
NM_000051.3(ATM):c.6866C>T (p.Ser2289Phe) rs1555119833
NM_000051.3(ATM):c.6867dup (p.Glu2290Ter) rs1555119834
NM_000051.3(ATM):c.6868G>A (p.Glu2290Lys) rs1479339581
NM_000051.3(ATM):c.6868G>C (p.Glu2290Gln) rs1479339581
NM_000051.3(ATM):c.6869A>C (p.Glu2290Ala) rs1555119842
NM_000051.3(ATM):c.6870G>A (p.Glu2290=) rs1555119845
NM_000051.3(ATM):c.6871T>C (p.Trp2291Arg) rs746815819
NM_000051.3(ATM):c.6879G>A (p.Leu2293=) rs1555119859
NM_000051.3(ATM):c.6882A>G (p.Glu2294=) rs1555119866
NM_000051.3(ATM):c.6885A>G (p.Glu2295=) rs748221367
NM_000051.3(ATM):c.6888A>T (p.Ala2296=) rs200735689
NM_000051.3(ATM):c.6889C>G (p.Gln2297Glu) rs1565520537
NM_000051.3(ATM):c.6890A>C (p.Gln2297Pro) rs1565520560
NM_000051.3(ATM):c.6891A>G (p.Gln2297=) rs773545588
NM_000051.3(ATM):c.6893T>C (p.Val2298Ala) rs1565520607
NM_000051.3(ATM):c.6895T>C (p.Phe2299Leu) rs1555119886
NM_000051.3(ATM):c.6897C>G (p.Phe2299Leu) rs777164914
NM_000051.3(ATM):c.6897C>T (p.Phe2299=) rs777164914
NM_000051.3(ATM):c.6898T>G (p.Trp2300Gly) rs1565520641
NM_000051.3(ATM):c.6899G>C (p.Trp2300Ser) rs1555119899
NM_000051.3(ATM):c.6900G>C (p.Trp2300Cys)
NM_000051.3(ATM):c.6901G>A (p.Ala2301Thr) rs1060501668
NM_000051.3(ATM):c.6901G>C (p.Ala2301Pro) rs1060501668
NM_000051.3(ATM):c.6905A>G (p.Lys2302Arg) rs1297586575
NM_000051.3(ATM):c.6908A>C (p.Lys2303Thr) rs1064795166
NM_000051.3(ATM):c.6908A>T (p.Lys2303Met) rs1064795166
NM_000051.3(ATM):c.6908dup (p.Glu2304fs) rs773570504
NM_000051.3(ATM):c.6910del (p.Glu2304fs) rs1555119940
NM_000051.3(ATM):c.6913C>T (p.Gln2305Ter) rs1282099124
NM_000051.3(ATM):c.6914_6915AG[1] (p.Leu2307fs) rs878853535
NM_000051.3(ATM):c.6918T>C (p.Ser2306=) rs1555119959
NM_000051.3(ATM):c.6919C>T (p.Leu2307Phe) rs56009889
NM_000051.3(ATM):c.6920_6923del (p.Leu2307fs) rs1064793043
NM_000051.3(ATM):c.6921T>G (p.Leu2307=) rs1555119966
NM_000051.3(ATM):c.6922G>T (p.Ala2308Ser)
NM_000051.3(ATM):c.6923C>T (p.Ala2308Val) rs876658454
NM_000051.3(ATM):c.6924C>A (p.Ala2308=) rs759878732
NM_000051.3(ATM):c.6925C>T (p.Leu2309=) rs763839047
NM_000051.3(ATM):c.6927G>T (p.Leu2309=) rs876660429
NM_000051.3(ATM):c.6929G>A (p.Ser2310Asn) rs1381019767
NM_000051.3(ATM):c.6930T>C (p.Ser2310=) rs876660710
NM_000051.3(ATM):c.6931A>G (p.Ile2311Val)
NM_000051.3(ATM):c.6935T>C (p.Leu2312Pro)
NM_000051.3(ATM):c.6936C>T (p.Leu2312=) rs1555119992
NM_000051.3(ATM):c.6942A>C (p.Gln2314His) rs764859160
NM_000051.3(ATM):c.6944T>C (p.Met2315Thr) rs1555120006
NM_000051.3(ATM):c.6945G>A (p.Met2315Ile) rs1555120014
NM_000051.3(ATM):c.6950A>C (p.Lys2317Thr) rs750285816
NM_000051.3(ATM):c.6952A>C (p.Lys2318Gln) rs1449259481
NM_000051.3(ATM):c.6952A>G (p.Lys2318Glu) rs1449259481
NM_000051.3(ATM):c.6954G>A (p.Lys2318=) rs1555120044
NM_000051.3(ATM):c.6955T>A (p.Leu2319Met) rs1555120047
NM_000051.3(ATM):c.6956T>G (p.Leu2319Trp) rs1555120049
NM_000051.3(ATM):c.6958G>T (p.Asp2320Tyr) rs1565521026
NM_000051.3(ATM):c.6959A>G (p.Asp2320Gly) rs1060501640
NM_000051.3(ATM):c.6961G>C (p.Ala2321Pro) rs1060501538
NM_000051.3(ATM):c.6963C>T (p.Ala2321=) rs1555120057
NM_000051.3(ATM):c.6965G>T (p.Ser2322Ile) rs876659183
NM_000051.3(ATM):c.6966C>T (p.Ser2322=) rs864622593
NM_000051.3(ATM):c.6968G>A (p.Cys2323Tyr) rs876660924
NM_000051.3(ATM):c.6968G>T (p.Cys2323Phe) rs876660924
NM_000051.3(ATM):c.6974C>T (p.Ala2325Val) rs200940211
NM_000051.3(ATM):c.6975+13delT rs763287238
NM_000051.3(ATM):c.6975+13dupT rs763287238
NM_000051.3(ATM):c.6975+14dupA rs1555120120
NM_000051.3(ATM):c.6975+16T>C rs1555120123
NM_000051.3(ATM):c.6975+1G>T rs1565521129
NM_000051.3(ATM):c.6975+2T>C rs879254199
NM_000051.3(ATM):c.6975+4T>A rs876660240
NM_000051.3(ATM):c.6975+4T>G
NM_000051.3(ATM):c.6975+5G>T rs575354684
NM_000051.3(ATM):c.6975+5_6975+6delGT rs1064794094
NM_000051.3(ATM):c.6975+5_6975+8delGTTT rs1565521135
NM_000051.3(ATM):c.6975+5_6975+9del5 rs1555120086
NM_000051.3(ATM):c.6975+5delG rs1442949382
NM_000051.3(ATM):c.6975+6T>C rs1169579742
NM_000051.3(ATM):c.6975+7T>A rs754834282
NM_000051.3(ATM):c.6975+7T>G rs754834282
NM_000051.3(ATM):c.6975G>A (p.Ala2325=) rs556778314
NM_000051.3(ATM):c.6975G>C (p.Ala2325=) rs556778314
NM_000051.3(ATM):c.6975G>T (p.Ala2325=) rs556778314
NM_000051.3(ATM):c.6976-10_6989delTCTTATACAGAACAATCCCAGCCT rs587779859
NM_000051.3(ATM):c.6976-11T>C rs1565523441
NM_000051.3(ATM):c.6976-13C>T rs1555120901
NM_000051.3(ATM):c.6976-19T>C rs1026199027
NM_000051.3(ATM):c.6976-1G>A
NM_000051.3(ATM):c.6976-1G>T
NM_000051.3(ATM):c.6976-2A>C rs587782403
NM_000051.3(ATM):c.6976-2A>G rs587782403
NM_000051.3(ATM):c.6976-3_6976-2insT rs1060501533
NM_000051.3(ATM):c.6976-5T>C rs1555120913
NM_000051.3(ATM):c.6976-6dupA rs760058702
NM_000051.3(ATM):c.6980A>T (p.Asn2327Ile) rs761587154
NM_000051.3(ATM):c.6982C>A (p.Pro2328Thr) rs769606850
NM_000051.3(ATM):c.6982C>G (p.Pro2328Ala)
NM_000051.3(ATM):c.6983C>T (p.Pro2328Leu) rs786202730
NM_000051.3(ATM):c.6988C>G (p.Leu2330Val) rs148432863
NM_000051.3(ATM):c.6994C>T (p.Leu2332Phe) rs762427092
NM_000051.3(ATM):c.6995T>C (p.Leu2332Pro) rs4988111
NM_000051.3(ATM):c.6995T>G (p.Leu2332Arg) rs4988111
NM_000051.3(ATM):c.6996_6999TACA[1] (p.Tyr2334fs) rs786203421
NM_000051.3(ATM):c.6997dup (p.Thr2333fs) rs587781299
NM_000051.3(ATM):c.6998C>A (p.Thr2333Lys) rs150503164
NM_000051.3(ATM):c.6998C>T (p.Thr2333Ile) rs150503164
NM_000051.3(ATM):c.6999A>G (p.Thr2333=) rs759267807
NM_000051.3(ATM):c.7000T>C (p.Tyr2334His) rs1064793312
NM_000051.3(ATM):c.7001A>G (p.Tyr2334Cys) rs879254258
NM_000051.3(ATM):c.7003A>C (p.Thr2335Pro) rs1555120970
NM_000051.3(ATM):c.7004C>T (p.Thr2335Ile) rs3092831
NM_000051.3(ATM):c.7005A>G (p.Thr2335=) rs1555120978
NM_000051.3(ATM):c.7010G>A (p.Cys2337Tyr) rs876658563
NM_000051.3(ATM):c.7010_7011del (p.Cys2337fs) rs864622416
NM_000051.3(ATM):c.7010_7065dup (p.Ile2356delinsValTer) rs1555120985
NM_000051.3(ATM):c.7011T>C (p.Cys2337=) rs878853536
NM_000051.3(ATM):c.7011T>G (p.Cys2337Trp) rs878853536
NM_000051.3(ATM):c.7012C>G (p.Leu2338Val) rs1555120990
NM_000051.3(ATM):c.7012C>T (p.Leu2338=) rs1555120990
NM_000051.3(ATM):c.7013T>C (p.Leu2338Pro) rs1555120997
NM_000051.3(ATM):c.7014G>C (p.Leu2338=) rs1555120999
NM_000051.3(ATM):c.7016G>A (p.Arg2339Lys) rs1305313302
NM_000051.3(ATM):c.7018G>A (p.Val2340Ile) rs876659429
NM_000051.3(ATM):c.7018G>T (p.Val2340Phe) rs876659429
NM_000051.3(ATM):c.7023T>C (p.Cys2341=) rs878853537
NM_000051.3(ATM):c.7024G>A (p.Gly2342Ser) rs1555121015
NM_000051.3(ATM):c.7026dup (p.Asn2343fs) rs1555121020
NM_000051.3(ATM):c.7028A>G (p.Asn2343Ser) rs876658507
NM_000051.3(ATM):c.7032G>A (p.Trp2344Ter) rs1131691162
NM_000051.3(ATM):c.7033T>G (p.Leu2345Val) rs1555121048
NM_000051.3(ATM):c.7035A>G (p.Leu2345=) rs1057523514
NM_000051.3(ATM):c.7036G>A (p.Ala2346Thr) rs144497088
NM_000051.3(ATM):c.7038A>G (p.Ala2346=) rs146167034
NM_000051.3(ATM):c.7038A>T (p.Ala2346=) rs146167034
NM_000051.3(ATM):c.7043C>T (p.Thr2348Met)
NM_000051.3(ATM):c.7044G>A (p.Thr2348=) rs140104789
NM_000051.3(ATM):c.7044_7047del (p.Thr2348_Cys2349insTer) rs1555121066
NM_000051.3(ATM):c.7050A>G (p.Leu2350=) rs1555121076
NM_000051.3(ATM):c.7052A>G (p.Glu2351Gly)
NM_000051.3(ATM):c.7061C>T (p.Ala2354Val) rs1555121079
NM_000051.3(ATM):c.7062G>A (p.Ala2354=) rs143489373
NM_000051.3(ATM):c.7062G>C (p.Ala2354=) rs143489373
NM_000051.3(ATM):c.7065_7067CAT[1] (p.Ile2356del) rs879254220
NM_000051.3(ATM):c.7066A>G (p.Ile2356Val) rs876658517
NM_000051.3(ATM):c.7066A>T (p.Ile2356Phe) rs876658517
NM_000051.3(ATM):c.7066_7081del (p.Val2355_Ile2356insTer) rs886039502
NM_000051.3(ATM):c.7070_7072dup (p.Gln2358_Thr2359insLeu)
NM_000051.3(ATM):c.7071G>T (p.Met2357Ile) rs753951063
NM_000051.3(ATM):c.7074G>A (p.Gln2358=) rs1060501593
NM_000051.3(ATM):c.7074G>T (p.Gln2358His) rs1060501593
NM_000051.3(ATM):c.7076C>A (p.Thr2359Asn)
NM_000051.3(ATM):c.7076C>T (p.Thr2359Ile) rs730881314
NM_000051.3(ATM):c.7077C>T (p.Thr2359=) rs1555121132
NM_000051.3(ATM):c.7078T>C (p.Tyr2360His) rs587779860
NM_000051.3(ATM):c.7079A>G (p.Tyr2360Cys) rs1555121141
NM_000051.3(ATM):c.7080T>G (p.Tyr2360Ter) rs1555121147
NM_000051.3(ATM):c.7081C>A (p.Leu2361Ile) rs1412288141
NM_000051.3(ATM):c.7088A>T (p.Lys2363Met) rs757293178
NM_000051.3(ATM):c.7088del (p.Lys2363fs) rs876658512
NM_000051.3(ATM):c.7089+1G>A rs777741666
NM_000051.3(ATM):c.7089+1G>T rs777741666
NM_000051.3(ATM):c.7089+20C>T rs730881275
NM_000051.3(ATM):c.7089+2T>G rs1057516235
NM_000051.3(ATM):c.7089+3A>G rs1565524203
NM_000051.3(ATM):c.7089+5G>A rs1351209504
NM_000051.3(ATM):c.7089+7T>C rs1404350048
NM_000051.3(ATM):c.7090-14G>A rs1486032156
NM_000051.3(ATM):c.7090-14G>T rs1486032156
NM_000051.3(ATM):c.7090-17G>T rs1555121895
NM_000051.3(ATM):c.7090-7C>T rs774223576
NM_000051.3(ATM):c.7090G>C (p.Ala2364Pro) rs759439613
NM_000051.3(ATM):c.7091C>T (p.Ala2364Val) rs1555121919
NM_000051.3(ATM):c.7091del (p.Ala2364fs) rs878853538
NM_000051.3(ATM):c.7093G>A (p.Val2365Ile)
NM_000051.3(ATM):c.7096G>A (p.Glu2366Lys) rs587781672
NM_000051.3(ATM):c.7096G>T (p.Glu2366Ter) rs587781672
NM_000051.3(ATM):c.7099G>A (p.Val2367Ile) rs1060501647
NM_000051.3(ATM):c.7099G>C (p.Val2367Leu) rs1060501647
NM_000051.3(ATM):c.7107A>C (p.Gly2369=) rs1057523056
NM_000051.3(ATM):c.7108A>G (p.Asn2370Asp) rs767494363
NM_000051.3(ATM):c.7109A>G (p.Asn2370Ser) rs1555121947
NM_000051.3(ATM):c.7111T>G (p.Tyr2371Asp) rs1555121956
NM_000051.3(ATM):c.7112A>T (p.Tyr2371Phe) rs1565526394
NM_000051.3(ATM):c.7113T>C (p.Tyr2371=) rs760534895
NM_000051.3(ATM):c.7116T>C (p.Asp2372=) rs3218675
NM_000051.3(ATM):c.7121A>C (p.Glu2374Ala) rs587782225
NM_000051.3(ATM):c.7122A>C (p.Glu2374Asp) rs376159946
NM_000051.3(ATM):c.7123_7125AGT[1] (p.Ser2376del) rs1555121978
NM_000051.3(ATM):c.7125T>C (p.Ser2375=) rs878853539
NM_000051.3(ATM):c.7129G>T (p.Asp2377Tyr) rs1555122008
NM_000051.3(ATM):c.7131T>C (p.Asp2377=) rs373309822
NM_000051.3(ATM):c.7135C>G (p.Leu2379Val) rs778888033
NM_000051.3(ATM):c.7140A>G (p.Arg2380=) rs750569023
NM_000051.3(ATM):c.7141_7151del (p.Asn2381fs) rs1555122030
NM_000051.3(ATM):c.7145G>C (p.Gly2382Ala) rs1060501639
NM_000051.3(ATM):c.7155G>A (p.Lys2385=) rs878853540
NM_000051.3(ATM):c.7156G>C (p.Ala2386Pro) rs876659392
NM_000051.3(ATM):c.7156G>T (p.Ala2386Ser) rs876659392
NM_000051.3(ATM):c.7157C>A (p.Ala2386Glu) rs786203697
NM_000051.3(ATM):c.7157C>G (p.Ala2386Gly) rs786203697
NM_000051.3(ATM):c.7159_7160insAGCC (p.Phe2387Ter)
