ClinVar Miner

List of variants in gene combination ATM, C11orf65 reported by GeneDx

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 698
Download table as spreadsheet
HGVS dbSNP
NM_000051.3(ATM):c.*1T>A rs757922166
NM_000051.3(ATM):c.5763-11T>C rs1057520675
NM_000051.3(ATM):c.5763-12A>G rs1057523388
NM_000051.3(ATM):c.5763-13C>T rs1057522554
NM_000051.3(ATM):c.5763-14_5763-13delTC rs1064794707
NM_000051.3(ATM):c.5763-17_5763-16delAT rs1064793040
NM_000051.3(ATM):c.5763-2A>T rs876659489
NM_000051.3(ATM):c.5763A>G (p.Arg1921=) rs1057523784
NM_000051.3(ATM):c.5764C>T (p.Pro1922Ser) rs587781865
NM_000051.3(ATM):c.5766_5768TTC[1] (p.Ser1924del) rs866749094
NM_000051.3(ATM):c.5776_5790del (p.Thr1926_Asp1930del) rs786203678
NM_000051.3(ATM):c.5784dup (p.Asn1929Ter) rs1131691254
NM_000051.3(ATM):c.5787T>C (p.Asn1929=) rs1057520448
NM_000051.3(ATM):c.5791delinsCCT (p.Ala1931fs) rs587779851
NM_000051.3(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000051.3(ATM):c.5798G>A (p.Trp1933Ter) rs876658740
NM_000051.3(ATM):c.5821G>C (p.Val1941Leu) rs147187700
NM_000051.3(ATM):c.5825C>T (p.Ala1942Val) rs730881394
NM_000051.3(ATM):c.5882A>G (p.Tyr1961Cys) rs56399311
NM_000051.3(ATM):c.5886A>G (p.Ala1962=) rs1057522876
NM_000051.3(ATM):c.5890A>G (p.Lys1964Glu) rs201963507
NM_000051.3(ATM):c.5890A>T (p.Lys1964Ter) rs201963507
NM_000051.3(ATM):c.5894_5900dup (p.Met1967fs) rs1555110517
NM_000051.3(ATM):c.5904T>C (p.Asp1968=) rs1555110549
NM_000051.3(ATM):c.5908C>T (p.Gln1970Ter) rs587781722
NM_000051.3(ATM):c.5910del (p.Glu1971fs) rs587782198
NM_000051.3(ATM):c.5915A>C (p.Lys1972Thr) rs730881377
NM_000051.3(ATM):c.5917A>G (p.Arg1973Gly) rs786202089
NM_000051.3(ATM):c.5918+16A>G rs3092911
NM_000051.3(ATM):c.5919-13T>C rs1555111740
NM_000051.3(ATM):c.5932G>T (p.Glu1978Ter) rs587779852
NM_000051.3(ATM):c.5945A>G (p.Gln1982Arg) rs543980602
NM_000051.3(ATM):c.5947dup (p.Ser1983fs) rs879254271
NM_000051.3(ATM):c.5953A>G (p.Thr1985Ala) rs879254252
NM_000051.3(ATM):c.5956A>G (p.Ile1986Val) rs876660935
NM_000051.3(ATM):c.5959dup (p.Ser1987fs) rs1555111808
NM_000051.3(ATM):c.5971G>A (p.Glu1991Lys) rs786203404
NM_000051.3(ATM):c.5973A>C (p.Glu1991Asp) rs587782274
NM_000051.3(ATM):c.5975A>C (p.Lys1992Thr) rs150757822
NM_000051.3(ATM):c.5980_5986delinsTAAGAAA (p.Lys1994_Glu1996delinsTer) rs1555111868
NM_000051.3(ATM):c.5982del (p.Glu1995fs) rs1555111855
NM_000051.3(ATM):c.5994A>T (p.Gly1998=) rs56046250
NM_000051.3(ATM):c.6003A>G (p.Leu2001=) rs1057523413
NM_000051.3(ATM):c.6006+13G>C rs368207631
NM_000051.3(ATM):c.6006+4_6006+5delAA rs879254108
NM_000051.3(ATM):c.6007-19G>A rs1304200112
NM_000051.3(ATM):c.6007-8G>A rs1057524058
NM_000051.3(ATM):c.6007-9T>C
NM_000051.3(ATM):c.6007G>A (p.Asp2003Asn) rs730881378
NM_000051.3(ATM):c.6011T>G (p.Leu2004Arg) rs1064795932
NM_000051.3(ATM):c.6013delinsAA (p.Leu2005fs) rs1555113523
NM_000051.3(ATM):c.6025T>C (p.Tyr2009His) rs199586999
NM_000051.3(ATM):c.6040G>T (p.Glu2014Ter) rs375783941
NM_000051.3(ATM):c.6042G>A (p.Glu2014=) rs138987778
NM_000051.3(ATM):c.6059del (p.Gly2020fs) rs1064794166
NM_000051.3(ATM):c.6062G>A (p.Cys2021Tyr) rs876660062
NM_000051.3(ATM):c.6067G>A (p.Gly2023Arg) rs11212587
NM_000051.3(ATM):c.6078G>A (p.Met2026Ile) rs369349023
NM_000051.3(ATM):c.6087C>T (p.Pro2029=) rs1060504316
NM_000051.3(ATM):c.6088A>G (p.Ile2030Val) rs145847315
NM_000051.3(ATM):c.6095+6T>C rs1057522992
NM_000051.3(ATM):c.6095G>A (p.Arg2032Lys) rs139770721
NM_000051.3(ATM):c.6096-14A>G rs184029731
NM_000051.3(ATM):c.6096-2A>G rs1057520704
NM_000051.3(ATM):c.6096-9_6096-5delTTCTT rs879254095
NM_000051.3(ATM):c.6097C>T (p.Leu2033=) rs769813736
NM_000051.3(ATM):c.6099A>G (p.Leu2033=) rs1057521275
NM_000051.3(ATM):c.6100C>A (p.Arg2034=) rs532480170
NM_000051.3(ATM):c.6100C>T (p.Arg2034Ter) rs532480170
NM_000051.3(ATM):c.6101G>A (p.Arg2034Gln) rs3218670
NM_000051.3(ATM):c.6114C>G (p.His2038Gln) rs774993357
NM_000051.3(ATM):c.6114C>T (p.His2038=) rs774993357
