ClinVar Miner

List of variants in gene combination ATM, C11orf65 reported as pathogenic

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 292
Download table as spreadsheet
HGVS dbSNP
NC_000011.10:g.(?_108222832)_(108369099_?)del
NC_000011.10:g.(?_108227615)_(108365518_?)del
NC_000011.10:g.(?_108243943)_(108365518_?)del
NC_000011.10:g.(?_108243953)_(108369099_?)del
NC_000011.10:g.(?_108267165)_(108365514_?)del
NC_000011.10:g.(?_108297287)_(108335961_?)del
NC_000011.10:g.(?_108325310)_(108369099_?)del
NC_000011.10:g.(?_108335912)_(108340340_?)del
NC_000011.10:g.(?_108343222)_(108369099_?)del
NC_000011.10:g.(?_108365072)_(108365518_?)del
NC_000011.10:g.(?_108365076)_(108365514_?)del
NC_000011.10:g.(?_108365082)_(108365508_?)del
NC_000011.10:g.108317447delG
NG_009830.1:g.(41245_49339)_(137044_147250)dup
NG_009830.1:g.118063_118073delTGTGTAATACAins6
NM_000051.3(ATM):c.3403-?_*(1_?)del
NM_000051.3(ATM):c.5762_5763insNG_009830.1:g.91138_91274 rs774925473
NM_000051.3(ATM):c.5765delC (p.Pro1922Leufs) rs786202814
NM_000051.3(ATM):c.5771C>A (p.Ser1924Ter) rs876658831
NM_000051.3(ATM):c.5784dup (p.Asn1929Terfs) rs1131691254
NM_000051.3(ATM):c.5791_5794delGCTTinsCCTCT (p.Ala1931Profs) rs1555110295
NM_000051.3(ATM):c.5791delGinsCCT (p.Ala1931Profs) rs587779851
NM_000051.3(ATM):c.5798G>A (p.Trp1933Ter) rs876658740
NM_000051.3(ATM):c.5853delC (p.Phe1952Leufs) rs1555110418
NM_000051.3(ATM):c.5870_5871delAT (p.Tyr1957Cysfs) rs1060501657
NM_000051.3(ATM):c.5890A>T (p.Lys1964Ter) rs201963507
NM_000051.3(ATM):c.5893_5897delAAAAG (p.Lys1965Tyrfs) rs587781727
NM_000051.3(ATM):c.5894_5900dupAAAGTAT (p.Met1967Ilefs) rs1555110517
NM_000051.3(ATM):c.5908C>T (p.Gln1970Ter) rs587781722
NM_000051.3(ATM):c.5910delA (p.Glu1971Argfs) rs587782198
NM_000051.3(ATM):c.5931delT (p.Phe1977Leufs)
NM_000051.3(ATM):c.5932G>T (p.Glu1978Ter) rs587779852
NM_000051.3(ATM):c.5935G>T (p.Glu1979Ter) rs1555111763
NM_000051.3(ATM):c.5944C>T (p.Gln1982Ter) rs1555111775
NM_000051.3(ATM):c.5959dup (p.Ser1987Phefs) rs1555111808
NM_000051.3(ATM):c.5971G>T (p.Glu1991Ter) rs786203404
NM_000051.3(ATM):c.5979_5983delTAAAG (p.Ser1993Argfs) rs876660134
NM_000051.3(ATM):c.5980A>T (p.Lys1994Ter)
NM_000051.3(ATM):c.5982delA (p.Glu1995Lysfs) rs1555111855
NM_000051.3(ATM):c.5982dup (p.Glu1995Argfs)
NM_000051.3(ATM):c.6002T>G (p.Leu2001Ter) rs1555111910
NM_000051.3(ATM):c.6004C>T (p.Gln2002Ter)