NM_000051.3(ATM):c.7164C>A (p.Leu2388=) rs1239532344
NM_000051.3(ATM):c.7164C>G (p.Leu2388=) rs1239532344
NM_000051.3(ATM):c.7166C>G (p.Ser2389Ter) rs1018140779
NM_000051.3(ATM):c.7166C>T (p.Ser2389Leu) rs1018140779
NM_000051.3(ATM):c.7174C>T (p.Arg2392Trp) rs149827260
NM_000051.3(ATM):c.7175G>A (p.Arg2392Gln) rs876659083
NM_000051.3(ATM):c.7175G>T (p.Arg2392Leu)
NM_000051.3(ATM):c.7178T>G (p.Phe2393Cys) rs1555122073
NM_000051.3(ATM):c.7179T>C (p.Phe2393=) rs1057520430
NM_000051.3(ATM):c.7179T>G (p.Phe2393Leu) rs1057520430
NM_000051.3(ATM):c.7181C>T (p.Ser2394Leu) rs587779861
NM_000051.3(ATM):c.7184A>T (p.Asp2395Val) rs1555122090
NM_000051.3(ATM):c.7186del (p.Thr2396fs) rs1555122092
NM_000051.3(ATM):c.7187C>G (p.Thr2396Ser) rs370559102
NM_000051.3(ATM):c.7189C>G (p.Gln2397Glu) rs747372355
NM_000051.3(ATM):c.7189C>T (p.Gln2397Ter) rs747372355
NM_000051.3(ATM):c.7190A>G (p.Gln2397Arg) rs1060501592
NM_000051.3(ATM):c.7191A>G (p.Gln2397=) rs768906734
NM_000051.3(ATM):c.7194C>A (p.Tyr2398Ter)
NM_000051.3(ATM):c.7196A>G (p.Gln2399Arg) rs1565526758
NM_000051.3(ATM):c.7198A>C (p.Arg2400=) rs777423778
NM_000051.3(ATM):c.7199G>T (p.Arg2400Ile) rs567457294
NM_000051.3(ATM):c.7200A>C (p.Arg2400Ser) rs1060501534
NM_000051.3(ATM):c.7200A>G (p.Arg2400=) rs1060501534
NM_000051.3(ATM):c.7201A>G (p.Ile2401Val) rs1565526813
NM_000051.3(ATM):c.7202T>C (p.Ile2401Thr) rs1555122117
NM_000051.3(ATM):c.7209C>T (p.Asn2403=) rs373662499
NM_000051.3(ATM):c.7211A>G (p.Tyr2404Cys) rs1064794093
NM_000051.3(ATM):c.7213A>C (p.Met2405Leu)
NM_000051.3(ATM):c.7213A>G (p.Met2405Val) rs587781323
NM_000051.3(ATM):c.7215G>A (p.Met2405Ile) rs879254179
NM_000051.3(ATM):c.7218A>G (p.Lys2406=) rs1321705346
NM_000051.3(ATM):c.7219T>C (p.Ser2407Pro) rs1565526951
NM_000051.3(ATM):c.7220C>A (p.Ser2407Ter) rs1555122149
NM_000051.3(ATM):c.7221A>G (p.Ser2407=) rs786201881
NM_000051.3(ATM):c.7221A>T (p.Ser2407=) rs786201881
NM_000051.3(ATM):c.7223C>T (p.Ser2408Leu) rs730881315
NM_000051.3(ATM):c.7224G>A (p.Ser2408=) rs145747513
NM_000051.3(ATM):c.7229T>A (p.Phe2410Tyr) rs758351633
NM_000051.3(ATM):c.7229T>C (p.Phe2410Ser) rs758351633
NM_000051.3(ATM):c.7230T>G (p.Phe2410Leu) rs1565527030
NM_000051.3(ATM):c.7235A>C (p.Asn2412Thr) rs786203311
NM_000051.3(ATM):c.7235A>G (p.Asn2412Ser) rs786203311
NM_000051.3(ATM):c.7239G>A (p.Lys2413=) rs1555122182
NM_000051.3(ATM):c.7240C>A (p.Gln2414Lys) rs863224462
NM_000051.3(ATM):c.7240C>T (p.Gln2414Ter) rs863224462
NM_000051.3(ATM):c.7244C>G (p.Ala2415Gly) rs370567994
NM_000051.3(ATM):c.7244C>T (p.Ala2415Val) rs370567994
NM_000051.3(ATM):c.7246C>T (p.Leu2416Phe) rs1060501615
NM_000051.3(ATM):c.7248C>T (p.Leu2416=) rs750513866
NM_000051.3(ATM):c.7251_7253dup (p.Lys2418dup) rs796051857
NM_000051.3(ATM):c.7253A>C (p.Lys2418Thr) rs1565527146
NM_000051.3(ATM):c.7253_7266del (p.Lys2418fs) rs1555122216
NM_000051.3(ATM):c.7261A>G (p.Lys2421Glu) rs1555122220
NM_000051.3(ATM):c.7261_7262insT (p.Lys2421fs)
NM_000051.3(ATM):c.7262A>C (p.Lys2421Thr) rs1360453074
NM_000051.3(ATM):c.7262A>T (p.Lys2421Ile)
NM_000051.3(ATM):c.7262_7263del (p.Lys2421fs) rs1131691157
NM_000051.3(ATM):c.7263A>G (p.Lys2421=) rs1555122232
NM_000051.3(ATM):c.7264G>A (p.Glu2422Lys) rs1163371592
NM_000051.3(ATM):c.7265A>G (p.Glu2422Gly) rs758614348
NM_000051.3(ATM):c.7266G>A (p.Glu2422=) rs876659834
NM_000051.3(ATM):c.7267G>A (p.Glu2423Lys) rs1555122245
NM_000051.3(ATM):c.7267_7270delinsTAC (p.Glu2423fs)
NM_000051.3(ATM):c.7268A>G (p.Glu2423Gly) rs121434221
NM_000051.3(ATM):c.7269A>T (p.Glu2423Asp) rs864622471
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7274G>T (p.Gly2425Val) rs148949644
NM_000051.3(ATM):c.7274del (p.Gly2425fs) rs1565527283
NM_000051.3(ATM):c.7277T>C (p.Leu2426Pro)
NM_000051.3(ATM):c.7279_7284del (p.Leu2427_Arg2428del) rs796051856
NM_000051.3(ATM):c.7280T>C (p.Leu2427Pro) rs1555122272
NM_000051.3(ATM):c.7280T>G (p.Leu2427Arg) rs1555122272
NM_000051.3(ATM):c.7282A>G (p.Arg2428Gly) rs1555122281
NM_000051.3(ATM):c.7282A>T (p.Arg2428Trp) rs1555122281
NM_000051.3(ATM):c.7289A>G (p.His2430Arg) rs786202856
NM_000051.3(ATM):c.7290T>A (p.His2430Gln) rs876658715
NM_000051.3(ATM):c.7290T>G (p.His2430Gln) rs876658715
NM_000051.3(ATM):c.7291A>G (p.Lys2431Glu) rs864622563
NM_000051.3(ATM):c.7293_7294del (p.Lys2431fs) rs1060501525
NM_000051.3(ATM):c.7294A>T (p.Ile2432Phe) rs587781838
NM_000051.3(ATM):c.7299G>A (p.Gln2433=) rs1057520451
NM_000051.3(ATM):c.7299_7302del (p.Asn2435fs) rs886039628
NM_000051.3(ATM):c.7303A>G (p.Asn2435Asp) rs1555122326
NM_000051.3(ATM):c.7305C>G (p.Asn2435Lys) rs1160508407
NM_000051.3(ATM):c.7306A>G (p.Arg2436Gly) rs1555122335
NM_000051.3(ATM):c.7307+18A>C rs777909508
NM_000051.3(ATM):c.7307+18A>G rs777909508
NM_000051.3(ATM):c.7307+1_7307+3dup rs1565527496
NM_000051.3(ATM):c.7307+3A>C rs1565527512
NM_000051.3(ATM):c.7307+3_7307+4insGTTC rs587782288
NM_000051.3(ATM):c.7307+4A>G rs730881316
NM_000051.3(ATM):c.7307+4A>T
NM_000051.3(ATM):c.7307+8G>C rs1057523631
NM_000051.3(ATM):c.7307G>A (p.Arg2436Lys) rs786203394
NM_000051.3(ATM):c.7308-10T>C rs745319720
NM_000051.3(ATM):c.7308-10T>G rs745319720
NM_000051.3(ATM):c.7308-10dup rs1555122910
NM_000051.3(ATM):c.7308-11T>C rs1565529149
NM_000051.3(ATM):c.7308-18T>C rs1473587970
NM_000051.3(ATM):c.7308-1G>C rs1555122941
NM_000051.3(ATM):c.7308-2A>C rs1555122938
NM_000051.3(ATM):c.7308-6T>C rs574836628
NM_000051.3(ATM):c.7308-7A>G rs1476284330
NM_000051.3(ATM):c.7308-8T>C rs1555122924
NM_000051.3(ATM):c.7308-9C>T rs878853541
NM_000051.3(ATM):c.7308A>C (p.Arg2436Ser) rs730881317
NM_000051.3(ATM):c.7309T>C (p.Tyr2437His) rs1565529213
NM_000051.3(ATM):c.7310A>G (p.Tyr2437Cys) rs1555122944
NM_000051.3(ATM):c.7311C>A (p.Tyr2437Ter) rs763470424
NM_000051.3(ATM):c.7312A>C (p.Thr2438Pro) rs1565529248
NM_000051.3(ATM):c.7313C>G (p.Thr2438Arg) rs147604227
NM_000051.3(ATM):c.7313C>T (p.Thr2438Ile) rs147604227
NM_000051.3(ATM):c.7314A>C (p.Thr2438=) rs199909913
NM_000051.3(ATM):c.7315G>C (p.Val2439Leu)
NM_000051.3(ATM):c.7316T>C (p.Val2439Ala) rs776266049
NM_000051.3(ATM):c.7317A>G (p.Val2439=) rs878853542
NM_000051.3(ATM):c.7318A>G (p.Lys2440Glu) rs1565529306
NM_000051.3(ATM):c.7321G>T (p.Val2441Phe) rs876659556
NM_000051.3(ATM):c.7322T>C (p.Val2441Ala) rs765548443
NM_000051.3(ATM):c.7326G>T (p.Gln2442His) rs1555122970
NM_000051.3(ATM):c.7327C>G (p.Arg2443Gly)
NM_000051.3(ATM):c.7327C>T (p.Arg2443Ter) rs121434220
NM_000051.3(ATM):c.7328G>A (p.Arg2443Gln) rs587782310
NM_000051.3(ATM):c.7331A>C (p.Glu2444Ala) rs879254245
NM_000051.3(ATM):c.7332G>C (p.Glu2444Asp) rs876658886
NM_000051.3(ATM):c.7334T>A (p.Leu2445Gln) rs1555122992
NM_000051.3(ATM):c.7334T>C (p.Leu2445Pro) rs1555122992
NM_000051.3(ATM):c.7336G>A (p.Glu2446Lys) rs730881318
NM_000051.3(ATM):c.7337A>G (p.Glu2446Gly) rs1555122998
NM_000051.3(ATM):c.7339T>G (p.Leu2447Val)
NM_000051.3(ATM):c.7346A>C (p.Glu2449Ala) rs1555123004
NM_000051.3(ATM):c.7347dup (p.Leu2450fs) rs1555123008
NM_000051.3(ATM):c.7351G>C (p.Ala2451Pro) rs587779862
NM_000051.3(ATM):c.7351G>T (p.Ala2451Ser) rs587779862
NM_000051.3(ATM):c.7354C>G (p.Leu2452Val) rs587779863
NM_000051.3(ATM):c.7355T>C (p.Leu2452Pro) rs1555123032
NM_000051.3(ATM):c.7357C>T (p.Arg2453Cys) rs755418571
NM_000051.3(ATM):c.7358G>A (p.Arg2453His) rs587781361
NM_000051.3(ATM):c.7359T>G (p.Arg2453=) rs786201541
NM_000051.3(ATM):c.7363C>T (p.Leu2455=) rs147665149
NM_000051.3(ATM):c.7364T>A (p.Leu2455Gln) rs1555123056
NM_000051.3(ATM):c.7364T>G (p.Leu2455Arg) rs1555123056
NM_000051.3(ATM):c.7365G>C (p.Leu2455=) rs756506590
NM_000051.3(ATM):c.7370A>C (p.Glu2457Ala) rs778482902
NM_000051.3(ATM):c.7371G>A (p.Glu2457=) rs1454725863
NM_000051.3(ATM):c.7373A>T (p.Asp2458Val) rs879254201
NM_000051.3(ATM):c.7375C>G (p.Arg2459Gly) rs730881383
NM_000051.3(ATM):c.7375C>T (p.Arg2459Cys) rs730881383
NM_000051.3(ATM):c.7376G>A (p.Arg2459His) rs1064796589
NM_000051.3(ATM):c.7381C>T (p.Arg2461Cys) rs201314561
NM_000051.3(ATM):c.7382G>A (p.Arg2461His) rs768461085
NM_000051.3(ATM):c.7382G>C (p.Arg2461Pro) rs768461085
NM_000051.3(ATM):c.7383C>T (p.Arg2461=) rs1429991894
NM_000051.3(ATM):c.7384T>C (p.Phe2462Leu) rs878853543
NM_000051.3(ATM):c.7390T>C (p.Cys2464Arg) rs55801750
NM_000051.3(ATM):c.7391G>A (p.Cys2464Tyr) rs1555123119
NM_000051.3(ATM):c.7391_7412del (p.Cys2464fs) rs1064794690
NM_000051.3(ATM):c.7399G>A (p.Val2467Ile) rs769722643
NM_000051.3(ATM):c.7400T>C (p.Val2467Ala)
NM_000051.3(ATM):c.7401T>G (p.Val2467=) rs1565529761
NM_000051.3(ATM):c.7407T>C (p.Asn2469=) rs1555123133
NM_000051.3(ATM):c.7408T>G (p.Tyr2470Asp) rs876659365
NM_000051.3(ATM):c.7409A>G (p.Tyr2470Cys) rs878853544
NM_000051.3(ATM):c.7409A>T (p.Tyr2470Phe) rs878853544
NM_000051.3(ATM):c.7410T>C (p.Tyr2470=) rs1555123144
NM_000051.3(ATM):c.7411A>G (p.Ile2471Val) rs1565529832
NM_000051.3(ATM):c.7412T>G (p.Ile2471Ser)
NM_000051.3(ATM):c.7415A>G (p.Asn2472Ser) rs1565529851
NM_000051.3(ATM):c.7420T>C (p.Leu2474=) rs1555123149
NM_000051.3(ATM):c.7424T>C (p.Leu2475Ser) rs1224883896
NM_000051.3(ATM):c.7425A>G (p.Leu2475=) rs1555123162
NM_000051.3(ATM):c.7427G>A (p.Ser2476Asn)
NM_000051.3(ATM):c.7429G>A (p.Gly2477Arg) rs778550056
NM_000051.3(ATM):c.7431A>T (p.Gly2477=) rs1158876832
NM_000051.3(ATM):c.7434A>G (p.Glu2478=) rs1555123171
NM_000051.3(ATM):c.7435G>C (p.Glu2479Gln) rs1060501583
NM_000051.3(ATM):c.7443T>C (p.Asp2481=) rs1555123181
NM_000051.3(ATM):c.7444A>G (p.Met2482Val) rs951373716
NM_000051.3(ATM):c.7445T>C (p.Met2482Thr) rs1555123191
NM_000051.3(ATM):c.7445_7446delinsCT (p.Met2482Thr) rs1565529987
NM_000051.3(ATM):c.7449G>A (p.Trp2483Ter) rs773516672
NM_000051.3(ATM):c.7450G>A (p.Val2484Ile) rs587779864
NM_000051.3(ATM):c.7456C>T (p.Arg2486Ter) rs587779865
NM_000051.3(ATM):c.7457G>A (p.Arg2486Gln) rs773944604
NM_000051.3(ATM):c.7462T>C (p.Cys2488Arg) rs1555123216
NM_000051.3(ATM):c.7463G>A (p.Cys2488Tyr) rs774281788
NM_000051.3(ATM):c.7463G>T (p.Cys2488Phe)
NM_000051.3(ATM):c.7464T>C (p.Cys2488=) rs1555123227
NM_000051.3(ATM):c.7465_7466del (p.Ser2489fs) rs786203734
NM_000051.3(ATM):c.7467C>T (p.Ser2489=) rs767846264
NM_000051.3(ATM):c.7468C>T (p.Leu2490Phe) rs753262623
NM_000051.3(ATM):c.7470C>G (p.Leu2490=) rs1057521604
NM_000051.3(ATM):c.7473G>T (p.Trp2491Cys) rs1555123257
NM_000051.3(ATM):c.7474C>T (p.Leu2492Phe) rs1555123259
NM_000051.3(ATM):c.7475T>G (p.Leu2492Arg) rs56399857