NM_000051.3(ATM):c.6115G>A (p.Glu2039Lys) rs864622251
NM_000051.3(ATM):c.6122T>C (p.Met2041Thr) rs1000032847
NM_000051.3(ATM):c.6133del (p.Ala2045fs) rs1555113762
NM_000051.3(ATM):c.6134C>A (p.Ala2045Asp) rs879254147
NM_000051.3(ATM):c.6144A>G (p.Thr2048=) rs1201081443
NM_000051.3(ATM):c.6145T>G (p.Tyr2049Asp) rs786203767
NM_000051.3(ATM):c.6150C>T (p.Asp2050=) rs1057520805
NM_000051.3(ATM):c.6153C>T (p.Leu2051=) rs876658452
NM_000051.3(ATM):c.6154G>A (p.Glu2052Lys) rs202206540
NM_000051.3(ATM):c.6160G>T (p.Ala2054Ser) rs587779853
NM_000051.3(ATM):c.6168C>T (p.Pro2056=) rs1057520449
NM_000051.3(ATM):c.6176C>T (p.Thr2059Ile) rs144761622
NM_000051.3(ATM):c.6178C>T (p.Arg2060Cys) rs587778078
NM_000051.3(ATM):c.6179G>A (p.Arg2060His) rs376521407
NM_000051.3(ATM):c.6179G>C (p.Arg2060Pro) rs376521407
NM_000051.3(ATM):c.6188G>A (p.Gly2063Glu) rs866290641
NM_000051.3(ATM):c.6192C>A (p.Ile2064=) rs876659831
NM_000051.3(ATM):c.6194T>C (p.Ile2065Thr) rs372838622
NM_000051.3(ATM):c.6198+116T>C
NM_000051.3(ATM):c.6198+130G>A
NM_000051.3(ATM):c.6198+1G>A rs778031266
NM_000051.3(ATM):c.6198+3A>G rs786202092
NM_000051.3(ATM):c.6198G>C (p.Gln2066His) rs786203341
NM_000051.3(ATM):c.6199-17A>C rs1555114516
NM_000051.3(ATM):c.6199-3delT rs762251357
NM_000051.3(ATM):c.6217C>G (p.Leu2073Val) rs767406075
NM_000051.3(ATM):c.6219C>T (p.Leu2073=) rs752478345
NM_000051.3(ATM):c.6228del (p.Leu2077fs) rs786203008
NM_000051.3(ATM):c.6232T>C (p.Ser2078Pro) rs587779854
NM_000051.3(ATM):c.6234C>T (p.Ser2078=) rs569483748
NM_000051.3(ATM):c.6235G>A (p.Val2079Ile) rs1800060
NM_000051.3(ATM):c.6238T>G (p.Tyr2080Asp) rs1064795467
NM_000051.3(ATM):c.6239A>G (p.Tyr2080Cys) rs587779855
NM_000051.3(ATM):c.6250T>C (p.Leu2084=) rs772608345
NM_000051.3(ATM):c.6253G>T (p.Asp2085Tyr) rs730881379
NM_000051.3(ATM):c.6255T>A (p.Asp2085Glu) rs376898203
NM_000051.3(ATM):c.6257A>T (p.Tyr2086Phe) rs730881380
NM_000051.3(ATM):c.6293T>C (p.Leu2098Pro) rs587780631
NM_000051.3(ATM):c.6311G>C (p.Trp2104Ser) rs1064794143
NM_000051.3(ATM):c.6312G>A (p.Trp2104Ter) rs1555114766
NM_000051.3(ATM):c.6313A>G (p.Arg2105Gly) rs879253983
NM_000051.3(ATM):c.6315G>C (p.Arg2105Ser) rs587780632
NM_000051.3(ATM):c.6323A>G (p.Gln2108Arg) rs773891864
NM_000051.3(ATM):c.6325T>G (p.Trp2109Gly) rs1060501654
NM_000051.3(ATM):c.6326G>A (p.Trp2109Ter) rs587782114
NM_000051.3(ATM):c.6327G>A (p.Trp2109Ter) rs867760244
NM_000051.3(ATM):c.6330C>T (p.Asp2110=) rs759029705
NM_000051.3(ATM):c.6332A>G (p.His2111Arg) rs876658300
NM_000051.3(ATM):c.6333T>C (p.His2111=) rs55756349
NM_000051.3(ATM):c.6342C>T (p.Ser2114=) rs754020535
NM_000051.3(ATM):c.6343G>A (p.Val2115Ile) rs587780634
NM_000051.3(ATM):c.6347+4A>G rs1342227995
NM_000051.3(ATM):c.6347+6A>C rs750501197
NM_000051.3(ATM):c.6348-12C>T rs1057521664
NM_000051.3(ATM):c.6348-252T>C
NM_000051.3(ATM):c.6348-54T>C
NM_000051.3(ATM):c.6348-8T>C rs730881292
NM_000051.3(ATM):c.6352del (p.Glu2118fs) rs1555116357
NM_000051.3(ATM):c.6357A>G (p.Val2119=) rs1060504295
NM_000051.3(ATM):c.6368G>T (p.Ser2123Ile) rs1064794104
NM_000051.3(ATM):c.6374A>G (p.His2125Arg) rs730881381
NM_000051.3(ATM):c.6381A>G (p.Ser2127=) rs1555116408
NM_000051.3(ATM):c.6382T>C (p.Leu2128=) rs753646931
NM_000051.3(ATM):c.6384del (p.Leu2128fs) rs1555116427
NM_000051.3(ATM):c.6392C>A (p.Ala2131Asp) rs1060501594
NM_000051.3(ATM):c.6396A>G (p.Leu2132=) rs370537345
NM_000051.3(ATM):c.6397C>T (p.Gln2133Ter) rs876658163
NM_000051.3(ATM):c.6404_6405insTT (p.Leu2135_Arg2136insTer) rs587782554
NM_000051.3(ATM):c.6411C>G (p.Asp2137Glu) rs780299607
NM_000051.3(ATM):c.6413_6414GA[1] (p.Glu2139fs) rs863225466
NM_000051.3(ATM):c.6420C>A (p.Phe2140Leu) rs587780635
NM_000051.3(ATM):c.6435_6436del (p.Leu2147fs) rs786202323
NM_000051.3(ATM):c.6437G>C (p.Ser2146Thr) rs56815840
NM_000051.3(ATM):c.6443A>T (p.Lys2148Ile) rs730881382
NM_000051.3(ATM):c.6452+13G>A rs760228732
NM_000051.3(ATM):c.6452+17A>C rs371044809
NM_000051.3(ATM):c.6452+2T>C rs1064795006