NM_000051.3(ATM):c.6007_6029dup (p.Ser2011Ilefs)
NM_000051.3(ATM):c.6015dup (p.Glu2007Argfs) rs1438576066
NM_000051.3(ATM):c.6027C>G (p.Tyr2009Ter) rs1555113567
NM_000051.3(ATM):c.6040G>T (p.Glu2014Ter) rs375783941
NM_000051.3(ATM):c.6044_6046delCAGinsTTATACTTCTCTTAGAAATCTACAGAAGT (p.Pro2015Leufs)
NM_000051.3(ATM):c.6049dupA (p.Ser2017Lysfs) rs797045030
NM_000051.3(ATM):c.6059delG (p.Gly2020Alafs) rs1064794166
NM_000051.3(ATM):c.6080delT (p.Leu2027Tyrfs) rs1060501548
NM_000051.3(ATM):c.6082C>T (p.Gln2028Ter) rs876659454
NM_000051.3(ATM):c.6090dup (p.Thr2031Tyrfs)
NM_000051.3(ATM):c.6095G>A (p.Arg2032Lys) rs139770721
NM_000051.3(ATM):c.6096-2A>G rs1057520704
NM_000051.3(ATM):c.6100C>T (p.Arg2034Ter) rs532480170
NM_000051.3(ATM):c.6108T>A (p.Tyr2036Ter)
NM_000051.3(ATM):c.6115G>T (p.Glu2039Ter) rs864622251
NM_000051.3(ATM):c.6133delG (p.Ala2045Profs) rs1555113762
NM_000051.3(ATM):c.6146_6147delAT (p.Tyr2049Terfs)
NM_000051.3(ATM):c.6154G>A (p.Glu2052Lys) rs202206540
NM_000051.3(ATM):c.6181C>T (p.Gln2061Ter) rs1555113845
NM_000051.3(ATM):c.6198+1G>A rs778031266
NM_000051.3(ATM):c.6200C>A (p.Ala2067Asp) rs397514577
NM_000051.3(ATM):c.6222C>A (p.Cys2074Ter)
NM_000051.3(ATM):c.6228delT (p.Leu2077Phefs) rs786203008
NM_000051.3(ATM):c.6237_6238delCT (p.Tyr2080Phefs) rs1555114623
NM_000051.3(ATM):c.6239_6240delAT (p.Tyr2080Phefs) rs878853529
NM_000051.3(ATM):c.6258T>G (p.Tyr2086Ter)
NM_000051.3(ATM):c.6270delCinsTT (p.Trp2091Leufs) rs1555114702
NM_000051.3(ATM):c.6272G>A (p.Trp2091Ter) rs1060501712
NM_000051.3(ATM):c.6280delG (p.Glu2094Asnfs)
NM_000051.3(ATM):c.6289G>T (p.Glu2097Ter) rs1555114737
NM_000051.3(ATM):c.6311G>A (p.Trp2104Ter)
NM_000051.3(ATM):c.6312G>A (p.Trp2104Ter) rs1555114766
NM_000051.3(ATM):c.6326G>A (p.Trp2109Ter) rs587782114
NM_000051.3(ATM):c.6327G>A (p.Trp2109Ter) rs867760244
NM_000051.3(ATM):c.6347+1G>A rs1057517120
NM_000051.3(ATM):c.6369_6370delTT (p.Ser2123Argfs) rs1555116381
NM_000051.3(ATM):c.6373delC (p.His2125Metfs) rs878853530
NM_000051.3(ATM):c.6397C>T (p.Gln2133Ter) rs876658163
NM_000051.3(ATM):c.6399delA (p.Gln2133Hisfs) rs1555116451
NM_000051.3(ATM):c.6399dup (p.Ser2134Ilefs) rs1555116451
NM_000051.3(ATM):c.6403_6404insCT (p.Leu2135Profs) rs1555116468
NM_000051.3(ATM):c.6404_6405insTT (p.Arg2136Terfs) rs587782554
NM_000051.3(ATM):c.6404dup (p.Arg2136Lysfs) rs587782554