NM_000051.3(ATM):c.7484C>T (p.Ser2495Phe) rs1449747119
NM_000051.3(ATM):c.7486G>C (p.Gly2496Arg) rs1565530187
NM_000051.3(ATM):c.7487G>A (p.Gly2496Glu) rs764478418
NM_000051.3(ATM):c.7487G>C (p.Gly2496Ala) rs764478418
NM_000051.3(ATM):c.7491_7499del (p.Ser2498_Val2500del) rs1064796307
NM_000051.3(ATM):c.7492T>G (p.Ser2498Ala) rs754245181
NM_000051.3(ATM):c.7494T>C (p.Ser2498=) rs34393781
NM_000051.3(ATM):c.7496A>G (p.Glu2499Gly) rs1224705805
NM_000051.3(ATM):c.7498G>A (p.Val2500Ile) rs1555123294
NM_000051.3(ATM):c.7499T>C (p.Val2500Ala) rs779810877
NM_000051.3(ATM):c.7499_7502delinsCCAG (p.Val2500_Asn2501delinsAlaSer) rs1555123310
NM_000051.3(ATM):c.7500C>T (p.Val2500=) rs1060504286
NM_000051.3(ATM):c.7502A>G (p.Asn2501Ser) rs531617441
NM_000051.3(ATM):c.7507A>G (p.Met2503Val) rs780931855
NM_000051.3(ATM):c.7507A>T (p.Met2503Leu) rs780931855
NM_000051.3(ATM):c.7509G>A (p.Met2503Ile) rs1266101531
NM_000051.3(ATM):c.7510dup (p.Met2504fs)
NM_000051.3(ATM):c.7511T>C (p.Met2504Thr) rs1060501644
NM_000051.3(ATM):c.7515+19A>T rs879254202
NM_000051.3(ATM):c.7515+20A>G rs80124497
NM_000051.3(ATM):c.7515+4A>G rs1565530434
NM_000051.3(ATM):c.7515+5G>A rs1555123361
NM_000051.3(ATM):c.7515+9T>G rs1465593444
NM_000051.3(ATM):c.7516-18_7516-17delTCinsAAT rs1555123881
NM_000051.3(ATM):c.7516-4G>T rs876660105
NM_000051.3(ATM):c.7516-5G>A rs1057520837
NM_000051.3(ATM):c.7516-5G>C rs1057520837
NM_000051.3(ATM):c.7516-6T>C rs1057521003
NM_000051.3(ATM):c.7516-9delT rs573494809
NM_000051.3(ATM):c.7516-9dup rs573494809
NM_000051.3(ATM):c.7516A>G (p.Arg2506Gly) rs200441272
NM_000051.3(ATM):c.7517G>A (p.Arg2506Lys) rs1555123920
NM_000051.3(ATM):c.7517_7520delGAGA rs587781905
NM_000051.3(ATM):c.7521C>A (p.Asp2507Glu) rs751234924
NM_000051.3(ATM):c.7521C>T (p.Asp2507=) rs751234924
NM_000051.3(ATM):c.7522G>A (p.Gly2508Arg) rs754395517
NM_000051.3(ATM):c.7527G>A (p.Met2509Ile) rs1060501579
NM_000051.3(ATM):c.7531A>T (p.Ile2511Phe) rs146069748
NM_000051.3(ATM):c.7533T>C (p.Ile2511=) rs786201279
NM_000051.3(ATM):c.7534C>A (p.Pro2512Thr) rs1565532052
NM_000051.3(ATM):c.7535C>T (p.Pro2512Leu) rs1237858258
NM_000051.3(ATM):c.7536A>G (p.Pro2512=) rs786202802
NM_000051.3(ATM):c.7539A>G (p.Thr2513=) rs752294923
NM_000051.3(ATM):c.7540T>C (p.Tyr2514His) rs1555123985
NM_000051.3(ATM):c.7540_7541TA[1] (p.Tyr2514_Lys2515delinsTer) rs1555123981
NM_000051.3(ATM):c.7541A>G (p.Tyr2514Cys) rs1555123994
NM_000051.3(ATM):c.7541A>T (p.Tyr2514Phe) rs1555123994
NM_000051.3(ATM):c.7542T>C (p.Tyr2514=) rs777925486
NM_000051.3(ATM):c.7542T>G (p.Tyr2514Ter) rs777925486
NM_000051.3(ATM):c.7543A>G (p.Lys2515Glu) rs1555124004
NM_000051.3(ATM):c.7545A>G (p.Lys2515=) rs1467809725
NM_000051.3(ATM):c.7547T>G (p.Phe2516Cys) rs774312539
NM_000051.3(ATM):c.7549_7562delinsATG (p.Leu2517fs)
NM_000051.3(ATM):c.7552C>T (p.Pro2518Ser) rs374876799
NM_000051.3(ATM):c.7553C>A (p.Pro2518His)
NM_000051.3(ATM):c.7553C>T (p.Pro2518Leu) rs879254136
NM_000051.3(ATM):c.7555C>G (p.Leu2519Val) rs1555124019
NM_000051.3(ATM):c.7557T>C (p.Leu2519=) rs1060504266
NM_000051.3(ATM):c.7559T>G (p.Met2520Arg) rs587782692
NM_000051.3(ATM):c.7562A>G (p.Tyr2521Cys) rs876660422
NM_000051.3(ATM):c.7563C>G (p.Tyr2521Ter) rs772228129
NM_000051.3(ATM):c.7564C>G (p.Gln2522Glu)
NM_000051.3(ATM):c.7565A>G (p.Gln2522Arg) rs1555124039
NM_000051.3(ATM):c.7566A>G (p.Gln2522=) rs775621333
NM_000051.3(ATM):c.7566A>T (p.Gln2522His) rs775621333
NM_000051.3(ATM):c.7567T>C (p.Leu2523=) rs1565532289
NM_000051.3(ATM):c.7570G>C (p.Ala2524Pro) rs769142993
NM_000051.3(ATM):c.7570G>T (p.Ala2524Ser)
NM_000051.3(ATM):c.7571C>T (p.Ala2524Val) rs876660663
NM_000051.3(ATM):c.7575_7576insTTC (p.Arg2526_Met2527insPhe) rs1555124054
NM_000051.3(ATM):c.7577G>A (p.Arg2526Lys) rs876659323
NM_000051.3(ATM):c.7577G>C (p.Arg2526Thr) rs876659323
NM_000051.3(ATM):c.7580T>A (p.Met2527Lys) rs1555124065
NM_000051.3(ATM):c.7587C>T (p.Thr2529=) rs890244103
NM_000051.3(ATM):c.7592T>C (p.Met2531Thr) rs587781365
NM_000051.3(ATM):c.7593G>A (p.Met2531Ile) rs786203764
NM_000051.3(ATM):c.7596G>A (p.Met2532Ile) rs587781854
NM_000051.3(ATM):c.7598G>A (p.Gly2533Glu) rs864622688
NM_000051.3(ATM):c.7599_7600dup (p.Gly2534fs) rs1555124089
NM_000051.3(ATM):c.7600G>A (p.Gly2534Ser) rs1555124094
NM_000051.3(ATM):c.7602C>T (p.Gly2534=) rs562264493
NM_000051.3(ATM):c.7603C>T (p.Leu2535=) rs1555124111
NM_000051.3(ATM):c.7608del (p.His2538fs) rs1565532554
NM_000051.3(ATM):c.7615G>A (p.Glu2539Lys) rs876658496
NM_000051.3(ATM):c.7617A>C (p.Glu2539Asp)
NM_000051.3(ATM):c.7618G>A (p.Val2540Ile) rs35203200
NM_000051.3(ATM):c.7620C>A (p.Val2540=) rs863224298
NM_000051.3(ATM):c.7620C>T (p.Val2540=) rs863224298
NM_000051.3(ATM):c.7621C>T (p.Leu2541Phe) rs1565532615
NM_000051.3(ATM):c.7622T>G (p.Leu2541Arg) rs876658933
NM_000051.3(ATM):c.7626T>A (p.Asn2542Lys) rs1555124134
NM_000051.3(ATM):c.7629+12T>C rs373731708
NM_000051.3(ATM):c.7629+12_7629+15delTGAA rs1555124156
NM_000051.3(ATM):c.7629+13G>A rs563651647
NM_000051.3(ATM):c.7629+1G>A rs1565532703
NM_000051.3(ATM):c.7629+2T>C rs786203059
NM_000051.3(ATM):c.7629+2dup rs1555124141
NM_000051.3(ATM):c.7629+3A>C rs752251778
NM_000051.3(ATM):c.7629T>C (p.Asn2543=) rs767123895
NM_000051.3(ATM):c.7629_7629+4del rs876660041
NM_000051.3(ATM):c.7630-12C>G rs911541230
NM_000051.3(ATM):c.7630-15G>T rs773603597
NM_000051.3(ATM):c.7630-17T>C rs116047570
NM_000051.3(ATM):c.7630-2A>C rs587779866
NM_000051.3(ATM):c.7630-2A>G rs587779866
NM_000051.3(ATM):c.7630-3C>A rs587782448
NM_000051.3(ATM):c.7630-3C>G rs587782448
NM_000051.3(ATM):c.7630-3C>T rs587782448
NM_000051.3(ATM):c.7630-3_7630-2delCA rs587782250
NM_000051.3(ATM):c.7630-4A>G rs1057523067
NM_000051.3(ATM):c.7630-7C>A rs730881276
NM_000051.3(ATM):c.7630-7C>T rs730881276
NM_000051.3(ATM):c.7630C>G (p.Leu2544Val) rs1555124455
NM_000051.3(ATM):c.7631T>C (p.Leu2544Pro) rs1555124459
NM_000051.3(ATM):c.7631del (p.Leu2544fs)
NM_000051.3(ATM):c.7638_7646del (p.Arg2547_Ser2549del) rs587776547
NM_000051.3(ATM):c.7639A>G (p.Arg2547Gly) rs1565533544
NM_000051.3(ATM):c.7648A>C (p.Met2550Leu) rs878853545
NM_000051.3(ATM):c.7648A>G (p.Met2550Val) rs878853545
NM_000051.3(ATM):c.7650G>T (p.Met2550Ile) rs1565533594
NM_000051.3(ATM):c.7652A>G (p.Asp2551Gly) rs1565533613
NM_000051.3(ATM):c.7654C>A (p.His2552Asn) rs786202174
NM_000051.3(ATM):c.7655_7656insGA (p.His2552fs) rs1565533629
NM_000051.3(ATM):c.7656C>A (p.His2552Gln) rs1555124473
NM_000051.3(ATM):c.7657C>A (p.Pro2553Thr) rs1555124475
NM_000051.3(ATM):c.7658C>A (p.Pro2553His) rs864622368
NM_000051.3(ATM):c.7658C>G (p.Pro2553Arg) rs864622368
NM_000051.3(ATM):c.7658C>T (p.Pro2553Leu) rs864622368
NM_000051.3(ATM):c.7660C>T (p.His2554Tyr) rs1555124482
NM_000051.3(ATM):c.7661A>T (p.His2554Leu) rs1555124487
NM_000051.3(ATM):c.7663C>A (p.His2555Asn) rs786203651
NM_000051.3(ATM):c.7664A>G (p.His2555Arg) rs876658925
NM_000051.3(ATM):c.7665delinsGTGA (p.His2555delinsGlnTer) rs1555124503
NM_000051.3(ATM):c.7667C>A (p.Thr2556Asn) rs1226186392
NM_000051.3(ATM):c.7669_7670del (p.Leu2557fs) rs1565533778
NM_000051.3(ATM):c.7671_7674del (p.Phe2558fs) rs1555124506
NM_000051.3(ATM):c.7681C>T (p.Leu2561=) rs1060504314
NM_000051.3(ATM):c.7684G>A (p.Ala2562Thr) rs1555124521
NM_000051.3(ATM):c.7684G>T (p.Ala2562Ser)
NM_000051.3(ATM):c.7685C>A (p.Ala2562Asp) rs1322308382
NM_000051.3(ATM):c.7686C>T (p.Ala2562=) rs1555124531
NM_000051.3(ATM):c.7687T>G (p.Leu2563Val) rs1208002418
NM_000051.3(ATM):c.7690G>A (p.Ala2564Thr) rs940285361
NM_000051.3(ATM):c.7693A>G (p.Asn2565Asp) rs1555124543
NM_000051.3(ATM):c.7696G>A (p.Ala2566Thr) rs1060501604
NM_000051.3(ATM):c.7699_7702del (p.Asn2567fs) rs1060501547
NM_000051.3(ATM):c.7701C>T (p.Asn2567=) rs786201637
NM_000051.3(ATM):c.7701_7702del (p.Asn2567fs) rs1064793359
NM_000051.3(ATM):c.7703G>A (p.Arg2568Lys)
NM_000051.3(ATM):c.7703_7704GA[1] (p.Arg2568_Asp2569insTer) rs759965045
NM_000051.3(ATM):c.7706A>G (p.Asp2569Gly) rs1555124575
NM_000051.3(ATM):c.7708G>T (p.Glu2570Ter) rs1555124587
NM_000051.3(ATM):c.7710A>G (p.Glu2570=) rs760215505
NM_000051.3(ATM):c.7712T>C (p.Phe2571Ser) rs1555124612
NM_000051.3(ATM):c.7714C>T (p.Leu2572=) rs1472587727
NM_000051.3(ATM):c.7716G>C (p.Leu2572=) rs763730344
NM_000051.3(ATM):c.7718C>G (p.Thr2573Ser) rs1565534068
NM_000051.3(ATM):c.7720A>C (p.Lys2574Gln) rs1357229307
NM_000051.3(ATM):c.7725A>G (p.Pro2575=) rs876658509
NM_000051.3(ATM):c.7727A>G (p.Glu2576Gly) rs1202657573
NM_000051.3(ATM):c.7729G>A (p.Val2577Ile) rs1064795004
NM_000051.3(ATM):c.7732G>C (p.Ala2578Pro) rs1555124632
NM_000051.3(ATM):c.7736G>C (p.Arg2579Thr) rs879254206
NM_000051.3(ATM):c.7737_7739AAG[1] (p.Arg2580del) rs1064795204
NM_000051.3(ATM):c.7739G>A (p.Arg2580Lys) rs761790685
NM_000051.3(ATM):c.7740A>C (p.Arg2580Ser) rs199915459
NM_000051.3(ATM):c.7742G>A (p.Ser2581Asn) rs1064795028
NM_000051.3(ATM):c.7744A>G (p.Arg2582Gly) rs750224234
NM_000051.3(ATM):c.7757A>G (p.Asn2586Ser) rs587778079
NM_000051.3(ATM):c.7764dup (p.Lys2589Ter)
NM_000051.3(ATM):c.7765A>G (p.Lys2589Glu) rs876659557
NM_000051.3(ATM):c.7766A>G (p.Lys2589Arg) rs878853546
NM_000051.3(ATM):c.7767del (p.Lys2589fs) rs1057517025
NM_000051.3(ATM):c.7768C>G (p.Gln2590Glu) rs876659561
NM_000051.3(ATM):c.7768C>T (p.Gln2590Ter)
NM_000051.3(ATM):c.7769A>G (p.Gln2590Arg) rs1555124706
NM_000051.3(ATM):c.7770A>G (p.Gln2590=) rs864622437
NM_000051.3(ATM):c.7772G>A (p.Ser2591Asn) rs730881319
NM_000051.3(ATM):c.7774T>C (p.Ser2592Pro) rs786202025
NM_000051.3(ATM):c.7775C>G (p.Ser2592Cys) rs755009196
NM_000051.3(ATM):c.7777C>T (p.Gln2593Ter) rs781215442
NM_000051.3(ATM):c.7778A>G (p.Gln2593Arg) rs587779867
NM_000051.3(ATM):c.7779G>A (p.Gln2593=) rs770321620
NM_000051.3(ATM):c.7782T>A (p.Leu2594=) rs905474729
NM_000051.3(ATM):c.7785T>C (p.Asp2595=) rs34838175
NM_000051.3(ATM):c.7786G>A (p.Glu2596Lys) rs1555124747
NM_000051.3(ATM):c.7788+10T>G rs1555124759
NM_000051.3(ATM):c.7788+12A>T rs1555124760
NM_000051.3(ATM):c.7788+19C>T rs201990371
NM_000051.3(ATM):c.7788+1G>T rs1565534524
NM_000051.3(ATM):c.7788+20G>A rs775245736
NM_000051.3(ATM):c.7788+3A>G rs869312788
NM_000051.3(ATM):c.7788+3A>T rs869312788
NM_000051.3(ATM):c.7788+7G>A rs749610251
NM_000051.3(ATM):c.7788+8G>T rs112775908
NM_000051.3(ATM):c.7788G>A (p.Glu2596=) rs587780639
NM_000051.3(ATM):c.7788G>C (p.Glu2596Asp) rs587780639
NM_000051.3(ATM):c.7788G>T (p.Glu2596Asp) rs587780639