NM_000051.3(ATM):c.6452+5T>A rs533830556
NM_000051.3(ATM):c.6452+9A>C rs771531015
NM_000051.3(ATM):c.6453-15C>A rs763296454
NM_000051.3(ATM):c.6453-15C>T rs763296454
NM_000051.3(ATM):c.6453-17T>G rs1057522251
NM_000051.3(ATM):c.6453-3T>C rs768073845
NM_000051.3(ATM):c.6453-5A>G rs755177899
NM_000051.3(ATM):c.6456A>G (p.Val2152=) rs876660014
NM_000051.3(ATM):c.6465G>A (p.Val2155=) rs140423883
NM_000051.3(ATM):c.6475T>G (p.Cys2159Gly) rs150408832
NM_000051.3(ATM):c.6481C>T (p.Arg2161Cys) rs1064793958
NM_000051.3(ATM):c.6482G>A (p.Arg2161His) rs756626462
NM_000051.3(ATM):c.6486C>T (p.Ser2162=) rs138166710
NM_000051.3(ATM):c.6490G>T (p.Glu2164Ter) rs1317619286
NM_000051.3(ATM):c.6500A>G (p.Tyr2167Cys) rs768155385
NM_000051.3(ATM):c.6503C>T (p.Ser2168Leu) rs200431631
NM_000051.3(ATM):c.6504G>A (p.Ser2168=) rs786203522
NM_000051.3(ATM):c.6505C>G (p.Leu2169Val) rs1064794157
NM_000051.3(ATM):c.6507C>G (p.Leu2169=) rs863224295
NM_000051.3(ATM):c.6516A>C (p.Thr2172=) rs576254168
NM_000051.3(ATM):c.6536T>C (p.Ile2179Thr) rs878853532
NM_000051.3(ATM):c.6537T>G (p.Ile2179Met) rs146243469
NM_000051.3(ATM):c.6543G>T (p.Glu2181Asp) rs138828590
NM_000051.3(ATM):c.6551G>C (p.Ser2184Thr) rs374551964
NM_000051.3(ATM):c.6552C>T (p.Ser2184=) rs565124064
NM_000051.3(ATM):c.6554T>C (p.Ile2185Thr) rs779611511
NM_000051.3(ATM):c.6571A>G (p.Arg2191Gly) rs587781861
NM_000051.3(ATM):c.6572+1G>A rs587779856
NM_000051.3(ATM):c.6572+20_6572+21delTT rs1064793041
NM_000051.3(ATM):c.6572+4T>C rs587780636
NM_000051.3(ATM):c.6573-11G>A rs375599653
NM_000051.3(ATM):c.6573-124T>A
NM_000051.3(ATM):c.6573-12C>T rs1057521666
NM_000051.3(ATM):c.6573-16_6573-15delAT rs1064794351
NM_000051.3(ATM):c.6573-41delC
NM_000051.3(ATM):c.6573-9G>C
NM_000051.3(ATM):c.6577G>A (p.Val2193Ile) rs754555043
NM_000051.3(ATM):c.6585T>C (p.His2195=) rs786203401
NM_000051.3(ATM):c.6603A>G (p.Val2201=) rs863224297
NM_000051.3(ATM):c.6604T>G (p.Tyr2202Asp) rs730881311
NM_000051.3(ATM):c.6628del (p.Gln2210fs) rs886039616
NM_000051.3(ATM):c.6636C>T (p.Leu2212=) rs876659563
NM_000051.3(ATM):c.6643A>G (p.Ser2215Gly) rs730881312
NM_000051.3(ATM):c.6645T>G (p.Ser2215Arg) rs1064794485
NM_000051.3(ATM):c.6671T>C (p.Met2224Thr) rs730881313
NM_000051.3(ATM):c.6678A>G (p.Leu2226=) rs772173373
NM_000051.3(ATM):c.6679C>T (p.Arg2227Cys) rs564652222
NM_000051.3(ATM):c.6680G>A (p.Arg2227His) rs879254132
NM_000051.3(ATM):c.6700C>T (p.Leu2234=) rs760602228
NM_000051.3(ATM):c.6730dup (p.Arg2244fs) rs1060501543
NM_000051.3(ATM):c.6736_6755delinsCA (p.Cys2246_Thr2252delinsHis) rs1064794237
NM_000051.3(ATM):c.6753C>T (p.Leu2251=) rs1057521515
NM_000051.3(ATM):c.6754del (p.Thr2252fs) rs1064793042
NM_000051.3(ATM):c.6774C>T (p.Leu2258=) rs1057520450
NM_000051.3(ATM):c.6777T>C (p.Ser2259=) rs1057522874
NM_000051.3(ATM):c.6795C>T (p.Phe2265=) rs3218699
NM_000051.3(ATM):c.6807+20A>G rs369001797
NM_000051.3(ATM):c.6807+20_6807+21delAT rs1555119392
NM_000051.3(ATM):c.6808-20A>G rs1240565463
NM_000051.3(ATM):c.6814G>A (p.Glu2272Lys) rs886039471
NM_000051.3(ATM):c.6816A>G (p.Glu2272=) rs1555119726
NM_000051.3(ATM):c.6820G>A (p.Ala2274Thr) rs567060474
NM_000051.3(ATM):c.6823A>C (p.Ile2275Leu) rs587779857
NM_000051.3(ATM):c.6823A>G (p.Ile2275Val) rs587779857
NM_000051.3(ATM):c.6835A>G (p.Lys2279Glu) rs756898113
NM_000051.3(ATM):c.6860G>A (p.Gly2287Glu) rs1800061
NM_000051.3(ATM):c.6860G>C (p.Gly2287Ala) rs1800061
NM_000051.3(ATM):c.6864_6865CT[1] (p.Val2288_Ser2289insTer) rs886039701
NM_000051.3(ATM):c.6879G>A (p.Leu2293=) rs1555119859
NM_000051.3(ATM):c.6885A>G (p.Glu2295=) rs748221367
NM_000051.3(ATM):c.6897C>T (p.Phe2299=) rs777164914
NM_000051.3(ATM):c.6908A>T (p.Lys2303Met) rs1064795166
NM_000051.3(ATM):c.6914_6915AG[1] (p.Leu2307fs) rs878853535
NM_000051.3(ATM):c.6919C>T (p.Leu2307Phe) rs56009889
NM_000051.3(ATM):c.6920_6923del (p.Leu2307fs) rs1064793043
NM_000051.3(ATM):c.6925C>T (p.Leu2309=) rs763839047
NM_000051.3(ATM):c.6974C>T (p.Ala2325Val) rs200940211