NM_000051.3(ATM):c.6415_6416delGA (p.Glu2139Ilefs) rs863225466
NM_000051.3(ATM):c.6433_6445del13 (p.Glu2145Metfs) rs786202264
NM_000051.3(ATM):c.6435_6436delAA (p.Leu2147Glnfs) rs786202323
NM_000051.3(ATM):c.6436dupA (p.Ser2146Lysfs) rs786202323
NM_000051.3(ATM):c.6444dup (p.Tyr2149Ilefs) rs1555116533
NM_000051.3(ATM):c.6452+1G>T
NM_000051.3(ATM):c.6463_6478dup16 (p.Lys2160Serfs) rs1555117084
NM_000051.3(ATM):c.6498_6499delGT (p.Tyr2167Phefs) rs1060501707
NM_000051.3(ATM):c.6555dup (p.Gly2186Trpfs)
NM_000051.3(ATM):c.6572+1G>A rs587779856
NM_000051.3(ATM):c.6585_6586delTA (p.His2195Glnfs) rs1555119004
NM_000051.3(ATM):c.6586A>T (p.Arg2196Ter) rs1555119011
NM_000051.3(ATM):c.6615G>A (p.Trp2205Ter) rs1555119041
NM_000051.3(ATM):c.6650_6657delTTAGTTTT (p.Phe2217Serfs) rs864622326
NM_000051.3(ATM):c.6657delT (p.Gln2220Argfs) rs876658603
NM_000051.3(ATM):c.6658C>T (p.Gln2220Ter) rs1060501536
NM_000051.3(ATM):c.6667delA (p.Ile2223Serfs) rs878853533
NM_000051.3(ATM):c.6673dupG (p.Ala2225Glyfs) rs587781872
NM_000051.3(ATM):c.6679C>T (p.Arg2227Cys) rs564652222
NM_000051.3(ATM):c.6683_6684delCA (p.Thr2228Serfs)
NM_000051.3(ATM):c.6725delC (p.Ser2242Tyrfs) rs876658394
NM_000051.3(ATM):c.6729_6730delAA (p.Glu2245Metfs) rs1060501543
NM_000051.3(ATM):c.6748dup (p.Ile2250Asnfs) rs1555119247
NM_000051.3(ATM):c.6750_6751insCTCA (p.Lys2253Hisfs) rs863224461
NM_000051.3(ATM):c.6754delA (p.Thr2252Profs) rs1064793042
NM_000051.3(ATM):c.6776_6777delCT (p.Ser2259Tyrfs) rs1131691156
NM_000051.3(ATM):c.6797_6798delAGinsC (p.Lys2266Thrfs) rs1555119364
NM_000051.3(ATM):c.6808-242_7516-275del
NM_000051.3(ATM):c.6814delGinsCA (p.Glu2272Glnfs)
NM_000051.3(ATM):c.6838C>T (p.Gln2280Ter)
NM_000051.3(ATM):c.6839delA (p.Gln2280Argfs) rs1407907917
NM_000051.3(ATM):c.6843C>G (p.Tyr2281Ter) rs1555119797
NM_000051.3(ATM):c.6843delC (p.Tyr2281Terfs)
NM_000051.3(ATM):c.6850delG (p.Val2284Leufs) rs876659569
NM_000051.3(ATM):c.6867dup (p.Glu2290Terfs) rs1555119834
NM_000051.3(ATM):c.6908dup (p.Glu2304Glyfs) rs773570504
NM_000051.3(ATM):c.6910delG (p.Glu2304Serfs) rs1555119940
NM_000051.3(ATM):c.6913C>T (p.Gln2305Ter) rs1282099124
NM_000051.3(ATM):c.6916_6917delAG (p.Leu2307Cysfs) rs878853535
NM_000051.3(ATM):c.6920_6923delTTGC (p.Leu2307Profs) rs1064793043
NM_000051.3(ATM):c.6976-10_6989delTCTTATACAGAACAATCCCAGCCT rs587779859
NM_000051.3(ATM):c.6997dupA (p.Thr2333Asnfs) rs587781299