NM_000051.3(ATM):c.7789-15G>C rs781449587
NM_000051.3(ATM):c.7789-16dupT rs776103192
NM_000051.3(ATM):c.7789-3T>G rs864622185
NM_000051.3(ATM):c.7789-9dup rs1555125203
NM_000051.3(ATM):c.7789G>T (p.Asp2597Tyr) rs1555125212
NM_000051.3(ATM):c.7792C>T (p.Arg2598Ter) rs138941496
NM_000051.3(ATM):c.7792del (p.Arg2598fs)
NM_000051.3(ATM):c.7793G>A (p.Arg2598Gln) rs140263969
NM_000051.3(ATM):c.7793G>T (p.Arg2598Leu) rs140263969
NM_000051.3(ATM):c.7794A>C (p.Arg2598=) rs1555125220
NM_000051.3(ATM):c.7796del (p.Thr2599fs) rs1555125223
NM_000051.3(ATM):c.7804G>A (p.Ala2602Thr) rs1555125227
NM_000051.3(ATM):c.7808A>G (p.Asn2603Ser) rs150355232
NM_000051.3(ATM):c.7812A>T (p.Arg2604Ser) rs1484346818
NM_000051.3(ATM):c.7813_7815ATA[1] (p.Ile2606del) rs786203830
NM_000051.3(ATM):c.7816A>G (p.Ile2606Val) rs376824528
NM_000051.3(ATM):c.7818A>G (p.Ile2606Met) rs1027959208
NM_000051.3(ATM):c.7819T>C (p.Cys2607Arg) rs1459650575
NM_000051.3(ATM):c.7825A>G (p.Ile2609Val) rs779400418
NM_000051.3(ATM):c.7826T>C (p.Ile2609Thr) rs369846067
NM_000051.3(ATM):c.7827C>T (p.Ile2609=) rs768423205
NM_000051.3(ATM):c.7834A>C (p.Arg2612=) rs1305691166
NM_000051.3(ATM):c.7835G>A (p.Arg2612Lys) rs138048269
NM_000051.3(ATM):c.7836G>A (p.Arg2612=) rs761324887
NM_000051.3(ATM):c.7836_7837GA[3] (p.Pro2614fs) rs730881293
NM_000051.3(ATM):c.7840C>T (p.Pro2614Ser) rs1555125305
NM_000051.3(ATM):c.7841C>A (p.Pro2614His) rs769207177
NM_000051.3(ATM):c.7841C>T (p.Pro2614Leu) rs769207177
NM_000051.3(ATM):c.7842T>G (p.Pro2614=) rs876660827
NM_000051.3(ATM):c.7843C>G (p.Gln2615Glu)
NM_000051.3(ATM):c.7846A>G (p.Met2616Val) rs876658208
NM_000051.3(ATM):c.7847T>C (p.Met2616Thr) rs762765902
NM_000051.3(ATM):c.7849G>T (p.Val2617Phe) rs1555125331
NM_000051.3(ATM):c.7852A>C (p.Arg2618=) rs1057521185
NM_000051.3(ATM):c.7852A>G (p.Arg2618Gly) rs1057521185
NM_000051.3(ATM):c.7854A>C (p.Arg2618Ser) rs1565536250
NM_000051.3(ATM):c.7857T>C (p.Ser2619=) rs1555125339
NM_000051.3(ATM):c.7858del (p.Val2620fs) rs1555125349
NM_000051.3(ATM):c.7860T>G (p.Val2620=) rs1555125353
NM_000051.3(ATM):c.7861G>C (p.Glu2621Gln) rs1555125355
NM_000051.3(ATM):c.7865C>G (p.Ala2622Gly) rs766351395
NM_000051.3(ATM):c.7865C>T (p.Ala2622Val) rs766351395
NM_000051.3(ATM):c.7867C>G (p.Leu2623Val)
NM_000051.3(ATM):c.7869T>C (p.Leu2623=) rs1565536371
NM_000051.3(ATM):c.7871G>C (p.Cys2624Ser)
NM_000051.3(ATM):c.7874A>C (p.Asp2625Ala) rs876660121
NM_000051.3(ATM):c.7875_7876delTGinsGC (p.Asp2625_Ala2626delinsGluPro) rs267606668
NM_000051.3(ATM):c.7877C>T (p.Ala2626Val) rs1555125394
NM_000051.3(ATM):c.7880A>G (p.Tyr2627Cys) rs767670019
NM_000051.3(ATM):c.7880del (p.Tyr2627fs) rs1057516599
NM_000051.3(ATM):c.7881_7885TATTA[1] (p.Ile2629fs) rs1450394308
NM_000051.3(ATM):c.7882A>C (p.Ile2628Leu)
NM_000051.3(ATM):c.7882A>G (p.Ile2628Val) rs587781370
NM_000051.3(ATM):c.7887A>G (p.Ile2629Met) rs752886000
NM_000051.3(ATM):c.7888T>G (p.Leu2630Val) rs1555125427
NM_000051.3(ATM):c.7889T>A (p.Leu2630Ter)
NM_000051.3(ATM):c.7890A>G (p.Leu2630=) rs756181210
NM_000051.3(ATM):c.7897T>G (p.Leu2633Val) rs587779868
NM_000051.3(ATM):c.7901A>T (p.Asp2634Val) rs876660909
NM_000051.3(ATM):c.7902T>G (p.Asp2634Glu) rs373147078
NM_000051.3(ATM):c.7904C>G (p.Ala2635Gly) rs754002355
NM_000051.3(ATM):c.7905C>T (p.Ala2635=) rs757829783
NM_000051.3(ATM):c.7910A>G (p.Gln2637Arg) rs1555125476
NM_000051.3(ATM):c.7912T>G (p.Trp2638Gly) rs563137460
NM_000051.3(ATM):c.7913G>A (p.Trp2638Ter) rs377349459
NM_000051.3(ATM):c.7914G>T (p.Trp2638Cys) rs758843096
NM_000051.3(ATM):c.7917G>A (p.Lys2639=) rs1555125501
NM_000051.3(ATM):c.7919C>G (p.Thr2640Ser) rs4988125
NM_000051.3(ATM):c.7919C>T (p.Thr2640Ile) rs4988125
NM_000051.3(ATM):c.7921C>T (p.Gln2641Ter) rs769523686
NM_000051.3(ATM):c.7926A>C (p.Arg2642Ser) rs863224440
NM_000051.3(ATM):c.7927+10T>C rs730881277
NM_000051.3(ATM):c.7927+13T>A rs748853277
NM_000051.3(ATM):c.7927+13delT rs587781324
NM_000051.3(ATM):c.7927+13dup rs587781324
NM_000051.3(ATM):c.7927+14A>G rs770850205
NM_000051.3(ATM):c.7927+16A>C rs746438364
NM_000051.3(ATM):c.7927+17G>A rs774276048
NM_000051.3(ATM):c.7927+1G>C rs1555125532
NM_000051.3(ATM):c.7927+5G>A rs1299306446
NM_000051.3(ATM):c.7927+5G>C rs1299306446
NM_000051.3(ATM):c.7927+5delG rs786204437
NM_000051.3(ATM):c.7927+6T>G
NM_000051.3(ATM):c.7927+7T>G rs1057521294
NM_000051.3(ATM):c.7927A>G (p.Lys2643Glu) rs587782487
NM_000051.3(ATM):c.7928-10T>C rs188404773
NM_000051.3(ATM):c.7928-10T>G rs188404773
NM_000051.3(ATM):c.7928-1G>A rs1555126163
NM_000051.3(ATM):c.7928-2A>G rs864622610
NM_000051.3(ATM):c.7928-2A>T rs864622610
NM_000051.3(ATM):c.7928-3C>T rs1555126153
NM_000051.3(ATM):c.7928-4A>C rs876658629
NM_000051.3(ATM):c.7928-6A>T rs373509918
NM_000051.3(ATM):c.7928-9T>C rs1060504261
NM_000051.3(ATM):c.7929A>T (p.Lys2643Asn) rs780247224
NM_000051.3(ATM):c.7929delA rs1064795550
NM_000051.3(ATM):c.7930G>A (p.Gly2644Ser) rs587781897
NM_000051.3(ATM):c.7930G>C (p.Gly2644Arg) rs587781897
NM_000051.3(ATM):c.7933A>G (p.Ile2645Val) rs937831636
NM_000051.3(ATM):c.7936A>C (p.Asn2646His) rs1060501575
NM_000051.3(ATM):c.7942C>A (p.Pro2648Thr) rs878853547
NM_000051.3(ATM):c.7942C>G (p.Pro2648Ala) rs878853547
NM_000051.3(ATM):c.7946C>T (p.Ala2649Val) rs876660877
NM_000051.3(ATM):c.7947A>C (p.Ala2649=) rs1060504301
NM_000051.3(ATM):c.7947A>G (p.Ala2649=) rs1060504301
NM_000051.3(ATM):c.7948G>A (p.Asp2650Asn) rs786202219
NM_000051.3(ATM):c.7949A>C (p.Asp2650Ala) rs1060501635
NM_000051.3(ATM):c.7950C>T (p.Asp2650=) rs1060504298
NM_000051.3(ATM):c.7951C>A (p.Gln2651Lys) rs587781994
NM_000051.3(ATM):c.7951C>T (p.Gln2651Ter) rs587781994
NM_000051.3(ATM):c.7955C>T (p.Pro2652Leu) rs1565538433
NM_000051.3(ATM):c.7957A>G (p.Ile2653Val) rs747448699
NM_000051.3(ATM):c.7958_7960del (p.Ile2653del) rs1555126226
NM_000051.3(ATM):c.7961C>T (p.Thr2654Ile) rs786203621
NM_000051.3(ATM):c.7967T>C (p.Leu2656Pro) rs121434218
NM_000051.3(ATM):c.7967T>G (p.Leu2656Arg) rs121434218
NM_000051.3(ATM):c.7969A>G (p.Lys2657Glu) rs755706903
NM_000051.3(ATM):c.7974T>C (p.Asn2658=) rs777548685
NM_000051.3(ATM):c.7976T>C (p.Leu2659Ser) rs1565538536
NM_000051.3(ATM):c.7978del (p.Glu2660fs)
NM_000051.3(ATM):c.7980A>T (p.Glu2660Asp) rs1555126247
NM_000051.3(ATM):c.7983T>C (p.Asp2661=) rs143972422
NM_000051.3(ATM):c.7983_7985TGT[2] (p.Val2664del) rs876660743
NM_000051.3(ATM):c.7984G>A (p.Val2662Ile) rs1315805984
NM_000051.3(ATM):c.7985T>A (p.Val2662Asp) rs863224463
NM_000051.3(ATM):c.7988T>C (p.Val2663Ala) rs377648506
NM_000051.3(ATM):c.7988_7991del (p.Val2663fs) rs587776550
NM_000051.3(ATM):c.7989T>C (p.Val2663=) rs774232968
NM_000051.3(ATM):c.7991_8010+8dup rs1555126295
NM_000051.3(ATM):c.7993C>G (p.Pro2665Ala) rs1555126304
NM_000051.3(ATM):c.7994C>A (p.Pro2665His)
NM_000051.3(ATM):c.7994C>T (p.Pro2665Leu)
NM_000051.3(ATM):c.7996A>C (p.Thr2666Pro) rs745775382
NM_000051.3(ATM):c.7996A>G (p.Thr2666Ala) rs745775382
NM_000051.3(ATM):c.7997C>A (p.Thr2666Asn) rs730881384
NM_000051.3(ATM):c.7998dup (p.Met2667fs) rs587779869
NM_000051.3(ATM):c.7999A>G (p.Met2667Val) rs34099398
NM_000051.3(ATM):c.7999A>T (p.Met2667Leu) rs34099398
NM_000051.3(ATM):c.8000T>C (p.Met2667Thr) rs1060501566
NM_000051.3(ATM):c.8001G>A (p.Met2667Ile)
NM_000051.3(ATM):c.8010+11A>C rs760588708
NM_000051.3(ATM):c.8010+185_8010+186delCC rs984385407
NM_000051.3(ATM):c.8010+186C>T rs227060
NM_000051.3(ATM):c.8010+18_8010+19del rs750095790
NM_000051.3(ATM):c.8010+19T>C rs1555126346
NM_000051.3(ATM):c.8010+19_8010+22delinsGAT rs1555126353
NM_000051.3(ATM):c.8010+1delG rs876659350
NM_000051.3(ATM):c.8010+234T>C rs527325769
NM_000051.3(ATM):c.8010+2T>C
NM_000051.3(ATM):c.8010+30dup rs3218702
NM_000051.3(ATM):c.8010+5T>A rs56256497
NM_000051.3(ATM):c.8010+5T>C rs56256497
NM_000051.3(ATM):c.8010+5T>G rs56256497
NM_000051.3(ATM):c.8011-10C>G rs1555127008
NM_000051.3(ATM):c.8011-131T>C
NM_000051.3(ATM):c.8011-16T>C rs776948701
NM_000051.3(ATM):c.8011-18T>C rs768522292
NM_000051.3(ATM):c.8011-1G>C rs1555127017
NM_000051.3(ATM):c.8011-1G>T rs1555127017
NM_000051.3(ATM):c.8011-215G>C rs766286034
NM_000051.3(ATM):c.8011-2A>C
NM_000051.3(ATM):c.8011-496T>C rs869312478
NM_000051.3(ATM):c.8011-6T>G rs762092284
NM_000051.3(ATM):c.8014G>T (p.Asp2672Tyr) rs1555127024
NM_000051.3(ATM):c.8015A>C (p.Asp2672Ala) rs763161651
NM_000051.3(ATM):c.8015A>G (p.Asp2672Gly)
NM_000051.3(ATM):c.8017C>T (p.His2673Tyr) rs1555127035
NM_000051.3(ATM):c.8026G>A (p.Glu2676Lys) rs786202859
NM_000051.3(ATM):c.8028A>G (p.Glu2676=) rs1389648050
NM_000051.3(ATM):c.8030A>G (p.Tyr2677Cys) rs28942103
NM_000051.3(ATM):c.8032G>A (p.Gly2678Arg) rs766730487
NM_000051.3(ATM):c.8036_8051del (p.Asn2679fs) rs587780640
NM_000051.3(ATM):c.8041G>A (p.Val2681Met) rs1064795034
NM_000051.3(ATM):c.8041G>C (p.Val2681Leu) rs1064795034
NM_000051.3(ATM):c.8044A>C (p.Thr2682Pro) rs730881320
NM_000051.3(ATM):c.8045C>G (p.Thr2682Ser)
NM_000051.3(ATM):c.8046T>C (p.Thr2682=) rs876660435
NM_000051.3(ATM):c.8046_8047TA[1] (p.Ile2683fs) rs1565540673
NM_000051.3(ATM):c.8047A>G (p.Ile2683Val) rs587781344
NM_000051.3(ATM):c.8047A>T (p.Ile2683Leu) rs587781344
NM_000051.3(ATM):c.8048T>C (p.Ile2683Thr) rs1555127096
NM_000051.3(ATM):c.8049A>G (p.Ile2683Met) rs1292192410
NM_000051.3(ATM):c.8050C>T (p.Gln2684Ter) rs1555127102
NM_000051.3(ATM):c.8051A>G (p.Gln2684Arg) rs1555127107
NM_000051.3(ATM):c.8056T>C (p.Phe2686Leu) rs1555127125
NM_000051.3(ATM):c.8062G>A (p.Ala2688Thr) rs1565540761
NM_000051.3(ATM):c.8066A>G (p.Glu2689Gly) rs759779781
NM_000051.3(ATM):c.8071C>T (p.Arg2691Cys) rs531980488
NM_000051.3(ATM):c.8072G>A (p.Arg2691His) rs876658385
NM_000051.3(ATM):c.8072G>C (p.Arg2691Pro) rs876658385
NM_000051.3(ATM):c.8073C>G (p.Arg2691=)
NM_000051.3(ATM):c.8076dup (p.Ala2693fs) rs1555127151
NM_000051.3(ATM):c.8079_8081AGG[1] (p.Gly2695del) rs1565540828
NM_000051.3(ATM):c.8080G>A (p.Gly2694Arg) rs1555127157
NM_000051.3(ATM):c.8082A>C (p.Gly2694=) rs540266635
NM_000051.3(ATM):c.8083G>A (p.Gly2695Ser) rs1555127166
NM_000051.3(ATM):c.8083G>T (p.Gly2695Cys) rs1555127166
NM_000051.3(ATM):c.8084G>A (p.Gly2695Asp) rs1060501680
NM_000051.3(ATM):c.8084G>C (p.Gly2695Ala)
NM_000051.3(ATM):c.8085T>G (p.Gly2695=) rs1057520554
NM_000051.3(ATM):c.8086G>A (p.Val2696Ile) rs989577687
NM_000051.3(ATM):c.8089A>G (p.Asn2697Asp) rs1555127177
NM_000051.3(ATM):c.8091T>C (p.Asn2697=) rs756887364