NM_000051.3(ATM):c.6975+13delT rs763287238
NM_000051.3(ATM):c.6975+13dupT rs763287238
NM_000051.3(ATM):c.6975+14dupA rs1555120120
NM_000051.3(ATM):c.6975+2T>C rs879254199
NM_000051.3(ATM):c.6975+5_6975+6delGT rs1064794094
NM_000051.3(ATM):c.6975+7T>A rs754834282
NM_000051.3(ATM):c.6975+7T>G rs754834282
NM_000051.3(ATM):c.6975G>A (p.Ala2325=) rs556778314
NM_000051.3(ATM):c.6975G>C (p.Ala2325=) rs556778314
NM_000051.3(ATM):c.6976-10_6989delTCTTATACAGAACAATCCCAGCCT rs587779859
NM_000051.3(ATM):c.6976-13C>T rs1555120901
NM_000051.3(ATM):c.6976-2A>C rs587782403
NM_000051.3(ATM):c.6976-5T>C rs1555120913
NM_000051.3(ATM):c.6983C>T (p.Pro2328Leu) rs786202730
NM_000051.3(ATM):c.6988C>G (p.Leu2330Val) rs148432863
NM_000051.3(ATM):c.6995T>C (p.Leu2332Pro) rs4988111
NM_000051.3(ATM):c.6997dup (p.Thr2333fs) rs587781299
NM_000051.3(ATM):c.6998C>A (p.Thr2333Lys) rs150503164
NM_000051.3(ATM):c.6998C>T (p.Thr2333Ile) rs150503164
NM_000051.3(ATM):c.6999A>G (p.Thr2333=) rs759267807
NM_000051.3(ATM):c.7000T>C (p.Tyr2334His) rs1064793312
NM_000051.3(ATM):c.7001A>G (p.Tyr2334Cys) rs879254258
NM_000051.3(ATM):c.7004C>T (p.Thr2335Ile) rs3092831
NM_000051.3(ATM):c.7010_7011del (p.Cys2337fs) rs864622416
NM_000051.3(ATM):c.7010_7065dup (p.Ile2356delinsValTer) rs1555120985
NM_000051.3(ATM):c.7035A>G (p.Leu2345=) rs1057523514
NM_000051.3(ATM):c.7036G>A (p.Ala2346Thr) rs144497088
NM_000051.3(ATM):c.7038A>T (p.Ala2346=) rs146167034
NM_000051.3(ATM):c.7044G>A (p.Thr2348=) rs140104789
NM_000051.3(ATM):c.7065_7067CAT[1] (p.Ile2356del) rs879254220
NM_000051.3(ATM):c.7066_7081del (p.Val2355_Ile2356insTer) rs886039502
NM_000051.3(ATM):c.7076C>T (p.Thr2359Ile) rs730881314
NM_000051.3(ATM):c.7078T>C (p.Tyr2360His) rs587779860
NM_000051.3(ATM):c.7089+20C>T rs730881275
NM_000051.3(ATM):c.7089+7T>C rs1404350048
NM_000051.3(ATM):c.7090-14G>A rs1486032156
NM_000051.3(ATM):c.7090-14G>T rs1486032156
NM_000051.3(ATM):c.7090G>C (p.Ala2364Pro) rs759439613
NM_000051.3(ATM):c.7107A>C (p.Gly2369=) rs1057523056
NM_000051.3(ATM):c.7108A>G (p.Asn2370Asp) rs767494363
NM_000051.3(ATM):c.7122A>C (p.Glu2374Asp) rs376159946
NM_000051.3(ATM):c.7131T>C (p.Asp2377=) rs373309822
NM_000051.3(ATM):c.7135C>G (p.Leu2379Val) rs778888033
NM_000051.3(ATM):c.7140A>G (p.Arg2380=) rs750569023
NM_000051.3(ATM):c.7145G>C (p.Gly2382Ala) rs1060501639
NM_000051.3(ATM):c.7156G>C (p.Ala2386Pro) rs876659392
NM_000051.3(ATM):c.7157C>A (p.Ala2386Glu) rs786203697
NM_000051.3(ATM):c.7166C>T (p.Ser2389Leu) rs1018140779
NM_000051.3(ATM):c.7174C>T (p.Arg2392Trp) rs149827260
NM_000051.3(ATM):c.7179T>C (p.Phe2393=) rs1057520430
NM_000051.3(ATM):c.7181C>T (p.Ser2394Leu) rs587779861
NM_000051.3(ATM):c.7187C>G (p.Thr2396Ser) rs370559102
NM_000051.3(ATM):c.7191A>G (p.Gln2397=) rs768906734
NM_000051.3(ATM):c.7200A>C (p.Arg2400Ser) rs1060501534
NM_000051.3(ATM):c.7209C>T (p.Asn2403=) rs373662499
NM_000051.3(ATM):c.7211A>G (p.Tyr2404Cys) rs1064794093
NM_000051.3(ATM):c.7215G>A (p.Met2405Ile) rs879254179
NM_000051.3(ATM):c.7221A>G (p.Ser2407=) rs786201881
NM_000051.3(ATM):c.7223C>T (p.Ser2408Leu) rs730881315
NM_000051.3(ATM):c.7224G>A (p.Ser2408=) rs145747513
NM_000051.3(ATM):c.7235A>C (p.Asn2412Thr) rs786203311
NM_000051.3(ATM):c.7235A>G (p.Asn2412Ser) rs786203311
NM_000051.3(ATM):c.7240C>A (p.Gln2414Lys) rs863224462
NM_000051.3(ATM):c.7244C>G (p.Ala2415Gly) rs370567994
NM_000051.3(ATM):c.7248C>T (p.Leu2416=) rs750513866
NM_000051.3(ATM):c.7253_7266del (p.Lys2418fs) rs1555122216
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7274G>T (p.Gly2425Val) rs148949644
NM_000051.3(ATM):c.7291A>G (p.Lys2431Glu) rs864622563
NM_000051.3(ATM):c.7299G>A (p.Gln2433=) rs1057520451
NM_000051.3(ATM):c.7299_7302del (p.Asn2435fs) rs886039628
NM_000051.3(ATM):c.7307+18A>C rs777909508
NM_000051.3(ATM):c.7307+18A>G rs777909508
NM_000051.3(ATM):c.7307+4A>G rs730881316
NM_000051.3(ATM):c.7307+8G>C rs1057523631
NM_000051.3(ATM):c.7308-10T>C rs745319720
NM_000051.3(ATM):c.7308-18T>C rs1473587970