NM_000051.3(ATM):c.7000_7003delTACA (p.Tyr2334Glnfs) rs786203421
NM_000051.3(ATM):c.7010_7011delGT (p.Cys2337Serfs) rs864622416
NM_000051.3(ATM):c.7010_7065dup56 (p.Ile2356Valfs) rs1555120985
NM_000051.3(ATM):c.7026dup (p.Asn2343Glnfs) rs1555121020
NM_000051.3(ATM):c.7032G>A (p.Trp2344Ter) rs1131691162
NM_000051.3(ATM):c.7044_7047delGTGC (p.Cys2349Terfs) rs1555121066
NM_000051.3(ATM):c.7080T>G (p.Tyr2360Ter) rs1555121147
NM_000051.3(ATM):c.7088delA (p.Lys2363Argfs) rs876658512
NM_000051.3(ATM):c.7091delC (p.Ala2364Glufs) rs878853538
NM_000051.3(ATM):c.7096G>T (p.Glu2366Ter) rs587781672
NM_000051.3(ATM):c.7186delA (p.Thr2396Leufs) rs1555122092
NM_000051.3(ATM):c.7189C>T (p.Gln2397Ter) rs747372355
NM_000051.3(ATM):c.7220C>A (p.Ser2407Ter) rs1555122149
NM_000051.3(ATM):c.7240C>T (p.Gln2414Ter) rs863224462
NM_000051.3(ATM):c.7251_7253dup (p.Lys2418_Arg2419insLys) rs796051857
NM_000051.3(ATM):c.7262_7263delAA (p.Lys2421Argfs) rs1131691157
NM_000051.3(ATM):c.7268A>G (p.Glu2423Gly) rs121434221
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7274delG (p.Gly2425Valfs)
NM_000051.3(ATM):c.7279_7284del (p.Leu2427_Arg2428del) rs796051856
NM_000051.3(ATM):c.7293_7294delAA (p.Lys2431Asnfs) rs1060501525
NM_000051.3(ATM):c.7311C>A (p.Tyr2437Ter) rs763470424
NM_000051.3(ATM):c.7327C>T (p.Arg2443Ter) rs121434220
NM_000051.3(ATM):c.7449G>A (p.Trp2483Ter) rs773516672
NM_000051.3(ATM):c.7456C>T (p.Arg2486Ter) rs587779865
NM_000051.3(ATM):c.7465_7466delTC (p.Ser2489Profs) rs786203734
NM_000051.3(ATM):c.7517_7520delGAGA (p.Arg2506Thrfs) rs587781905
NM_000051.3(ATM):c.7542T>G (p.Tyr2514Ter) rs777925486
NM_000051.3(ATM):c.7542_7543delTA (p.Tyr2514Terfs) rs1555123981
NM_000051.3(ATM):c.7563C>G (p.Tyr2521Ter) rs772228129
NM_000051.3(ATM):c.7599_7600dup (p.Gly2534Glufs) rs1555124089
NM_000051.3(ATM):c.7608delA (p.His2538Metfs)
NM_000051.3(ATM):c.7629_7629+4delTGTAA rs876660041
NM_000051.3(ATM):c.7630-2A>C rs587779866
NM_000051.3(ATM):c.7630-2A>G rs587779866
NM_000051.3(ATM):c.7638_7646delTAGAATTTC (p.Arg2547_Ser2549del) rs587776547
NM_000051.3(ATM):c.7655_7656insGA (p.His2552Glnfs)
NM_000051.3(ATM):c.7665delCinsGTGA (p.His2555_Asp2889delinsGlnTer) rs1555124503
NM_000051.3(ATM):c.7669_7670delTT (p.Leu2557Valfs)
NM_000051.3(ATM):c.7671_7674delGTTT (p.Phe2558Leufs) rs1555124506
NM_000051.3(ATM):c.7699_7702delAACA (p.Asn2567Glufs) rs1060501547