NM_000051.3(ATM):c.8094A>G (p.Leu2698=) rs786203569
NM_000051.3(ATM):c.8096C>G (p.Pro2699Arg) rs879254209
NM_000051.3(ATM):c.8098A>T (p.Lys2700Ter) rs758588019
NM_000051.3(ATM):c.8100A>G (p.Lys2700=) rs778601472
NM_000051.3(ATM):c.8100A>T (p.Lys2700Asn) rs778601472
NM_000051.3(ATM):c.8103_8104del (p.Ile2702fs) rs1064793406
NM_000051.3(ATM):c.8105T>G (p.Ile2702Arg) rs876659735
NM_000051.3(ATM):c.8106dup (p.Asp2703fs) rs1555127231
NM_000051.3(ATM):c.8107G>A (p.Asp2703Asn) rs1555127236
NM_000051.3(ATM):c.8108A>T (p.Asp2703Val) rs1565541059
NM_000051.3(ATM):c.8109T>C (p.Asp2703=) rs201689025
NM_000051.3(ATM):c.8111G>A (p.Cys2704Tyr) rs1555127249
NM_000051.3(ATM):c.8112T>C (p.Cys2704=) rs786201543
NM_000051.3(ATM):c.8113G>A (p.Val2705Ile) rs587779870
NM_000051.3(ATM):c.8113G>T (p.Val2705Leu) rs587779870
NM_000051.3(ATM):c.8118T>C (p.Gly2706=) rs1057520990
NM_000051.3(ATM):c.8119T>A (p.Ser2707Thr) rs1555127276
NM_000051.3(ATM):c.8120C>G (p.Ser2707Cys) rs748016261
NM_000051.3(ATM):c.8121C>T (p.Ser2707=) rs770138283
NM_000051.3(ATM):c.8122G>A (p.Asp2708Asn) rs587782719
NM_000051.3(ATM):c.8122G>C (p.Asp2708His) rs587782719
NM_000051.3(ATM):c.8124T>A (p.Asp2708Glu) rs587781990
NM_000051.3(ATM):c.8124T>C (p.Asp2708=) rs587781990
NM_000051.3(ATM):c.8125G>A (p.Gly2709Ser) rs3218680
NM_000051.3(ATM):c.8127del (p.Lys2710fs)
NM_000051.3(ATM):c.8129A>G (p.Lys2710Arg) rs587782001
NM_000051.3(ATM):c.8138G>A (p.Arg2713Lys) rs876659351
NM_000051.3(ATM):c.8138G>C (p.Arg2713Thr) rs876659351
NM_000051.3(ATM):c.8140C>A (p.Gln2714Lys) rs1060501695
NM_000051.3(ATM):c.8140C>G (p.Gln2714Glu) rs1060501695
NM_000051.3(ATM):c.8140C>T (p.Gln2714Ter) rs1060501695
NM_000051.3(ATM):c.8142G>A (p.Gln2714=) rs1565541302
NM_000051.3(ATM):c.8146G>T (p.Val2716Phe) rs730881385
NM_000051.3(ATM):c.8147T>C (p.Val2716Ala) rs587782652
NM_000051.3(ATM):c.8148_8151+2delTAAGGT rs1565541335
NM_000051.3(ATM):c.8149A>C (p.Lys2717Gln)
NM_000051.3(ATM):c.8149A>T (p.Lys2717Ter) rs774334667
NM_000051.3(ATM):c.8150A>G (p.Lys2717Arg) rs1555127353
NM_000051.3(ATM):c.8151+11C>T rs555381912
NM_000051.3(ATM):c.8151+17C>G
NM_000051.3(ATM):c.8151+3G>A rs760065522
NM_000051.3(ATM):c.8151+4A>T rs1294982909
NM_000051.3(ATM):c.8151+5G>A rs1555127370
NM_000051.3(ATM):c.8151+8T>C rs768069197
NM_000051.3(ATM):c.8152-16C>G rs1555128173
NM_000051.3(ATM):c.8152-17G>A rs368924012
NM_000051.3(ATM):c.8152-1G>A rs1398616877
NM_000051.3(ATM):c.8152-20C>T rs1555128158
NM_000051.3(ATM):c.8152-2A>G rs777602049
NM_000051.3(ATM):c.8152-6C>T rs200389039
NM_000051.3(ATM):c.8152-8T>G rs752705487
NM_000051.3(ATM):c.8152-9A>G rs1555128181
NM_000051.3(ATM):c.8152G>A (p.Gly2718Ser) rs1060501689
NM_000051.3(ATM):c.8154C>T (p.Gly2718=) rs371021126
NM_000051.3(ATM):c.8155C>T (p.Arg2719Cys) rs138526014
NM_000051.3(ATM):c.8156G>A (p.Arg2719His) rs55982963
NM_000051.3(ATM):c.8156G>T (p.Arg2719Leu) rs55982963
NM_000051.3(ATM):c.8158G>A (p.Asp2720Asn) rs876659942
NM_000051.3(ATM):c.8158G>C (p.Asp2720His)
NM_000051.3(ATM):c.8161G>C (p.Asp2721His) rs876659066
NM_000051.3(ATM):c.8162A>G (p.Asp2721Gly) rs1555128280
NM_000051.3(ATM):c.8164C>G (p.Leu2722Val) rs587782399
NM_000051.3(ATM):c.8164C>T (p.Leu2722=) rs587782399
NM_000051.3(ATM):c.8164_8181del (p.Leu2722_Val2727del) rs1555128287
NM_000051.3(ATM):c.8168G>T (p.Arg2723Ile) rs1555128301
NM_000051.3(ATM):c.8169A>T (p.Arg2723Ser) rs780495319
NM_000051.3(ATM):c.8171A>G (p.Gln2724Arg) rs1565543300
NM_000051.3(ATM):c.8173G>C (p.Asp2725His) rs587782049
NM_000051.3(ATM):c.8174A>G (p.Asp2725Gly) rs1555128314
NM_000051.3(ATM):c.8178T>C (p.Ala2726=) rs367575159
NM_000051.3(ATM):c.8180T>C (p.Val2727Ala) rs1565543359
NM_000051.3(ATM):c.8180T>G (p.Val2727Gly)
NM_000051.3(ATM):c.8182A>T (p.Met2728Leu) rs1555128338
NM_000051.3(ATM):c.8185C>T (p.Gln2729Ter) rs587781967
NM_000051.3(ATM):c.8186A>C (p.Gln2729Pro) rs1555128350
NM_000051.3(ATM):c.8187A>C (p.Gln2729His) rs587781946
NM_000051.3(ATM):c.8187A>G (p.Gln2729=) rs587781946
NM_000051.3(ATM):c.8187A>T (p.Gln2729His) rs587781946
NM_000051.3(ATM):c.8188C>A (p.Gln2730Lys) rs587782317
NM_000051.3(ATM):c.8189A>C (p.Gln2730Pro)
NM_000051.3(ATM):c.8189A>G (p.Gln2730Arg)
NM_000051.3(ATM):c.8193C>A (p.Val2731=) rs1060504307
NM_000051.3(ATM):c.8194T>C (p.Phe2732Leu) rs876659619
NM_000051.3(ATM):c.8194T>G (p.Phe2732Val) rs876659619
NM_000051.3(ATM):c.8198A>G (p.Gln2733Arg)
NM_000051.3(ATM):c.8199G>A (p.Gln2733=) rs770552705
NM_000051.3(ATM):c.8202_8203GT[3] (p.Asn2736fs) rs1555128432
NM_000051.3(ATM):c.8206A>T (p.Asn2736Tyr) rs1060501577
NM_000051.3(ATM):c.8206_8207dup (p.Asn2736fs) rs587782525
NM_000051.3(ATM):c.8207A>G (p.Asn2736Ser) rs1190456608
NM_000051.3(ATM):c.8208T>C (p.Asn2736=) rs1057523318
NM_000051.3(ATM):c.8211A>G (p.Thr2737=) rs876660946
NM_000051.3(ATM):c.8211A>T (p.Thr2737=) rs876660946
NM_000051.3(ATM):c.8213T>G (p.Leu2738Ter) rs773889320
NM_000051.3(ATM):c.8215C>T (p.Leu2739=) rs1060504311
NM_000051.3(ATM):c.8217G>A (p.Leu2739=) rs759069006
NM_000051.3(ATM):c.8217G>T (p.Leu2739=) rs759069006
NM_000051.3(ATM):c.8218C>T (p.Gln2740Ter) rs866402530
NM_000051.3(ATM):c.8220G>A (p.Gln2740=) rs1060504313
NM_000051.3(ATM):c.8224_8225del (p.Asn2742fs) rs1162534390
NM_000051.3(ATM):c.8228C>G (p.Thr2743Arg) rs730881321
NM_000051.3(ATM):c.8228C>T (p.Thr2743Met) rs730881321
NM_000051.3(ATM):c.8229G>A (p.Thr2743=) rs150603052
NM_000051.3(ATM):c.8231A>C (p.Glu2744Ala) rs764003317
NM_000051.3(ATM):c.8234C>T (p.Thr2745Ile) rs786203094
NM_000051.3(ATM):c.8240A>G (p.Lys2747Arg) rs1038749014
NM_000051.3(ATM):c.8246A>G (p.Lys2749Arg) rs779145081
NM_000051.3(ATM):c.8246A>T (p.Lys2749Ile) rs779145081
NM_000051.3(ATM):c.8248T>A (p.Leu2750Ile) rs876658559
NM_000051.3(ATM):c.8248T>C (p.Leu2750=) rs876658559
NM_000051.3(ATM):c.8248_8268del (p.Leu2750_Lys2756del) rs771146489
NM_000051.3(ATM):c.8249dup (p.Leu2750fs) rs1565543844
NM_000051.3(ATM):c.8251_8254del (p.Thr2751fs) rs786202120
NM_000051.3(ATM):c.8254A>G (p.Ile2752Val) rs1215163673
NM_000051.3(ATM):c.8256C>G (p.Ile2752Met) rs1555128574
NM_000051.3(ATM):c.8258G>T (p.Cys2753Phe) rs1284049490
NM_000051.3(ATM):c.8260A>G (p.Thr2754Ala) rs587781414
NM_000051.3(ATM):c.8261C>T (p.Thr2754Ile) rs587779871
NM_000051.3(ATM):c.8262T>G (p.Thr2754=) rs1057521506
NM_000051.3(ATM):c.8264_8268del (p.Tyr2755fs) rs730881294
NM_000051.3(ATM):c.8265T>C (p.Tyr2755=) rs758654836
NM_000051.3(ATM):c.8265T>G (p.Tyr2755Ter) rs758654836
NM_000051.3(ATM):c.8266A>C (p.Lys2756Gln) rs371638537
NM_000051.3(ATM):c.8266A>G (p.Lys2756Glu) rs371638537
NM_000051.3(ATM):c.8266A>T (p.Lys2756Ter) rs371638537
NM_000051.3(ATM):c.8267A>G (p.Lys2756Arg) rs1555128635
NM_000051.3(ATM):c.8268+11G>A rs769204788
NM_000051.3(ATM):c.8268+13A>T rs1400036072
NM_000051.3(ATM):c.8268+14C>T rs1057520231
NM_000051.3(ATM):c.8268+15T>G rs1555128691
NM_000051.3(ATM):c.8268+17C>T rs1555128698
NM_000051.3(ATM):c.8268+18T>C rs1555128701
NM_000051.3(ATM):c.8268+1G>A rs876658957
NM_000051.3(ATM):c.8268+1G>T rs876658957
NM_000051.3(ATM):c.8268+22_8268+25del rs746285826
NM_000051.3(ATM):c.8268+5C>T rs1565544035
NM_000051.3(ATM):c.8268+6T>A rs747153940
NM_000051.3(ATM):c.8268+7A>G rs1057524565
NM_000051.3(ATM):c.8268G>T (p.Lys2756Asn) rs1555128642
NM_000051.3(ATM):c.8269-10_8269-9delGT rs587780641
NM_000051.3(ATM):c.8269-14A>T rs114320959
NM_000051.3(ATM):c.8269-18_8269-15delTTTA rs1064794684
NM_000051.3(ATM):c.8269-1G>C rs1565557607
NM_000051.3(ATM):c.8269-3C>T rs1555135336
NM_000051.3(ATM):c.8269-5T>G rs1555135331
NM_000051.3(ATM):c.8269G>A (p.Val2757Met) rs761625350
NM_000051.3(ATM):c.8269G>C (p.Val2757Leu) rs761625350
NM_000051.3(ATM):c.8269delG rs1555135341
NM_000051.3(ATM):c.8270T>G (p.Val2757Gly) rs201216427
NM_000051.3(ATM):c.8272G>T (p.Val2758Phe) rs1555135373
NM_000051.3(ATM):c.8275C>G (p.Pro2759Ala)
NM_000051.3(ATM):c.8275C>T (p.Pro2759Ser) rs764906663
NM_000051.3(ATM):c.8277C>T (p.Pro2759=) rs878853548
NM_000051.3(ATM):c.8278C>G (p.Leu2760Val) rs758609900
NM_000051.3(ATM):c.8279T>C (p.Leu2760Pro) rs1060501578
NM_000051.3(ATM):c.8279_8280TC[1] (p.Gln2762fs)
NM_000051.3(ATM):c.8279_8280TC[2] (p.Gln2762fs) rs775899653
NM_000051.3(ATM):c.8284C>T (p.Gln2762Ter) rs751574257
NM_000051.3(ATM):c.8287C>T (p.Arg2763Ter) rs876659872
NM_000051.3(ATM):c.8288G>A (p.Arg2763Gln) rs551411717
NM_000051.3(ATM):c.8288del (p.Arg2763fs) rs886039630
NM_000051.3(ATM):c.8291_8293GTG[1] (p.Gly2765del) rs1565557806
NM_000051.3(ATM):c.8292_8293del (p.Ser2764fs) rs879254036
NM_000051.3(ATM):c.8293G>A (p.Gly2765Ser) rs748634900
NM_000051.3(ATM):c.8294G>A (p.Gly2765Asp) rs1565557835
NM_000051.3(ATM):c.8296G>A (p.Val2766Ile) rs730881322
NM_000051.3(ATM):c.8297T>G (p.Val2766Gly) rs1064796249
NM_000051.3(ATM):c.8299C>T (p.Leu2767Phe) rs786203975
NM_000051.3(ATM):c.8300T>G (p.Leu2767Arg)
NM_000051.3(ATM):c.8301T>G (p.Leu2767=) rs1060504303
NM_000051.3(ATM):c.8302G>A (p.Glu2768Lys) rs1555135513
NM_000051.3(ATM):c.8305T>C (p.Trp2769Arg)
NM_000051.3(ATM):c.8305_8317del (p.Trp2769fs) rs786202318
NM_000051.3(ATM):c.8307G>A (p.Trp2769Ter) rs778269655
NM_000051.3(ATM):c.8308T>G (p.Cys2770Gly) rs749737164
NM_000051.3(ATM):c.8310C>T (p.Cys2770=) rs1555135544
NM_000051.3(ATM):c.8311A>G (p.Thr2771Ala) rs876660587
NM_000051.3(ATM):c.8312C>T (p.Thr2771Ile) rs771781881
NM_000051.3(ATM):c.8313A>C (p.Thr2771=) rs1555135563
NM_000051.3(ATM):c.8314G>A (p.Gly2772Arg) rs1064794239
NM_000051.3(ATM):c.8315G>A (p.Gly2772Glu) rs775293524
NM_000051.3(ATM):c.8315G>C (p.Gly2772Ala) rs775293524
NM_000051.3(ATM):c.8318C>A (p.Thr2773Asn) rs786203321
NM_000051.3(ATM):c.8319_8323dup (p.Pro2775fs) rs1555135596
NM_000051.3(ATM):c.8321_8322delinsA (p.Val2774fs) rs1060501630
NM_000051.3(ATM):c.8322C>A (p.Val2774=) rs1060504267
NM_000051.3(ATM):c.8325del (p.Ile2776fs) rs886039623
NM_000051.3(ATM):c.8327T>C (p.Ile2776Thr) rs746475628
NM_000051.3(ATM):c.8328_8329del (p.Ile2776fs) rs1555135633
NM_000051.3(ATM):c.8330G>T (p.Gly2777Val) rs879254240
NM_000051.3(ATM):c.8333A>C (p.Glu2778Ala) rs876659792
NM_000051.3(ATM):c.8336T>A (p.Phe2779Tyr) rs876660461
NM_000051.3(ATM):c.8341G>T (p.Val2781Phe) rs1293051732
NM_000051.3(ATM):c.8341_8343del (p.Val2781del) rs1178661659
NM_000051.3(ATM):c.8346C>T (p.Asn2782=) rs999357615
NM_000051.3(ATM):c.8349T>C (p.Asn2783=) rs1555135681
NM_000051.3(ATM):c.8353G>A (p.Asp2785Asn) rs587782417
NM_000051.3(ATM):c.8354A>G (p.Asp2785Gly)