NM_000051.3(ATM):c.7308A>C (p.Arg2436Ser) rs730881317
NM_000051.3(ATM):c.7313C>T (p.Thr2438Ile) rs147604227
NM_000051.3(ATM):c.7314A>C (p.Thr2438=) rs199909913
NM_000051.3(ATM):c.7316T>C (p.Val2439Ala) rs776266049
NM_000051.3(ATM):c.7317A>G (p.Val2439=) rs878853542
NM_000051.3(ATM):c.7327C>T (p.Arg2443Ter) rs121434220
NM_000051.3(ATM):c.7328G>A (p.Arg2443Gln) rs587782310
NM_000051.3(ATM):c.7331A>C (p.Glu2444Ala) rs879254245
NM_000051.3(ATM):c.7332G>C (p.Glu2444Asp) rs876658886
NM_000051.3(ATM):c.7336G>A (p.Glu2446Lys) rs730881318
NM_000051.3(ATM):c.7347dup (p.Leu2450fs) rs1555123008
NM_000051.3(ATM):c.7351G>C (p.Ala2451Pro) rs587779862
NM_000051.3(ATM):c.7354C>G (p.Leu2452Val) rs587779863
NM_000051.3(ATM):c.7357C>T (p.Arg2453Cys) rs755418571
NM_000051.3(ATM):c.7358G>A (p.Arg2453His) rs587781361
NM_000051.3(ATM):c.7359T>G (p.Arg2453=) rs786201541
NM_000051.3(ATM):c.7363C>T (p.Leu2455=) rs147665149
NM_000051.3(ATM):c.7370A>C (p.Glu2457Ala) rs778482902
NM_000051.3(ATM):c.7373A>T (p.Asp2458Val) rs879254201
NM_000051.3(ATM):c.7375C>G (p.Arg2459Gly) rs730881383
NM_000051.3(ATM):c.7375C>T (p.Arg2459Cys) rs730881383
NM_000051.3(ATM):c.7376G>A (p.Arg2459His) rs1064796589
NM_000051.3(ATM):c.7381C>T (p.Arg2461Cys) rs201314561
NM_000051.3(ATM):c.7383C>T (p.Arg2461=) rs1429991894
NM_000051.3(ATM):c.7390T>C (p.Cys2464Arg) rs55801750
NM_000051.3(ATM):c.7391_7412del (p.Cys2464fs) rs1064794690
NM_000051.3(ATM):c.7449G>A (p.Trp2483Ter) rs773516672
NM_000051.3(ATM):c.7450G>A (p.Val2484Ile) rs587779864
NM_000051.3(ATM):c.7456C>T (p.Arg2486Ter) rs587779865
NM_000051.3(ATM):c.7463G>A (p.Cys2488Tyr) rs774281788
NM_000051.3(ATM):c.7468C>T (p.Leu2490Phe) rs753262623
NM_000051.3(ATM):c.7470C>G (p.Leu2490=) rs1057521604
NM_000051.3(ATM):c.7475T>G (p.Leu2492Arg) rs56399857
NM_000051.3(ATM):c.7491_7499del (p.Ser2498_Val2500del) rs1064796307
NM_000051.3(ATM):c.7494T>C (p.Ser2498=) rs34393781
NM_000051.3(ATM):c.7502A>G (p.Asn2501Ser) rs531617441
NM_000051.3(ATM):c.7515+19A>T rs879254202
NM_000051.3(ATM):c.7515+20A>G rs80124497
NM_000051.3(ATM):c.7516-18_7516-17delTCinsAAT rs1555123881
NM_000051.3(ATM):c.7516-5G>A rs1057520837
NM_000051.3(ATM):c.7516-6T>C rs1057521003
NM_000051.3(ATM):c.7516-9delT rs573494809
NM_000051.3(ATM):c.7516-9dup rs573494809
NM_000051.3(ATM):c.7516A>G (p.Arg2506Gly) rs200441272
NM_000051.3(ATM):c.7517_7520delGAGA rs587781905
NM_000051.3(ATM):c.7522G>A (p.Gly2508Arg) rs754395517
NM_000051.3(ATM):c.7531A>T (p.Ile2511Phe) rs146069748
NM_000051.3(ATM):c.7539A>G (p.Thr2513=) rs752294923
NM_000051.3(ATM):c.7542T>C (p.Tyr2514=) rs777925486
NM_000051.3(ATM):c.7552C>T (p.Pro2518Ser) rs374876799
NM_000051.3(ATM):c.7553C>T (p.Pro2518Leu) rs879254136
NM_000051.3(ATM):c.7559T>G (p.Met2520Arg) rs587782692
NM_000051.3(ATM):c.7566A>G (p.Gln2522=) rs775621333
NM_000051.3(ATM):c.7577G>A (p.Arg2526Lys) rs876659323
NM_000051.3(ATM):c.7592T>C (p.Met2531Thr) rs587781365
NM_000051.3(ATM):c.7593G>A (p.Met2531Ile) rs786203764
NM_000051.3(ATM):c.7596G>A (p.Met2532Ile) rs587781854
NM_000051.3(ATM):c.7618G>A (p.Val2540Ile) rs35203200
NM_000051.3(ATM):c.7629+12T>C rs373731708
NM_000051.3(ATM):c.7629+13G>A rs563651647
NM_000051.3(ATM):c.7629+2T>C rs786203059
NM_000051.3(ATM):c.7629T>C (p.Asn2543=) rs767123895
NM_000051.3(ATM):c.7630-12C>G rs911541230
NM_000051.3(ATM):c.7630-15G>T rs773603597
NM_000051.3(ATM):c.7630-17T>C rs116047570
NM_000051.3(ATM):c.7630-2A>C rs587779866
NM_000051.3(ATM):c.7630-2A>G rs587779866
NM_000051.3(ATM):c.7630-3C>A rs587782448
NM_000051.3(ATM):c.7630-3C>T rs587782448
NM_000051.3(ATM):c.7630-4A>G rs1057523067
NM_000051.3(ATM):c.7630-7C>A rs730881276
NM_000051.3(ATM):c.7638_7646del (p.Arg2547_Ser2549del) rs587776547
NM_000051.3(ATM):c.7686C>T (p.Ala2562=) rs1555124531
NM_000051.3(ATM):c.7699_7702del (p.Asn2567fs) rs1060501547
NM_000051.3(ATM):c.7701_7702del (p.Asn2567fs) rs1064793359
NM_000051.3(ATM):c.7703_7704GA[1] (p.Arg2568_Asp2569insTer) rs759965045
NM_000051.3(ATM):c.7714C>T (p.Leu2572=) rs1472587727