NM_000051.3(ATM):c.7701_7702delCA (p.Asn2567Lysfs) rs1064793359
NM_000051.3(ATM):c.7705_7706delGA (p.Asp2569Terfs) rs759965045
NM_000051.3(ATM):c.7767delA (p.Lys2589Asnfs) rs1057517025
NM_000051.3(ATM):c.7768C>T (p.Gln2590Ter)
NM_000051.3(ATM):c.7777C>T (p.Gln2593Ter) rs781215442
NM_000051.3(ATM):c.7788G>A (p.Glu2596=) rs587780639
NM_000051.3(ATM):c.7789-3T>G rs864622185
NM_000051.3(ATM):c.7792C>T (p.Arg2598Ter) rs138941496
NM_000051.3(ATM):c.7838_7839dupGA (p.Pro2614Aspfs) rs730881293
NM_000051.3(ATM):c.7858delG (p.Val2620Leufs) rs1555125349
NM_000051.3(ATM):c.7865C>T (p.Ala2622Val) rs766351395
NM_000051.3(ATM):c.7875_7876delTGinsGC (p.Asp2625_Ala2626delinsGluPro) rs267606668
NM_000051.3(ATM):c.7880delA (p.Tyr2627Leufs) rs1057516599
NM_000051.3(ATM):c.7886_7890delTATTA (p.Ile2629Serfs) rs1450394308
NM_000051.3(ATM):c.7913G>A (p.Trp2638Ter) rs377349459
NM_000051.3(ATM):c.7921C>T (p.Gln2641Ter) rs769523686
NM_000051.3(ATM):c.7951C>T (p.Gln2651Ter) rs587781994
NM_000051.3(ATM):c.7967T>C (p.Leu2656Pro) rs121434218
NM_000051.3(ATM):c.7985T>A (p.Val2662Asp) rs863224463
NM_000051.3(ATM):c.7988_7991del (p.Val2663Alafs) rs587776550
NM_000051.3(ATM):c.7998dupT (p.Met2667Tyrfs) rs587779869
NM_000051.3(ATM):c.8030A>G (p.Tyr2677Cys) rs28942103
NM_000051.3(ATM):c.8036_8051del16 (p.Asn2679Serfs) rs587780640
NM_000051.3(ATM):c.8048_8049delTA (p.Ile2683Thrfs)
NM_000051.3(ATM):c.8050C>T (p.Gln2684Ter) rs1555127102
NM_000051.3(ATM):c.8103_8104delAA (p.Ile2702Argfs) rs1064793406
NM_000051.3(ATM):c.8122G>A (p.Asp2708Asn) rs587782719
NM_000051.3(ATM):c.8140C>T (p.Gln2714Ter) rs1060501695
NM_000051.3(ATM):c.8146G>T (p.Val2716Phe) rs730881385
NM_000051.3(ATM):c.8147T>C (p.Val2716Ala) rs587782652
NM_000051.3(ATM):c.8185C>T (p.Gln2729Ter) rs587781967
NM_000051.3(ATM):c.8204_8205dupGT (p.Asn2736Valfs) rs1555128432
NM_000051.3(ATM):c.8205_8206insAA (p.Asn2736Lysfs) rs587782525
NM_000051.3(ATM):c.8213T>G (p.Leu2738Ter) rs773889320
NM_000051.3(ATM):c.8218C>T (p.Gln2740Ter) rs866402530
NM_000051.3(ATM):c.8224_8225delAA (p.Asn2742Hisfs) rs1162534390
NM_000051.3(ATM):c.8249dup (p.Leu2750Phefs)
NM_000051.3(ATM):c.8251_8254delACTA (p.Thr2751Serfs) rs786202120
NM_000051.3(ATM):c.8264_8268delATAAG (p.Tyr2755Cysfs) rs730881294
NM_000051.3(ATM):c.8265T>G (p.Tyr2755Ter) rs758654836
NM_000051.3(ATM):c.8266A>T (p.Lys2756Ter) rs371638537