NM_000051.3(ATM):c.8355T>C (p.Asp2785=) rs372834825
NM_000051.3(ATM):c.8360C>T (p.Ala2787Val) rs879253877
NM_000051.3(ATM):c.8363A>C (p.His2788Pro) rs1555135716
NM_000051.3(ATM):c.8363A>G (p.His2788Arg) rs1555135716
NM_000051.3(ATM):c.8366A>G (p.Lys2789Arg)
NM_000051.3(ATM):c.8367delinsTT (p.Lys2789fs) rs786202418
NM_000051.3(ATM):c.8371_8374del (p.Tyr2791fs) rs1064793046
NM_000051.3(ATM):c.8372A>G (p.Tyr2791Cys)
NM_000051.3(ATM):c.8373C>A (p.Tyr2791Ter) rs1060504292
NM_000051.3(ATM):c.8373C>G (p.Tyr2791Ter)
NM_000051.3(ATM):c.8373C>T (p.Tyr2791=) rs1060504292
NM_000051.3(ATM):c.8377C>T (p.Pro2793Ser) rs1174335574
NM_000051.3(ATM):c.8382T>A (p.Asn2794Lys) rs1555135797
NM_000051.3(ATM):c.8383G>A (p.Asp2795Asn)
NM_000051.3(ATM):c.8383G>T (p.Asp2795Tyr) rs1565558417
NM_000051.3(ATM):c.8385_8394TTTCAGTGCC[1] (p.Phe2799fs) rs786202800
NM_000051.3(ATM):c.8386T>C (p.Phe2796Leu)
NM_000051.3(ATM):c.8389A>G (p.Ser2797Gly)
NM_000051.3(ATM):c.8390G>A (p.Ser2797Asn) rs1203037698
NM_000051.3(ATM):c.8391T>C (p.Ser2797=) rs566485657
NM_000051.3(ATM):c.8392G>T (p.Ala2798Ser)
NM_000051.3(ATM):c.8393C>A (p.Ala2798Asp) rs772992098
NM_000051.3(ATM):c.8393C>T (p.Ala2798Val) rs772992098
NM_000051.3(ATM):c.8395T>G (p.Phe2799Val) rs730881323
NM_000051.3(ATM):c.8397del (p.Gln2800fs) rs587781837
NM_000051.3(ATM):c.8399A>C (p.Gln2800Pro) rs879254273
NM_000051.3(ATM):c.8400G>C (p.Gln2800His) rs879253901
NM_000051.3(ATM):c.8403C>A (p.Cys2801Ter) rs1555135852
NM_000051.3(ATM):c.8405A>G (p.Gln2802Arg) rs730881324
NM_000051.3(ATM):c.8410A>C (p.Lys2804Gln) rs878853549
NM_000051.3(ATM):c.8412A>G (p.Lys2804=) rs1555135872
NM_000051.3(ATM):c.8415G>A (p.Met2805Ile) rs1555135878
NM_000051.3(ATM):c.8416_8418+5del
NM_000051.3(ATM):c.8417T>C (p.Met2806Thr) rs1234463032
NM_000051.3(ATM):c.8418+13C>T rs372552946
NM_000051.3(ATM):c.8418+14A>C rs1555135939
NM_000051.3(ATM):c.8418+15A>C rs1565558731
NM_000051.3(ATM):c.8418+1G>A rs766533795
NM_000051.3(ATM):c.8418+2T>C rs1060501713
NM_000051.3(ATM):c.8418+5G>A rs1305740166
NM_000051.3(ATM):c.8418+5G>T rs1305740166
NM_000051.3(ATM):c.8418+5_8418+8delGTGA rs730881295
NM_000051.3(ATM):c.8418+6T>C rs1555135928
NM_000051.3(ATM):c.8418G>A (p.Met2806Ile) rs762744146
NM_000051.3(ATM):c.8419-16_8419-13delTATT rs774275044
NM_000051.3(ATM):c.8419-17A>G rs1057520452
NM_000051.3(ATM):c.8419-19A>G rs12279930
NM_000051.3(ATM):c.8419-1G>C rs1555137920
NM_000051.3(ATM):c.8419-2A>G rs1555137917
NM_000051.3(ATM):c.8419-7_8419-4delTTTA rs730881306
NM_000051.3(ATM):c.8419-8A>G rs567215034
NM_000051.3(ATM):c.8419G>A (p.Glu2807Lys) rs1555137929
NM_000051.3(ATM):c.8419G>T (p.Glu2807Ter) rs1555137929
NM_000051.3(ATM):c.8421G>A (p.Glu2807=) rs1555137945
NM_000051.3(ATM):c.8422G>A (p.Val2808Met) rs876660616
NM_000051.3(ATM):c.8424G>T (p.Val2808=) rs786203870
NM_000051.3(ATM):c.8425C>G (p.Gln2809Glu) rs1555137973
NM_000051.3(ATM):c.8425C>T (p.Gln2809Ter) rs1555137973
NM_000051.3(ATM):c.8427A>G (p.Gln2809=) rs538173062
NM_000051.3(ATM):c.8428A>C (p.Lys2810Gln) rs730881325
NM_000051.3(ATM):c.8428A>G (p.Lys2810Glu) rs730881325
NM_000051.3(ATM):c.8429A>C (p.Lys2810Thr) rs1555137999
NM_000051.3(ATM):c.8430_8432del (p.Lys2811del) rs587782558
NM_000051.3(ATM):c.8431A>T (p.Lys2811Ter) rs1131691158
NM_000051.3(ATM):c.8432del (p.Lys2811fs) rs587782558
NM_000051.3(ATM):c.8432dup (p.Ser2812fs) rs587782558
NM_000051.3(ATM):c.8434T>C (p.Ser2812Pro) rs786202372
NM_000051.3(ATM):c.8434T>G (p.Ser2812Ala) rs786202372
NM_000051.3(ATM):c.8435C>G (p.Ser2812Cys) rs1565563280
NM_000051.3(ATM):c.8435_8436del (p.Ser2812fs) rs767533596
NM_000051.3(ATM):c.8435_8437del (p.Ser2812del)
NM_000051.3(ATM):c.8437T>C (p.Phe2813Leu) rs1280239284
NM_000051.3(ATM):c.8438T>C (p.Phe2813Ser) rs1555138027
NM_000051.3(ATM):c.8440del (p.Glu2814fs) rs752526400
NM_000051.3(ATM):c.8443G>A (p.Glu2815Lys)
NM_000051.3(ATM):c.8446A>C (p.Lys2816Gln) rs1555138041
NM_000051.3(ATM):c.8448A>G (p.Lys2816=) rs1555138048
NM_000051.3(ATM):c.8450A>G (p.Tyr2817Cys) rs747764678
NM_000051.3(ATM):c.8456T>G (p.Val2819Gly) rs1565563392
NM_000051.3(ATM):c.8461A>G (p.Met2821Val) rs876660081
NM_000051.3(ATM):c.8462T>G (p.Met2821Arg) rs1555138065
NM_000051.3(ATM):c.8466T>C (p.Asp2822=) rs1057523224
NM_000051.3(ATM):c.8469T>C (p.Val2823=) rs1555138081
NM_000051.3(ATM):c.8471G>A (p.Cys2824Tyr) rs876660927
NM_000051.3(ATM):c.8471G>C (p.Cys2824Ser)
NM_000051.3(ATM):c.8472C>T (p.Cys2824=) rs1555138090
NM_000051.3(ATM):c.8473C>T (p.Gln2825Ter) rs587781363
NM_000051.3(ATM):c.8474A>G (p.Gln2825Arg) rs1555138094
NM_000051.3(ATM):c.8475A>G (p.Gln2825=) rs769656947
NM_000051.3(ATM):c.8476_8477dup (p.Asn2826fs) rs786203272
NM_000051.3(ATM):c.8479T>A (p.Phe2827Ile) rs370152402
NM_000051.3(ATM):c.8480T>G (p.Phe2827Cys) rs121434216
NM_000051.3(ATM):c.8481T>G (p.Phe2827Leu) rs886047614
NM_000051.3(ATM):c.8482C>G (p.Gln2828Glu) rs1555138125
NM_000051.3(ATM):c.8483A>G (p.Gln2828Arg) rs1565563564
NM_000051.3(ATM):c.8484del (p.Gln2828fs) rs1565563579
NM_000051.3(ATM):c.8486C>T (p.Pro2829Leu) rs938431501
NM_000051.3(ATM):c.8492T>C (p.Phe2831Ser)
NM_000051.3(ATM):c.8494C>T (p.Arg2832Cys) rs587779872
NM_000051.3(ATM):c.8495G>A (p.Arg2832His) rs529296539
NM_000051.3(ATM):c.8495G>C (p.Arg2832Pro) rs529296539
NM_000051.3(ATM):c.8495G>T (p.Arg2832Leu) rs529296539
NM_000051.3(ATM):c.8497T>C (p.Tyr2833His) rs774171813
NM_000051.3(ATM):c.8498A>G (p.Tyr2833Cys) rs1555138162
NM_000051.3(ATM):c.8502C>T (p.Phe2834=) rs1555138167
NM_000051.3(ATM):c.8504G>A (p.Cys2835Tyr) rs759655842
NM_000051.3(ATM):c.8505C>A (p.Cys2835Ter) rs587781597
NM_000051.3(ATM):c.8506A>G (p.Met2836Val) rs879253968
NM_000051.3(ATM):c.8514dup (p.Phe2839fs) rs876659010
NM_000051.3(ATM):c.8515T>A (p.Phe2839Ile) rs876658958
NM_000051.3(ATM):c.8517C>A (p.Phe2839Leu) rs767845728
NM_000051.3(ATM):c.8518T>C (p.Leu2840=) rs794727769
NM_000051.3(ATM):c.8519T>C (p.Leu2840Ser)
NM_000051.3(ATM):c.8520G>C (p.Leu2840Phe) rs752652869
NM_000051.3(ATM):c.8521G>C (p.Asp2841His) rs786203013
NM_000051.3(ATM):c.8521G>T (p.Asp2841Tyr) rs786203013
NM_000051.3(ATM):c.8524C>T (p.Pro2842Ser) rs876659505
NM_000051.3(ATM):c.8525C>G (p.Pro2842Arg) rs879254065
NM_000051.3(ATM):c.8526A>G (p.Pro2842=) rs900737596
NM_000051.3(ATM):c.8528C>T (p.Ala2843Val) rs1060501637
NM_000051.3(ATM):c.8530A>C (p.Ile2844Leu) rs756230327
NM_000051.3(ATM):c.8530A>G (p.Ile2844Val) rs756230327
NM_000051.3(ATM):c.8530_8532dup (p.Ile2844dup) rs1555138275
NM_000051.3(ATM):c.8532T>C (p.Ile2844=) rs730881278
NM_000051.3(ATM):c.8535G>A (p.Trp2845Ter) rs1555138291
NM_000051.3(ATM):c.8542A>G (p.Lys2848Glu) rs1565563932
NM_000051.3(ATM):c.8545C>A (p.Arg2849=) rs587778080
NM_000051.3(ATM):c.8545C>G (p.Arg2849Gly) rs587778080
NM_000051.3(ATM):c.8545C>T (p.Arg2849Ter) rs587778080
NM_000051.3(ATM):c.8546G>A (p.Arg2849Gln) rs587782202
NM_000051.3(ATM):c.8546G>C (p.Arg2849Pro) rs587782202
NM_000051.3(ATM):c.8548T>C (p.Leu2850=) rs1555138320
NM_000051.3(ATM):c.8548T>G (p.Leu2850Val) rs1555138320
NM_000051.3(ATM):c.8549T>A (p.Leu2850Ter) rs876658716
NM_000051.3(ATM):c.8549T>C (p.Leu2850Ser) rs876658716
NM_000051.3(ATM):c.8552C>T (p.Ala2851Val) rs876659701
NM_000051.3(ATM):c.8554T>C (p.Tyr2852His) rs1064794108
NM_000051.3(ATM):c.8556T>C (p.Tyr2852=) rs779394254
NM_000051.3(ATM):c.8558C>G (p.Thr2853Arg) rs141534716
NM_000051.3(ATM):c.8558C>T (p.Thr2853Met) rs141534716
NM_000051.3(ATM):c.8559G>A (p.Thr2853=) rs368058202
NM_000051.3(ATM):c.8560C>T (p.Arg2854Cys) rs201958469
NM_000051.3(ATM):c.8561G>A (p.Arg2854His) rs1060501605
NM_000051.3(ATM):c.8561G>T (p.Arg2854Leu) rs1060501605
NM_000051.3(ATM):c.8562C>T (p.Arg2854=) rs878853550
NM_000051.3(ATM):c.8564del (p.Ser2855fs) rs886039643
NM_000051.3(ATM):c.8565T>G (p.Ser2855Arg) rs780905851
NM_000051.3(ATM):c.8565_8566delinsAA (p.Ser2855_Val2856delinsArgIle) rs587781353
NM_000051.3(ATM):c.8567T>A (p.Val2856Glu) rs1060501649
NM_000051.3(ATM):c.8571T>C (p.Ala2857=) rs786203050
NM_000051.3(ATM):c.8572A>G (p.Thr2858Ala) rs749193688
NM_000051.3(ATM):c.8574T>C (p.Thr2858=) rs786203415
NM_000051.3(ATM):c.8576C>G (p.Ser2859Cys) rs786203542
NM_000051.3(ATM):c.8576C>T (p.Ser2859Phe) rs786203542
NM_000051.3(ATM):c.8578_8580delTCT (p.SER1512DEL) rs786203976
NM_000051.3(ATM):c.8581A>G (p.Ile2861Val) rs1555138472
NM_000051.3(ATM):c.8584+10T>C rs373321041
NM_000051.3(ATM):c.8584+13T>C rs1057522394
NM_000051.3(ATM):c.8584+16A>C rs1322889530
NM_000051.3(ATM):c.8584+1G>A rs876658182
NM_000051.3(ATM):c.8584+2T>C rs730881326
NM_000051.3(ATM):c.8584+4A>G rs1555138484
NM_000051.3(ATM):c.8584+6C>G rs863224300
NM_000051.3(ATM):c.8584+7T>C rs1374271708
NM_000051.3(ATM):c.8584+7T>G rs1374271708
NM_000051.3(ATM):c.8584+9_8584+11delCTT rs1064794534
NM_000051.3(ATM):c.8584+9delC rs1565564405
NM_000051.3(ATM):c.8585-11T>G rs752428743
NM_000051.3(ATM):c.8585-13_8598del27 rs1555139443
NM_000051.3(ATM):c.8585-17_8585-14delGTTT rs764013510
NM_000051.3(ATM):c.8585-1G>A rs876660066
NM_000051.3(ATM):c.8585-229A>T
NM_000051.3(ATM):c.8585-2A>C rs1060501700
NM_000051.3(ATM):c.8585-2A>G rs1060501700
NM_000051.3(ATM):c.8585-4C>A rs1555139447
NM_000051.3(ATM):c.8585-4C>G rs1555139447
NM_000051.3(ATM):c.8586del (p.Gly2863fs) rs1555139467
NM_000051.3(ATM):c.8588G>T (p.Gly2863Val) rs786201911
NM_000051.3(ATM):c.8592C>T (p.Tyr2864=) rs56025670
NM_000051.3(ATM):c.8593A>G (p.Ile2865Val) rs786202223
NM_000051.3(ATM):c.8594T>C (p.Ile2865Thr) rs587779873
NM_000051.3(ATM):c.8595A>T (p.Ile2865=) rs777245630
NM_000051.3(ATM):c.8596C>G (p.Leu2866Val) rs368666328
NM_000051.3(ATM):c.8596C>T (p.Leu2866Phe) rs368666328
NM_000051.3(ATM):c.8597T>C (p.Leu2866Pro) rs1555139517
NM_000051.3(ATM):c.8601A>G (p.Gly2867=) rs1565567027
NM_000051.3(ATM):c.8602C>A (p.Leu2868Ile) rs587780642
NM_000051.3(ATM):c.8602C>G (p.Leu2868Val)
NM_000051.3(ATM):c.8605G>A (p.Gly2869Ser)
NM_000051.3(ATM):c.8606G>A (p.Gly2869Asp) rs1555139531
NM_000051.3(ATM):c.8606G>C (p.Gly2869Ala) rs1555139531
NM_000051.3(ATM):c.8608G>A (p.Asp2870Asn) rs55798854
NM_000051.3(ATM):c.8608_8650dup (p.Glu2884delinsGlyTer)
NM_000051.3(ATM):c.8609A>G (p.Asp2870Gly) rs1555139540
NM_000051.3(ATM):c.8610T>C (p.Asp2870=) rs1370524851
NM_000051.3(ATM):c.8612G>C (p.Arg2871Thr) rs1555139547
NM_000051.3(ATM):c.8615A>G (p.His2872Arg)
NM_000051.3(ATM):c.8615_8616del (p.His2872fs) rs1232259438
NM_000051.3(ATM):c.8616T>G (p.His2872Gln) rs1555139556
NM_000051.3(ATM):c.8617G>A (p.Val2873Ile) rs730881327