NM_000051.3(ATM):c.7729G>A (p.Val2577Ile) rs1064795004
NM_000051.3(ATM):c.7736G>C (p.Arg2579Thr) rs879254206
NM_000051.3(ATM):c.7737_7739AAG[1] (p.Arg2580del) rs1064795204
NM_000051.3(ATM):c.7740A>C (p.Arg2580Ser) rs199915459
NM_000051.3(ATM):c.7742G>A (p.Ser2581Asn) rs1064795028
NM_000051.3(ATM):c.7744A>G (p.Arg2582Gly) rs750224234
NM_000051.3(ATM):c.7757A>G (p.Asn2586Ser) rs587778079
NM_000051.3(ATM):c.7772G>A (p.Ser2591Asn) rs730881319
NM_000051.3(ATM):c.7775C>G (p.Ser2592Cys) rs755009196
NM_000051.3(ATM):c.7778A>G (p.Gln2593Arg) rs587779867
NM_000051.3(ATM):c.7782T>A (p.Leu2594=) rs905474729
NM_000051.3(ATM):c.7785T>C (p.Asp2595=) rs34838175
NM_000051.3(ATM):c.7788+19C>T rs201990371
NM_000051.3(ATM):c.7788+3A>G rs869312788
NM_000051.3(ATM):c.7788+7G>A rs749610251
NM_000051.3(ATM):c.7788+8G>T rs112775908
NM_000051.3(ATM):c.7788G>A (p.Glu2596=) rs587780639
NM_000051.3(ATM):c.7789-16dupT rs776103192
NM_000051.3(ATM):c.7789-9dup rs1555125203
NM_000051.3(ATM):c.7792C>T (p.Arg2598Ter) rs138941496
NM_000051.3(ATM):c.7794A>C (p.Arg2598=) rs1555125220
NM_000051.3(ATM):c.7816A>G (p.Ile2606Val) rs376824528
NM_000051.3(ATM):c.7818A>G (p.Ile2606Met) rs1027959208
NM_000051.3(ATM):c.7825A>G (p.Ile2609Val) rs779400418
NM_000051.3(ATM):c.7836_7837GA[3] (p.Pro2614fs) rs730881293
NM_000051.3(ATM):c.7852A>C (p.Arg2618=) rs1057521185
NM_000051.3(ATM):c.7865C>G (p.Ala2622Gly) rs766351395
NM_000051.3(ATM):c.7865C>T (p.Ala2622Val) rs766351395
NM_000051.3(ATM):c.7880del (p.Tyr2627fs) rs1057516599
NM_000051.3(ATM):c.7881_7885TATTA[1] (p.Ile2629fs) rs1450394308
NM_000051.3(ATM):c.7897T>G (p.Leu2633Val) rs587779868
NM_000051.3(ATM):c.7912T>G (p.Trp2638Gly) rs563137460
NM_000051.3(ATM):c.7913G>A (p.Trp2638Ter) rs377349459
NM_000051.3(ATM):c.7919C>T (p.Thr2640Ile) rs4988125
NM_000051.3(ATM):c.7921C>T (p.Gln2641Ter) rs769523686
NM_000051.3(ATM):c.7926A>C (p.Arg2642Ser) rs863224440
NM_000051.3(ATM):c.7927+10T>C rs730881277
NM_000051.3(ATM):c.7927+13T>A rs748853277
NM_000051.3(ATM):c.7927+13delT rs587781324
NM_000051.3(ATM):c.7927+13dup rs587781324
NM_000051.3(ATM):c.7927+7T>G rs1057521294
NM_000051.3(ATM):c.7928-10T>C rs188404773
NM_000051.3(ATM):c.7928-6A>T rs373509918
NM_000051.3(ATM):c.7929delA rs1064795550
NM_000051.3(ATM):c.7942C>G (p.Pro2648Ala) rs878853547
NM_000051.3(ATM):c.7951C>A (p.Gln2651Lys) rs587781994
NM_000051.3(ATM):c.7983T>C (p.Asp2661=) rs143972422
NM_000051.3(ATM):c.7983_7985TGT[2] (p.Val2664del) rs876660743
NM_000051.3(ATM):c.7988T>C (p.Val2663Ala) rs377648506
NM_000051.3(ATM):c.7997C>A (p.Thr2666Asn) rs730881384
NM_000051.3(ATM):c.7998dup (p.Met2667fs) rs587779869
NM_000051.3(ATM):c.7999A>G (p.Met2667Val) rs34099398
NM_000051.3(ATM):c.8010+11A>C rs760588708
NM_000051.3(ATM):c.8010+19T>C rs1555126346
NM_000051.3(ATM):c.8011-131T>C
NM_000051.3(ATM):c.8011-16T>C rs776948701
NM_000051.3(ATM):c.8011-6T>G rs762092284
NM_000051.3(ATM):c.8015A>C (p.Asp2672Ala) rs763161651
NM_000051.3(ATM):c.8026G>A (p.Glu2676Lys) rs786202859
NM_000051.3(ATM):c.8032G>A (p.Gly2678Arg) rs766730487
NM_000051.3(ATM):c.8036_8051del (p.Asn2679fs) rs587780640
NM_000051.3(ATM):c.8041G>A (p.Val2681Met) rs1064795034
NM_000051.3(ATM):c.8044A>C (p.Thr2682Pro) rs730881320
NM_000051.3(ATM):c.8071C>T (p.Arg2691Cys) rs531980488
NM_000051.3(ATM):c.8072G>A (p.Arg2691His) rs876658385
NM_000051.3(ATM):c.8076dup (p.Ala2693fs) rs1555127151
NM_000051.3(ATM):c.8082A>C (p.Gly2694=) rs540266635
NM_000051.3(ATM):c.8085T>G (p.Gly2695=) rs1057520554
NM_000051.3(ATM):c.8096C>G (p.Pro2699Arg) rs879254209
NM_000051.3(ATM):c.8100A>G (p.Lys2700=) rs778601472
NM_000051.3(ATM):c.8103_8104del (p.Ile2702fs) rs1064793406
NM_000051.3(ATM):c.8112T>C (p.Cys2704=) rs786201543
NM_000051.3(ATM):c.8113G>A (p.Val2705Ile) rs587779870
NM_000051.3(ATM):c.8113G>T (p.Val2705Leu) rs587779870
NM_000051.3(ATM):c.8118T>C (p.Gly2706=) rs1057520990
NM_000051.3(ATM):c.8120C>G (p.Ser2707Cys) rs748016261
NM_000051.3(ATM):c.8121C>T (p.Ser2707=) rs770138283