NM_000051.3(ATM):c.8269delG (p.Val2757Trpfs) rs1555135341
NM_000051.3(ATM):c.8283_8284delTC (p.Gln2762Alafs) rs775899653
NM_000051.3(ATM):c.8284C>T (p.Gln2762Ter)
NM_000051.3(ATM):c.8287C>T (p.Arg2763Ter) rs876659872
NM_000051.3(ATM):c.8292_8293delTG (p.Ser2764Argfs) rs879254036
NM_000051.3(ATM):c.8293G>A (p.Gly2765Ser) rs748634900
NM_000051.3(ATM):c.8305_8317delTGGTGCACAGGAA (p.Trp2769Leufs) rs786202318
NM_000051.3(ATM):c.8307G>A (p.Trp2769Ter) rs778269655
NM_000051.3(ATM):c.8319_8323dupTGTCC (p.Pro2775Leufs) rs1555135596
NM_000051.3(ATM):c.8321_8322delTCinsA (p.Val2774Aspfs) rs1060501630
NM_000051.3(ATM):c.8325delC (p.Ile2776Leufs) rs886039623
NM_000051.3(ATM):c.8328_8329delTG (p.Ile2776Metfs) rs1555135633
NM_000051.3(ATM):c.8367delAinsTT (p.Lys2789Asnfs) rs786202418
NM_000051.3(ATM):c.8371_8374delTACA (p.Tyr2791Glyfs) rs1064793046
NM_000051.3(ATM):c.8373C>A (p.Tyr2791Ter) rs1060504292
NM_000051.3(ATM):c.8395_8404delTTTCAGTGCC (p.Phe2799Lysfs) rs786202800
NM_000051.3(ATM):c.8397delT (p.Gln2800Serfs) rs587781837
NM_000051.3(ATM):c.8403C>A (p.Cys2801Ter) rs1555135852
NM_000051.3(ATM):c.8418+5_8418+8delGTGA rs730881295
NM_000051.3(ATM):c.8419G>T (p.Glu2807Ter) rs1555137929
NM_000051.3(ATM):c.8431A>T (p.Lys2811Ter) rs1131691158
NM_000051.3(ATM):c.8432delA (p.Lys2811Serfs) rs587782558
NM_000051.3(ATM):c.8432dupA (p.Ser2812Valfs) rs587782558
NM_000051.3(ATM):c.8435_8436delCT (p.Ser2812Phefs) rs767533596
NM_000051.3(ATM):c.8440delG (p.Glu2814Lysfs)
NM_000051.3(ATM):c.8473C>T (p.Gln2825Ter) rs587781363
NM_000051.3(ATM):c.8476_8477dupAA (p.Asn2826Lysfs) rs786203272
NM_000051.3(ATM):c.8480T>G (p.Phe2827Cys) rs121434216
NM_000051.3(ATM):c.8484del (p.Gln2828Hisfs)
NM_000051.3(ATM):c.8494C>T (p.Arg2832Cys) rs587779872
NM_000051.3(ATM):c.8505C>A (p.Cys2835Ter) rs587781597
NM_000051.3(ATM):c.8514dupA (p.Phe2839Ilefs) rs876659010
NM_000051.3(ATM):c.8545C>T (p.Arg2849Ter) rs587778080
NM_000051.3(ATM):c.8549T>A (p.Leu2850Ter) rs876658716
NM_000051.3(ATM):c.8578_8580delTCT (p.Ser2860del) rs786203976
NM_000051.3(ATM):c.8615_8616delAT (p.His2872Argfs) rs1232259438
NM_000051.3(ATM):c.8624dupA (p.Asn2875Lysfs) rs876660411
NM_000051.3(ATM):c.8625_8627delTATinsAAAA (p.Asn2875Lysfs)
NM_000051.3(ATM):c.8641C>T (p.Gln2881Ter) rs1057520672
NM_000051.3(ATM):c.8655dupT (p.Val2886Cysfs) rs753961188
NM_000051.3(ATM):c.8672-1G>C rs876660088