NM_000051.3(ATM):c.8618T>C (p.Val2873Ala)
NM_000051.3(ATM):c.8621A>G (p.Gln2874Arg) rs1565567144
NM_000051.3(ATM):c.8623A>C (p.Asn2875His) rs1057519869
NM_000051.3(ATM):c.8624A>C (p.Asn2875Thr) rs587782451
NM_000051.3(ATM):c.8624A>G (p.Asn2875Ser) rs587782451
NM_000051.3(ATM):c.8624dup (p.Asn2875fs) rs876660411
NM_000051.3(ATM):c.8625_8627delinsAAAA (p.Asn2875fs) rs1565567205
NM_000051.3(ATM):c.8628C>T (p.Ile2876=) rs1555139577
NM_000051.3(ATM):c.8629T>C (p.Leu2877=) rs730881279
NM_000051.3(ATM):c.8631G>A (p.Leu2877=) rs1064794840
NM_000051.3(ATM):c.8631G>C (p.Leu2877Phe) rs1064794840
NM_000051.3(ATM):c.8636A>G (p.Asn2879Ser) rs1565567277
NM_000051.3(ATM):c.8641C>T (p.Gln2881Ter) rs1057520672
NM_000051.3(ATM):c.8642A>G (p.Gln2881Arg) rs1555139623
NM_000051.3(ATM):c.8643G>T (p.Gln2881His)
NM_000051.3(ATM):c.8646A>G (p.Ser2882=) rs1027903529
NM_000051.3(ATM):c.8653C>T (p.Leu2885Phe) rs775185939
NM_000051.3(ATM):c.8655T>C (p.Leu2885=) rs1555139640
NM_000051.3(ATM):c.8655dup (p.Val2886fs) rs753961188
NM_000051.3(ATM):c.8656G>A (p.Val2886Ile) rs1064795066
NM_000051.3(ATM):c.8656_8658delinsATT (p.Val2886Ile) rs786202067
NM_000051.3(ATM):c.8659C>G (p.His2887Asp)
NM_000051.3(ATM):c.8660A>C (p.His2887Pro) rs864622173
NM_000051.3(ATM):c.8660A>G (p.His2887Arg) rs864622173
NM_000051.3(ATM):c.8663T>C (p.Ile2888Thr) rs760955058
NM_000051.3(ATM):c.8665G>A (p.Asp2889Asn) rs587781814
NM_000051.3(ATM):c.8665G>C (p.Asp2889His) rs587781814
NM_000051.3(ATM):c.8666A>G (p.Asp2889Gly) rs876658236
NM_000051.3(ATM):c.8667T>G (p.Asp2889Glu) rs1565567506
NM_000051.3(ATM):c.8668C>G (p.Leu2890Val) rs587779874
NM_000051.3(ATM):c.8671+17A>G rs765608446
NM_000051.3(ATM):c.8671+18T>C rs763189977
NM_000051.3(ATM):c.8671+19G>C rs1308810219
NM_000051.3(ATM):c.8671+1G>T rs1555139694
NM_000051.3(ATM):c.8671+20T>C rs1057521774
NM_000051.3(ATM):c.8671+2T>C rs1057516229
NM_000051.3(ATM):c.8671+2dup rs1555139698
NM_000051.3(ATM):c.8671+4A>G rs876660652
NM_000051.3(ATM):c.8671+9T>C rs200190537
NM_000051.3(ATM):c.8671+9T>G rs200190537
NM_000051.3(ATM):c.8671G>A (p.Gly2891Ser) rs1565567541
NM_000051.3(ATM):c.8672-104G>A
NM_000051.3(ATM):c.8672-13T>G rs730881280
NM_000051.3(ATM):c.8672-1G>C rs876660088
NM_000051.3(ATM):c.8672-1G>T rs876660088
NM_000051.3(ATM):c.8672-3T>C rs1060501550
NM_000051.3(ATM):c.8672-3T>G
NM_000051.3(ATM):c.8672-6C>A rs1555142794
NM_000051.3(ATM):c.8672G>A (p.Gly2891Asp) rs748192003
NM_000051.3(ATM):c.8672G>T (p.Gly2891Val) rs748192003
NM_000051.3(ATM):c.8674G>A (p.Val2892Ile) rs1064793425
NM_000051.3(ATM):c.8675T>C (p.Val2892Ala)
NM_000051.3(ATM):c.8676T>A (p.Val2892=) rs1401097446
NM_000051.3(ATM):c.8677G>A (p.Ala2893Thr) rs1555142808
NM_000051.3(ATM):c.8682dup (p.Glu2895Ter) rs1565579084
NM_000051.3(ATM):c.8686_8694del (p.Gln2896_Lys2898del) rs1060501671
NM_000051.3(ATM):c.8691C>A (p.Gly2897=) rs1555142814
NM_000051.3(ATM):c.8695dup (p.Ile2899fs) rs1555142816
NM_000051.3(ATM):c.8697C>G (p.Ile2899Met) rs1333079704
NM_000051.3(ATM):c.8702C>T (p.Pro2901Leu) rs1565579149
NM_000051.3(ATM):c.8706T>C (p.Thr2902=) rs1555142824
NM_000051.3(ATM):c.8710G>C (p.Glu2904Gln)
NM_000051.3(ATM):c.8711A>G (p.Glu2904Gly) rs786202826
NM_000051.3(ATM):c.8713A>C (p.Thr2905Pro) rs1555142833
NM_000051.3(ATM):c.8715A>G (p.Thr2905=) rs786202933
NM_000051.3(ATM):c.8716G>A (p.Val2906Ile) rs587780643
NM_000051.3(ATM):c.8717T>C (p.Val2906Ala) rs730881328
NM_000051.3(ATM):c.8720C>A (p.Pro2907His) rs56887719
NM_000051.3(ATM):c.8720C>G (p.Pro2907Arg) rs56887719
NM_000051.3(ATM):c.8725A>T (p.Arg2909Ter) rs1555142845
NM_000051.3(ATM):c.8728C>T (p.Leu2910Phe) rs1555142851
NM_000051.3(ATM):c.8730C>A (p.Leu2910=) rs551041839
NM_000051.3(ATM):c.8730C>G (p.Leu2910=) rs551041839
NM_000051.3(ATM):c.8731A>C (p.Thr2911Pro) rs786203271
NM_000051.3(ATM):c.8731A>G (p.Thr2911Ala) rs786203271
NM_000051.3(ATM):c.8732C>T (p.Thr2911Ile) rs794728018
NM_000051.3(ATM):c.8733C>A (p.Thr2911=) rs1057523011
NM_000051.3(ATM):c.8734A>G (p.Arg2912Gly) rs376676328
NM_000051.3(ATM):c.8737G>C (p.Asp2913His) rs756899044
NM_000051.3(ATM):c.8737G>T (p.Asp2913Tyr) rs756899044
NM_000051.3(ATM):c.8739T>G (p.Asp2913Glu) rs764778912
NM_000051.3(ATM):c.8741T>C (p.Ile2914Thr) rs780303327
NM_000051.3(ATM):c.8742T>G (p.Ile2914Met) rs587782264
NM_000051.3(ATM):c.8751C>G (p.Gly2917=) rs779858366
NM_000051.3(ATM):c.8751C>T (p.Gly2917=) rs779858366
NM_000051.3(ATM):c.8752A>T (p.Met2918Leu) rs1555142873
NM_000051.3(ATM):c.8757C>T (p.Gly2919=) rs987508358
NM_000051.3(ATM):c.8758A>G (p.Ile2920Val) rs1555142880
NM_000051.3(ATM):c.8759T>C (p.Ile2920Thr) rs1565579485
NM_000051.3(ATM):c.8761A>T (p.Thr2921Ser) rs876658823
NM_000051.3(ATM):c.8762C>A (p.Thr2921Lys) rs730881329
NM_000051.3(ATM):c.8762C>T (p.Thr2921Met) rs730881329
NM_000051.3(ATM):c.8763G>A (p.Thr2921=) rs781528244
NM_000051.3(ATM):c.8763G>T (p.Thr2921=) rs781528244
NM_000051.3(ATM):c.8766dup (p.Val2923fs) rs876660813
NM_000051.3(ATM):c.8768T>A (p.Val2923Asp) rs786203055
NM_000051.3(ATM):c.8773G>A (p.Gly2925Ser) rs876658519
NM_000051.3(ATM):c.8773G>C (p.Gly2925Arg)
NM_000051.3(ATM):c.8774G>A (p.Gly2925Asp)
NM_000051.3(ATM):c.8774G>C (p.Gly2925Ala)
NM_000051.3(ATM):c.8774G>T (p.Gly2925Val) rs769959260
NM_000051.3(ATM):c.8781_8786+2delCAGAAGGT
NM_000051.3(ATM):c.8783G>A (p.Arg2928Lys) rs1555142909
NM_000051.3(ATM):c.8784A>G (p.Arg2928=) rs1565579622
NM_000051.3(ATM):c.8785A>C (p.Arg2929=) rs1013290424
NM_000051.3(ATM):c.8786+11T>C rs368627124
NM_000051.3(ATM):c.8786+11T>G rs368627124
NM_000051.3(ATM):c.8786+12G>A rs767836309
NM_000051.3(ATM):c.8786+16T>C rs1057521277
NM_000051.3(ATM):c.8786+16T>G rs1057521277
NM_000051.3(ATM):c.8786+19delA rs730881307
NM_000051.3(ATM):c.8786+1G>A rs17174393
NM_000051.3(ATM):c.8786+1G>C rs17174393
NM_000051.3(ATM):c.8786+1G>T rs17174393
NM_000051.3(ATM):c.8786+20G>C rs56283878
NM_000051.3(ATM):c.8786+2T>A rs1555142918
NM_000051.3(ATM):c.8786+2dup rs1565579654
NM_000051.3(ATM):c.8786+7G>A rs1555142923
NM_000051.3(ATM):c.8786+8A>C rs4986839
NM_000051.3(ATM):c.8786+8A>G rs4986839
NM_000051.3(ATM):c.8786+9T>C rs1060504271
NM_000051.3(ATM):c.8786_8786+3delGGTA rs1060501569
NM_000051.3(ATM):c.8787-12G>C rs1565582204
NM_000051.3(ATM):c.8787-13T>G rs1565582198
NM_000051.3(ATM):c.8787-14G>A rs994348665
NM_000051.3(ATM):c.8787-15T>C rs1057521788
NM_000051.3(ATM):c.8787-19A>G rs1555143457
NM_000051.3(ATM):c.8787-20T>A rs1352666899
NM_000051.3(ATM):c.8787-4C>G rs944858078
NM_000051.3(ATM):c.8787-5T>C rs1479499265
NM_000051.3(ATM):c.8787A>G (p.Arg2929=) rs1555143477
NM_000051.3(ATM):c.8788T>G (p.Cys2930Gly) rs876659807
NM_000051.3(ATM):c.8789G>A (p.Cys2930Tyr) rs1060501572
NM_000051.3(ATM):c.8789G>T (p.Cys2930Phe) rs1060501572
NM_000051.3(ATM):c.8790C>G (p.Cys2930Trp) rs1565582275
NM_000051.3(ATM):c.8792G>A (p.Cys2931Tyr)
NM_000051.3(ATM):c.8792G>C (p.Cys2931Ser) rs1060501563
NM_000051.3(ATM):c.8793T>A (p.Cys2931Ter) rs1555143494
NM_000051.3(ATM):c.8797A>G (p.Lys2933Glu) rs587779875
NM_000051.3(ATM):c.8800A>G (p.Thr2934Ala) rs746351323
NM_000051.3(ATM):c.8801C>A (p.Thr2934Asn)
NM_000051.3(ATM):c.8802C>G (p.Thr2934=) rs1565582354
NM_000051.3(ATM):c.8802del (p.Met2935fs) rs876660567
NM_000051.3(ATM):c.8805G>A (p.Met2935Ile) rs772621438
NM_000051.3(ATM):c.8806G>C (p.Glu2936Gln) rs1060501537
NM_000051.3(ATM):c.8809G>A (p.Val2937Met) rs786203917
NM_000051.3(ATM):c.8810T>A (p.Val2937Glu) rs587782149
NM_000051.3(ATM):c.8810T>C (p.Val2937Ala) rs587782149
NM_000051.3(ATM):c.8813T>A (p.Met2938Lys) rs1565582407
NM_000051.3(ATM):c.8814_8824del (p.Met2938fs) rs758814126
NM_000051.3(ATM):c.8815A>C (p.Arg2939=) rs1555143522
NM_000051.3(ATM):c.8818A>G (p.Asn2940Asp) rs1565582460
NM_000051.3(ATM):c.8818_8821dup (p.Ser2941Ter) rs876658959
NM_000051.3(ATM):c.8820C>G (p.Asn2940Lys) rs775823407
NM_000051.3(ATM):c.8820C>T (p.Asn2940=) rs775823407
NM_000051.3(ATM):c.8821T>G (p.Ser2941Ala) rs1555143549
NM_000051.3(ATM):c.8821_8822TC[1] (p.Gln2942fs) rs1555143538
NM_000051.3(ATM):c.8823T>C (p.Ser2941=) rs1060504288
NM_000051.3(ATM):c.8824C>T (p.Gln2942Ter)
NM_000051.3(ATM):c.8831C>T (p.Thr2944Ile) rs1555143562
NM_000051.3(ATM):c.8831_8832CT[1] (p.Leu2945fs) rs786203030
NM_000051.3(ATM):c.8833C>G (p.Leu2945Val) rs786203505
NM_000051.3(ATM):c.8833C>T (p.Leu2945=) rs786203505
NM_000051.3(ATM):c.8835_8836del (p.Leu2946fs) rs786202547
NM_000051.3(ATM):c.8840C>A (p.Thr2947Asn) rs1555143579
NM_000051.3(ATM):c.8842A>G (p.Ile2948Val)
NM_000051.3(ATM):c.8843T>C (p.Ile2948Thr) rs876659516
NM_000051.3(ATM):c.8844T>C (p.Ile2948=) rs878853551
NM_000051.3(ATM):c.8845G>A (p.Val2949Ile) rs587782497
NM_000051.3(ATM):c.8847A>G (p.Val2949=) rs876658820
NM_000051.3(ATM):c.8848G>A (p.Glu2950Lys) rs898091069
NM_000051.3(ATM):c.8850+10T>C rs762487236
NM_000051.3(ATM):c.8850+12dupT rs1555143639
NM_000051.3(ATM):c.8850+14T>C rs1294857465
NM_000051.3(ATM):c.8850+17G>A rs1027667991
NM_000051.3(ATM):c.8850+1G>A rs1555143620
NM_000051.3(ATM):c.8850+2T>C rs1555143623
NM_000051.3(ATM):c.8850+4A>C rs587782335
NM_000051.3(ATM):c.8850+4A>G rs587782335
NM_000051.3(ATM):c.8850+5A>C rs1057522186
NM_000051.3(ATM):c.8850+5A>T
NM_000051.3(ATM):c.8850+8A>G rs1057520908
NM_000051.3(ATM):c.8851-10C>T rs1057521676
NM_000051.3(ATM):c.8851-10_8851-7delCTCT
NM_000051.3(ATM):c.8851-15dup rs1565607238
NM_000051.3(ATM):c.8851-16T>C rs1565607217
NM_000051.3(ATM):c.8851-19A>G rs772496794
NM_000051.3(ATM):c.8851-1G>T rs1057516537
NM_000051.3(ATM):c.8851-2A>G rs886039647
NM_000051.3(ATM):c.8851-3T>G rs748874219
NM_000051.3(ATM):c.8851-973A>C rs170548
NM_000051.3(ATM):c.8851-973A>T rs170548
NM_000051.3(ATM):c.8851-?_*3591dup3912
NM_000051.3(ATM):c.8851G>A (p.Val2951Ile) rs1555151205
NM_000051.3(ATM):c.8851G>C (p.Val2951Leu) rs1555151205
NM_000051.3(ATM):c.8853C>G (p.Val2951=) rs878853552
NM_000051.3(ATM):c.8854C>G (p.Leu2952Val) rs1555151218
NM_000051.3(ATM):c.8855T>C (p.Leu2952Pro)
NM_000051.3(ATM):c.8859A>G (p.Leu2953=) rs773994431
NM_000051.3(ATM):c.8860T>C (p.Tyr2954His) rs371619067
NM_000051.3(ATM):c.8861A>G (p.Tyr2954Cys) rs767507047
NM_000051.3(ATM):c.8863_8865del (p.Asp2955del) rs587780644
NM_000051.3(ATM):c.8867C>T (p.Pro2956Leu) rs1555151244
NM_000051.3(ATM):c.8868A>T (p.Pro2956=) rs1157772894
NM_000051.3(ATM):c.8870T>G (p.Leu2957Arg) rs1555151255
NM_000051.3(ATM):c.8873_8874del (p.Leu2957_Phe2958insTer) rs864622669