NM_000051.3(ATM):c.8122G>A (p.Asp2708Asn) rs587782719
NM_000051.3(ATM):c.8129A>G (p.Lys2710Arg) rs587782001
NM_000051.3(ATM):c.8138G>A (p.Arg2713Lys) rs876659351
NM_000051.3(ATM):c.8138G>C (p.Arg2713Thr) rs876659351
NM_000051.3(ATM):c.8140C>T (p.Gln2714Ter) rs1060501695
NM_000051.3(ATM):c.8146G>T (p.Val2716Phe) rs730881385
NM_000051.3(ATM):c.8147T>C (p.Val2716Ala) rs587782652
NM_000051.3(ATM):c.8149A>T (p.Lys2717Ter) rs774334667
NM_000051.3(ATM):c.8151+11C>T rs555381912
NM_000051.3(ATM):c.8151+3G>A rs760065522
NM_000051.3(ATM):c.8151+8T>C rs768069197
NM_000051.3(ATM):c.8152-17G>A rs368924012
NM_000051.3(ATM):c.8152-1G>A rs1398616877
NM_000051.3(ATM):c.8152-6C>T rs200389039
NM_000051.3(ATM):c.8154C>T (p.Gly2718=) rs371021126
NM_000051.3(ATM):c.8156G>A (p.Arg2719His) rs55982963
NM_000051.3(ATM):c.8178T>C (p.Ala2726=) rs367575159
NM_000051.3(ATM):c.8185C>T (p.Gln2729Ter) rs587781967
NM_000051.3(ATM):c.8187A>G (p.Gln2729=) rs587781946
NM_000051.3(ATM):c.8187A>T (p.Gln2729His) rs587781946
NM_000051.3(ATM):c.8194T>G (p.Phe2732Val) rs876659619
NM_000051.3(ATM):c.8199G>A (p.Gln2733=) rs770552705
NM_000051.3(ATM):c.8208T>C (p.Asn2736=) rs1057523318
NM_000051.3(ATM):c.8211A>G (p.Thr2737=) rs876660946
NM_000051.3(ATM):c.8217G>A (p.Leu2739=) rs759069006
NM_000051.3(ATM):c.8217G>T (p.Leu2739=) rs759069006
NM_000051.3(ATM):c.8228C>T (p.Thr2743Met) rs730881321
NM_000051.3(ATM):c.8246A>G (p.Lys2749Arg) rs779145081
NM_000051.3(ATM):c.8248_8268del (p.Leu2750_Lys2756del) rs771146489
NM_000051.3(ATM):c.8260A>G (p.Thr2754Ala) rs587781414
NM_000051.3(ATM):c.8261C>T (p.Thr2754Ile) rs587779871
NM_000051.3(ATM):c.8262T>G (p.Thr2754=) rs1057521506
NM_000051.3(ATM):c.8264_8268del (p.Tyr2755fs) rs730881294
NM_000051.3(ATM):c.8265T>C (p.Tyr2755=) rs758654836
NM_000051.3(ATM):c.8265T>G (p.Tyr2755Ter) rs758654836
NM_000051.3(ATM):c.8266A>G (p.Lys2756Glu) rs371638537
NM_000051.3(ATM):c.8266A>T (p.Lys2756Ter) rs371638537
NM_000051.3(ATM):c.8268+11G>A rs769204788
NM_000051.3(ATM):c.8268+14C>T rs1057520231
NM_000051.3(ATM):c.8268+15T>G rs1555128691
NM_000051.3(ATM):c.8268+17C>T rs1555128698
NM_000051.3(ATM):c.8268+18T>C rs1555128701
NM_000051.3(ATM):c.8268+1G>A rs876658957
NM_000051.3(ATM):c.8268+6T>A rs747153940
NM_000051.3(ATM):c.8268+7A>G rs1057524565
NM_000051.3(ATM):c.8269-10_8269-9delGT rs587780641
NM_000051.3(ATM):c.8269-14A>T rs114320959
NM_000051.3(ATM):c.8269-18_8269-15delTTTA rs1064794684
NM_000051.3(ATM):c.8269-3C>T rs1555135336
NM_000051.3(ATM):c.8270T>G (p.Val2757Gly) rs201216427
NM_000051.3(ATM):c.8288del (p.Arg2763fs) rs886039630
NM_000051.3(ATM):c.8292_8293del (p.Ser2764fs) rs879254036
NM_000051.3(ATM):c.8296G>A (p.Val2766Ile) rs730881322
NM_000051.3(ATM):c.8297T>G (p.Val2766Gly) rs1064796249
NM_000051.3(ATM):c.8305_8317del (p.Trp2769fs) rs786202318
NM_000051.3(ATM):c.8310C>T (p.Cys2770=) rs1555135544
NM_000051.3(ATM):c.8314G>A (p.Gly2772Arg) rs1064794239
NM_000051.3(ATM):c.8325del (p.Ile2776fs) rs886039623
NM_000051.3(ATM):c.8327T>C (p.Ile2776Thr) rs746475628
NM_000051.3(ATM):c.8330G>T (p.Gly2777Val) rs879254240
NM_000051.3(ATM):c.8353G>A (p.Asp2785Asn) rs587782417
NM_000051.3(ATM):c.8355T>C (p.Asp2785=) rs372834825
NM_000051.3(ATM):c.8360C>T (p.Ala2787Val) rs879253877
NM_000051.3(ATM):c.8371_8374del (p.Tyr2791fs) rs1064793046
NM_000051.3(ATM):c.8373C>A (p.Tyr2791Ter) rs1060504292
NM_000051.3(ATM):c.8385_8394TTTCAGTGCC[1] (p.Phe2799fs) rs786202800
NM_000051.3(ATM):c.8391T>C (p.Ser2797=) rs566485657
NM_000051.3(ATM):c.8393C>A (p.Ala2798Asp) rs772992098
NM_000051.3(ATM):c.8395T>G (p.Phe2799Val) rs730881323
NM_000051.3(ATM):c.8397del (p.Gln2800fs) rs587781837
NM_000051.3(ATM):c.8399A>C (p.Gln2800Pro) rs879254273
NM_000051.3(ATM):c.8400G>C (p.Gln2800His) rs879253901
NM_000051.3(ATM):c.8405A>G (p.Gln2802Arg) rs730881324
NM_000051.3(ATM):c.8412A>G (p.Lys2804=) rs1555135872
NM_000051.3(ATM):c.8418+13C>T rs372552946
NM_000051.3(ATM):c.8418+5_8418+8delGTGA rs730881295