NM_000051.3(ATM):c.8682dup (p.Glu2895Terfs)
NM_000051.3(ATM):c.8695dup (p.Ile2899Asnfs) rs1555142816
NM_000051.3(ATM):c.8732C>T (p.Thr2911Ile) rs794728018
NM_000051.3(ATM):c.8766dupT (p.Val2923Cysfs) rs876660813
NM_000051.3(ATM):c.8786+1G>A rs17174393
NM_000051.3(ATM):c.8786+1G>C rs17174393
NM_000051.3(ATM):c.8786+1G>T rs17174393
NM_000051.3(ATM):c.8793T>A (p.Cys2931Ter) rs1555143494
NM_000051.3(ATM):c.8802delC (p.Met2935Trpfs) rs876660567
NM_000051.3(ATM):c.8814_8824delGAGAAACTCTC (p.Met2938Ilefs) rs758814126
NM_000051.3(ATM):c.8818_8821dupAACT (p.Ser2941Terfs) rs876658959
NM_000051.3(ATM):c.8823_8824delTC (p.Gln2942Glyfs) rs1555143538
NM_000051.3(ATM):c.8833_8834delCT (p.Leu2945Valfs) rs786203030
NM_000051.3(ATM):c.8835_8836delGT (p.Leu2946Asnfs) rs786202547
NM_000051.3(ATM):c.8873_8874delTT (p.Phe2958Terfs) rs864622669
NM_000051.3(ATM):c.8874dup (p.Asp2959Terfs) rs864622669
NM_000051.3(ATM):c.8876_8879delACTG (p.Asp2959Glyfs) rs786204726
NM_000051.3(ATM):c.8879G>A (p.Trp2960Ter) rs1131691149
NM_000051.3(ATM):c.8880G>A (p.Trp2960Ter) rs1060501650
NM_000051.3(ATM):c.8903T>A (p.Leu2968Ter) rs1555151315
NM_000051.3(ATM):c.8911C>T (p.Gln2971Ter)
NM_000051.3(ATM):c.8925_8928dup (p.Glu2977Argfs) rs1555151395
NM_000051.3(ATM):c.8942delA (p.His2981Profs) rs786203489
NM_000051.3(ATM):c.8977C>T (p.Arg2993Ter) rs770641163
NM_000051.3(ATM):c.8987+1G>C rs786203631
NM_000051.3(ATM):c.8988-1G>A rs730881386
NM_000051.3(ATM):c.8988-1G>C rs730881386
NM_000051.3(ATM):c.8998C>T (p.Gln3000Ter) rs587781698
NM_000051.3(ATM):c.9001_9002delAG (p.Ser3001Phefs) rs876660022
NM_000051.3(ATM):c.9005delT (p.Phe3002Serfs) rs876659235
NM_000051.3(ATM):c.9019G>T (p.Glu3007Ter) rs876660382
NM_000051.3(ATM):c.9021dupA (p.Arg3008Thrfs) rs876660235
NM_000051.3(ATM):c.9022C>T (p.Arg3008Cys) rs587782292
NM_000051.3(ATM):c.9037_9040delCTAC (p.Leu3013Lysfs)
NM_000051.3(ATM):c.9039dupA (p.Gln3014Thrfs) rs879253972
NM_000051.3(ATM):c.9045_9052dupGAAACTGA (p.Lys3018Argfs) rs1555151827
NM_000051.3(ATM):c.9047_9057del11 (p.Lys3016Serfs) rs587782847
NM_000051.3(ATM):c.9064dupG (p.Glu3022Glyfs) rs1057516282
NM_000051.3(ATM):c.9073delG (p.Val3025Cysfs) rs1555151928
NM_000051.3(ATM):c.9079dupA (p.Ser3027Lysfs) rs587780645
NM_000051.3(ATM):c.9112delC (p.Gln3038Argfs) rs587779878
NM_000051.3(ATM):c.9139C>T (p.Arg3047Ter) rs121434219

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.