NM_000051.3(ATM):c.8874dup (p.Asp2959Ter) rs864622669
NM_000051.3(ATM):c.8876_8879del (p.Asp2959fs) rs786204726
NM_000051.3(ATM):c.8878T>C (p.Trp2960Arg) rs1064794739
NM_000051.3(ATM):c.8879G>A (p.Trp2960Ter) rs1131691149
NM_000051.3(ATM):c.8880G>A (p.Trp2960Ter) rs1060501650
NM_000051.3(ATM):c.8881A>G (p.Thr2961Ala) rs1565607505
NM_000051.3(ATM):c.8882C>T (p.Thr2961Ile)
NM_000051.3(ATM):c.8893T>C (p.Leu2965=) rs1060504287
NM_000051.3(ATM):c.8894T>G (p.Leu2965Trp) rs1555151299
NM_000051.3(ATM):c.8895G>C (p.Leu2965Phe) rs200899512
NM_000051.3(ATM):c.8895G>T (p.Leu2965Phe) rs200899512
NM_000051.3(ATM):c.8902T>C (p.Leu2968=) rs775313366
NM_000051.3(ATM):c.8903T>A (p.Leu2968Ter) rs1555151315
NM_000051.3(ATM):c.8904G>A (p.Leu2968=) rs1555151326
NM_000051.3(ATM):c.8904G>T (p.Leu2968Phe) rs1555151326
NM_000051.3(ATM):c.8906A>G (p.Tyr2969Cys) rs376524155
NM_000051.3(ATM):c.8911C>T (p.Gln2971Ter) rs1565607653
NM_000051.3(ATM):c.8912A>G (p.Gln2971Arg) rs1060501714
NM_000051.3(ATM):c.8915A>G (p.Gln2972Arg) rs763773991
NM_000051.3(ATM):c.8916G>A (p.Gln2972=) rs1555151349
NM_000051.3(ATM):c.8917A>G (p.Arg2973Gly) rs1555151352
NM_000051.3(ATM):c.8918G>T (p.Arg2973Met) rs730881331
NM_000051.3(ATM):c.8918_8929delinsTGT (p.Arg2973_Glu2977delinsMetTer) rs1064795675
NM_000051.3(ATM):c.8919G>A (p.Arg2973=) rs786203613
NM_000051.3(ATM):c.8920C>A (p.Pro2974Thr) rs984616023
NM_000051.3(ATM):c.8920C>T (p.Pro2974Ser) rs984616023
NM_000051.3(ATM):c.8921C>T (p.Pro2974Leu) rs139379666
NM_000051.3(ATM):c.8922G>A (p.Pro2974=) rs527248759
NM_000051.3(ATM):c.8925_8928dup (p.Glu2977delinsArgTer) rs1555151395
NM_000051.3(ATM):c.8928T>C (p.Asp2976=) rs786202343
NM_000051.3(ATM):c.8934T>C (p.Thr2978=) rs1057521029
NM_000051.3(ATM):c.8937G>A (p.Glu2979=) rs876658242
NM_000051.3(ATM):c.8938C>A (p.Leu2980Ile) rs786203721
NM_000051.3(ATM):c.8938C>G (p.Leu2980Val) rs786203721
NM_000051.3(ATM):c.8940T>G (p.Leu2980=) rs576335919
NM_000051.3(ATM):c.8941C>T (p.His2981Tyr) rs1555151422
NM_000051.3(ATM):c.8942A>G (p.His2981Arg) rs750441954
NM_000051.3(ATM):c.8942del (p.His2981fs) rs786203489
NM_000051.3(ATM):c.8943C>G (p.His2981Gln) rs876660594
NM_000051.3(ATM):c.8944C>T (p.Pro2982Ser) rs1485620194
NM_000051.3(ATM):c.8947A>C (p.Thr2983Pro) rs1555151456
NM_000051.3(ATM):c.8950C>A (p.Leu2984Met) rs747445236
NM_000051.3(ATM):c.8955T>C (p.Asn2985=) rs755561691
NM_000051.3(ATM):c.8955T>G (p.Asn2985Lys) rs755561691
NM_000051.3(ATM):c.8958A>C (p.Ala2986=) rs863224567
NM_000051.3(ATM):c.8959G>C (p.Asp2987His) rs863224582
NM_000051.3(ATM):c.8959G>T (p.Asp2987Tyr) rs863224582
NM_000051.3(ATM):c.8964C>T (p.Asp2988=) rs969795398
NM_000051.3(ATM):c.8965C>G (p.Gln2989Glu) rs147695170
NM_000051.3(ATM):c.8966A>G (p.Gln2989Arg) rs1555151490
NM_000051.3(ATM):c.8967A>G (p.Gln2989=) rs876659033
NM_000051.3(ATM):c.8968G>A (p.Glu2990Lys) rs1800558
NM_000051.3(ATM):c.8972G>A (p.Cys2991Tyr)
NM_000051.3(ATM):c.8972G>T (p.Cys2991Phe) rs1555151500
NM_000051.3(ATM):c.8977C>T (p.Arg2993Ter) rs770641163
NM_000051.3(ATM):c.8978G>A (p.Arg2993Gln) rs587778081
NM_000051.3(ATM):c.8979A>G (p.Arg2993=) rs1042288533
NM_000051.3(ATM):c.8983C>A (p.Leu2995Ile) rs142322668
NM_000051.3(ATM):c.8987+10A>G rs1060504308
NM_000051.3(ATM):c.8987+11T>G rs1555151554
NM_000051.3(ATM):c.8987+1G>C rs786203631
NM_000051.3(ATM):c.8987+20G>T rs1555151566
NM_000051.3(ATM):c.8987+3G>A rs56360226
NM_000051.3(ATM):c.8987+3_8987+35del33 rs774188684
NM_000051.3(ATM):c.8987+5G>C rs876660570
NM_000051.3(ATM):c.8987G>A (p.Ser2996Asn) rs1555151525
NM_000051.3(ATM):c.8988-12T>A rs1370262422
NM_000051.3(ATM):c.8988-17T>C rs1565608529
NM_000051.3(ATM):c.8988-1G>A rs730881386
NM_000051.3(ATM):c.8988-1G>C rs730881386
NM_000051.3(ATM):c.8988-1G>T
NM_000051.3(ATM):c.8988-2A>C rs786202087
NM_000051.3(ATM):c.8988-2A>G rs786202087
NM_000051.3(ATM):c.8988-3T>C rs1565608600
NM_000051.3(ATM):c.8988-6_8988-4delCCT rs767175242
NM_000051.3(ATM):c.8988-7T>G rs1487809821
NM_000051.3(ATM):c.8988-8G>A rs1555151666
NM_000051.3(ATM):c.8988-8dup
NM_000051.3(ATM):c.8992A>G (p.Ile2998Val) rs1565608692
NM_000051.3(ATM):c.8993T>C (p.Ile2998Thr) rs778670498
NM_000051.3(ATM):c.8996A>T (p.Asp2999Val) rs1555151684
NM_000051.3(ATM):c.8998C>G (p.Gln3000Glu) rs587781698
NM_000051.3(ATM):c.8998C>T (p.Gln3000Ter) rs587781698
NM_000051.3(ATM):c.8999_9000AG[1] (p.Ser3001fs) rs876660022
NM_000051.3(ATM):c.9002G>A (p.Ser3001Asn) rs587781413
NM_000051.3(ATM):c.9002G>C (p.Ser3001Thr) rs587781413
NM_000051.3(ATM):c.9005T>A (p.Phe3002Tyr) rs1565608780
NM_000051.3(ATM):c.9005del (p.Phe3002fs) rs876659235
NM_000051.3(ATM):c.9006C>A (p.Phe3002Leu) rs540172506
NM_000051.3(ATM):c.9006C>G (p.Phe3002Leu) rs540172506
NM_000051.3(ATM):c.9006C>T (p.Phe3002=) rs540172506
NM_000051.3(ATM):c.9008A>G (p.Asn3003Ser) rs144636562
NM_000051.3(ATM):c.9010A>G (p.Lys3004Glu) rs1555151737
NM_000051.3(ATM):c.9013G>A (p.Val3005Ile) rs1555151745
NM_000051.3(ATM):c.9014T>C (p.Val3005Ala) rs876659968
NM_000051.3(ATM):c.9016G>A (p.Ala3006Thr) rs876658767
NM_000051.3(ATM):c.9016G>C (p.Ala3006Pro) rs876658767
NM_000051.3(ATM):c.9019G>T (p.Glu3007Ter) rs876660382
NM_000051.3(ATM):c.9021A>C (p.Glu3007Asp) rs1565608897
NM_000051.3(ATM):c.9021dup (p.Arg3008fs) rs876660235
NM_000051.3(ATM):c.9022C>G (p.Arg3008Gly) rs587782292
NM_000051.3(ATM):c.9022C>T (p.Arg3008Cys) rs587782292
NM_000051.3(ATM):c.9023G>A (p.Arg3008His) rs587781894
NM_000051.3(ATM):c.9023G>C (p.Arg3008Pro)
NM_000051.3(ATM):c.9024T>C (p.Arg3008=) rs876658179
NM_000051.3(ATM):c.9026T>G (p.Val3009Gly) rs1565608934
NM_000051.3(ATM):c.9027C>G (p.Val3009=) rs1200351979
NM_000051.3(ATM):c.9031A>G (p.Met3011Val) rs372795527
NM_000051.3(ATM):c.9032T>G (p.Met3011Arg) rs1555151804
NM_000051.3(ATM):c.9037C>T (p.Leu3013=) rs1555151809
NM_000051.3(ATM):c.9037_9040del (p.Leu3013fs) rs1565609008
NM_000051.3(ATM):c.9039A>G (p.Leu3013=) rs876659127
NM_000051.3(ATM):c.9039dup (p.Gln3014fs) rs879253972
NM_000051.3(ATM):c.9041A>G (p.Gln3014Arg) rs1064793579
NM_000051.3(ATM):c.9042A>G (p.Gln3014=) rs1060504291
NM_000051.3(ATM):c.9042A>T (p.Gln3014His)
NM_000051.3(ATM):c.9043G>A (p.Glu3015Lys)
NM_000051.3(ATM):c.9044A>G (p.Glu3015Gly) rs1565609065
NM_000051.3(ATM):c.9045G>A (p.Glu3015=) rs786203336
NM_000051.3(ATM):c.9045_9052dup (p.Lys3018delinsArgAsnTer) rs1555151827
NM_000051.3(ATM):c.9047_9057del (p.Lys3016fs) rs587782847
NM_000051.3(ATM):c.9048A>G (p.Lys3016=) rs553001467
NM_000051.3(ATM):c.9049C>T (p.Leu3017=) rs876658991
NM_000051.3(ATM):c.9050T>C (p.Leu3017Pro) rs786204218
NM_000051.3(ATM):c.9050_9051insTTCA (p.Lys3018fs) rs1555151854
NM_000051.3(ATM):c.9060G>T (p.Val3020=) rs864622625
NM_000051.3(ATM):c.9063A>G (p.Glu3021=) rs1555151874
NM_000051.3(ATM):c.9064dup (p.Glu3022fs) rs1057516282
NM_000051.3(ATM):c.9067G>A (p.Gly3023Ser) rs879253964
NM_000051.3(ATM):c.9068G>A (p.Gly3023Asp) rs769548726
NM_000051.3(ATM):c.9068G>T (p.Gly3023Val) rs769548726
NM_000051.3(ATM):c.9070A>C (p.Thr3024Pro) rs587781630
NM_000051.3(ATM):c.9071C>T (p.Thr3024Ile) rs786203183
NM_000051.3(ATM):c.9072T>G (p.Thr3024=) rs1308894113
NM_000051.3(ATM):c.9073G>A (p.Val3025Met) rs1555151925
NM_000051.3(ATM):c.9073del (p.Val3025fs) rs1555151928
NM_000051.3(ATM):c.9077T>G (p.Leu3026Arg) rs1565609286
NM_000051.3(ATM):c.9079A>C (p.Ser3027Arg) rs763152094
NM_000051.3(ATM):c.9079A>G (p.Ser3027Gly) rs763152094
NM_000051.3(ATM):c.9079dup (p.Ser3027fs) rs587780645
NM_000051.3(ATM):c.9080G>C (p.Ser3027Thr) rs1565609342
NM_000051.3(ATM):c.9082G>A (p.Val3028Ile) rs876660251
NM_000051.3(ATM):c.9084T>C (p.Val3028=) rs786203210
NM_000051.3(ATM):c.9084_9086TGG[1] (p.Gly3030del)
NM_000051.3(ATM):c.9086G>A (p.Gly3029Asp) rs201199629
NM_000051.3(ATM):c.9086G>T (p.Gly3029Val) rs201199629
NM_000051.3(ATM):c.9087T>G (p.Gly3029=) rs759675675
NM_000051.3(ATM):c.9088G>A (p.Gly3030Arg) rs879254215
NM_000051.3(ATM):c.9088G>C (p.Gly3030Arg) rs879254215
NM_000051.3(ATM):c.9089G>A (p.Gly3030Glu) rs876658529
NM_000051.3(ATM):c.9089G>T (p.Gly3030Val)
NM_000051.3(ATM):c.9092_9098delinsT (p.Gln3031_Asn3033delinsLeu) rs1555151979
NM_000051.3(ATM):c.9094G>A (p.Val3032Met) rs587779877
NM_000051.3(ATM):c.9094G>C (p.Val3032Leu) rs587779877
NM_000051.3(ATM):c.9096G>A (p.Val3032=) rs1565609478
NM_000051.3(ATM):c.9098A>G (p.Asn3033Ser) rs1555151991
NM_000051.3(ATM):c.9101T>G (p.Leu3034Trp) rs1555151992
NM_000051.3(ATM):c.9102_9103delinsTT (p.Leu3034_Leu3035delinsPhePhe) rs730881308
NM_000051.3(ATM):c.9103C>A (p.Leu3035Ile) rs866769874
NM_000051.3(ATM):c.9103C>T (p.Leu3035Phe) rs866769874
NM_000051.3(ATM):c.9106A>G (p.Ile3036Val) rs1565609567
NM_000051.3(ATM):c.9109C>T (p.Gln3037Ter) rs1555152009
NM_000051.3(ATM):c.9111G>T (p.Gln3037His) rs1555152012
NM_000051.3(ATM):c.9112del (p.Gln3038fs) rs587779878
NM_000051.3(ATM):c.9113A>T (p.Gln3038Leu) rs1131691391
NM_000051.3(ATM):c.9117C>T (p.Ala3039=) rs1289926943
NM_000051.3(ATM):c.9119T>C (p.Ile3040Thr) rs369870357
NM_000051.3(ATM):c.9128A>G (p.Lys3043Arg) rs867893961
NM_000051.3(ATM):c.9131A>G (p.Asn3044Ser) rs1555152029
NM_000051.3(ATM):c.9131A>T (p.Asn3044Ile) rs1555152029
NM_000051.3(ATM):c.9131dup (p.Asn3044fs)
NM_000051.3(ATM):c.9133C>G (p.Leu3045Val) rs1555152033
NM_000051.3(ATM):c.9133C>T (p.Leu3045Phe) rs1555152033
NM_000051.3(ATM):c.9136A>G (p.Ser3046Gly) rs1555152041
NM_000051.3(ATM):c.9139C>T (p.Arg3047Ter) rs121434219
NM_000051.3(ATM):c.9140G>A (p.Arg3047Gln) rs1047129530
NM_000051.3(ATM):c.9142C>G (p.Leu3048Val) rs876660534
NM_000051.3(ATM):c.9145_9146del (p.Phe3049fs) rs1555152058
NM_000051.3(ATM):c.9146del (p.Phe3049fs) rs1555152058
NM_000051.3(ATM):c.9149C>T (p.Pro3050Leu) rs778267979
NM_000051.3(ATM):c.9151G>C (p.Gly3051Arg) rs730881332
NM_000051.3(ATM):c.9152G>A (p.Gly3051Glu)
NM_000051.3(ATM):c.9152G>C (p.Gly3051Ala) rs1555152073
NM_000051.3(ATM):c.9153A>C (p.Gly3051=) rs1555152080
NM_000051.3(ATM):c.9156G>T (p.Trp3052Cys) rs587781711
NM_000051.3(ATM):c.9157A>T (p.Lys3053Ter) rs1555152104
NM_000051.3(ATM):c.9159A>G (p.Lys3053=) rs1060504315
NM_000051.3(ATM):c.9160G>A (p.Ala3054Thr) rs1565609869
NM_000051.3(ATM):c.9161C>G (p.Ala3054Gly) rs1555152117
NM_000051.3(ATM):c.9161C>T (p.Ala3054Val) rs1555152117
NM_000051.3(ATM):c.9166G>T (p.Val3056Leu) rs371767164
NM_000051.3(ATM):c.9166del (p.Val3056fs) rs876659234
NM_001351834.2(ATM):c.5763-1050A>G rs774925473
c.8201_8212del11ins6

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.