NM_000051.3(ATM):c.8419-16_8419-13delTATT rs774275044
NM_000051.3(ATM):c.8419-17A>G rs1057520452
NM_000051.3(ATM):c.8419-7_8419-4delTTTA rs730881306
NM_000051.3(ATM):c.8419G>T (p.Glu2807Ter) rs1555137929
NM_000051.3(ATM):c.8427A>G (p.Gln2809=) rs538173062
NM_000051.3(ATM):c.8428A>C (p.Lys2810Gln) rs730881325
NM_000051.3(ATM):c.8432del (p.Lys2811fs) rs587782558
NM_000051.3(ATM):c.8448A>G (p.Lys2816=) rs1555138048
NM_000051.3(ATM):c.8466T>C (p.Asp2822=) rs1057523224
NM_000051.3(ATM):c.8473C>T (p.Gln2825Ter) rs587781363
NM_000051.3(ATM):c.8479T>A (p.Phe2827Ile) rs370152402
NM_000051.3(ATM):c.8486C>T (p.Pro2829Leu) rs938431501
NM_000051.3(ATM):c.8494C>T (p.Arg2832Cys) rs587779872
NM_000051.3(ATM):c.8495G>A (p.Arg2832His) rs529296539
NM_000051.3(ATM):c.8495G>T (p.Arg2832Leu) rs529296539
NM_000051.3(ATM):c.8497T>C (p.Tyr2833His) rs774171813
NM_000051.3(ATM):c.8506A>G (p.Met2836Val) rs879253968
NM_000051.3(ATM):c.8525C>G (p.Pro2842Arg) rs879254065
NM_000051.3(ATM):c.8526A>G (p.Pro2842=) rs900737596
NM_000051.3(ATM):c.8530_8532dup (p.Ile2844dup) rs1555138275
NM_000051.3(ATM):c.8532T>C (p.Ile2844=) rs730881278
NM_000051.3(ATM):c.8545C>T (p.Arg2849Ter) rs587778080
NM_000051.3(ATM):c.8546G>A (p.Arg2849Gln) rs587782202
NM_000051.3(ATM):c.8549T>A (p.Leu2850Ter) rs876658716
NM_000051.3(ATM):c.8549T>C (p.Leu2850Ser) rs876658716
NM_000051.3(ATM):c.8554T>C (p.Tyr2852His) rs1064794108
NM_000051.3(ATM):c.8556T>C (p.Tyr2852=) rs779394254
NM_000051.3(ATM):c.8558C>G (p.Thr2853Arg) rs141534716
NM_000051.3(ATM):c.8558C>T (p.Thr2853Met) rs141534716
NM_000051.3(ATM):c.8560C>T (p.Arg2854Cys) rs201958469
NM_000051.3(ATM):c.8561G>A (p.Arg2854His) rs1060501605
NM_000051.3(ATM):c.8562C>T (p.Arg2854=) rs878853550
NM_000051.3(ATM):c.8564del (p.Ser2855fs) rs886039643
NM_000051.3(ATM):c.8565_8566delinsAA (p.Ser2855_Val2856delinsArgIle) rs587781353
NM_000051.3(ATM):c.8578_8580delTCT (p.SER1512DEL) rs786203976
NM_000051.3(ATM):c.8584+10T>C rs373321041
NM_000051.3(ATM):c.8584+13T>C rs1057522394
NM_000051.3(ATM):c.8584+9_8584+11delCTT rs1064794534
NM_000051.3(ATM):c.8585-13_8598del27 rs1555139443
NM_000051.3(ATM):c.8585-17_8585-14delGTTT rs764013510
NM_000051.3(ATM):c.8585-229A>T
NM_000051.3(ATM):c.8585-2A>C rs1060501700
NM_000051.3(ATM):c.8592C>T (p.Tyr2864=) rs56025670
NM_000051.3(ATM):c.8593A>G (p.Ile2865Val) rs786202223
NM_000051.3(ATM):c.8594T>C (p.Ile2865Thr) rs587779873
NM_000051.3(ATM):c.8595A>T (p.Ile2865=) rs777245630
NM_000051.3(ATM):c.8596C>T (p.Leu2866Phe) rs368666328
NM_000051.3(ATM):c.8617G>A (p.Val2873Ile) rs730881327
NM_000051.3(ATM):c.8624A>G (p.Asn2875Ser) rs587782451
NM_000051.3(ATM):c.8629T>C (p.Leu2877=) rs730881279
NM_000051.3(ATM):c.8631G>A (p.Leu2877=) rs1064794840
NM_000051.3(ATM):c.8641C>T (p.Gln2881Ter) rs1057520672
NM_000051.3(ATM):c.8655dup (p.Val2886fs) rs753961188
NM_000051.3(ATM):c.8656G>A (p.Val2886Ile) rs1064795066
NM_000051.3(ATM):c.8663T>C (p.Ile2888Thr) rs760955058
NM_000051.3(ATM):c.8668C>G (p.Leu2890Val) rs587779874
NM_000051.3(ATM):c.8671+19G>C rs1308810219
NM_000051.3(ATM):c.8671+20T>C rs1057521774
NM_000051.3(ATM):c.8671+9T>G rs200190537
NM_000051.3(ATM):c.8672-104G>A
NM_000051.3(ATM):c.8672-13T>G rs730881280
NM_000051.3(ATM):c.8672-1G>C rs876660088
NM_000051.3(ATM):c.8674G>A (p.Val2892Ile) rs1064793425
NM_000051.3(ATM):c.8695dup (p.Ile2899fs) rs1555142816
NM_000051.3(ATM):c.8706T>C (p.Thr2902=) rs1555142824
NM_000051.3(ATM):c.8717T>C (p.Val2906Ala) rs730881328
NM_000051.3(ATM):c.8730C>G (p.Leu2910=) rs551041839
NM_000051.3(ATM):c.8732C>T (p.Thr2911Ile) rs794728018
NM_000051.3(ATM):c.8733C>A (p.Thr2911=) rs1057523011
NM_000051.3(ATM):c.8734A>G (p.Arg2912Gly) rs376676328
NM_000051.3(ATM):c.8757C>T (p.Gly2919=) rs987508358
NM_000051.3(ATM):c.8762C>A (p.Thr2921Lys) rs730881329
NM_000051.3(ATM):c.8762C>T (p.Thr2921Met) rs730881329
NM_000051.3(ATM):c.8763G>T (p.Thr2921=) rs781528244
NM_000051.3(ATM):c.8786+11T>C rs368627124
NM_000051.3(ATM):c.8786+11T>G rs368627124
NM_000051.3(ATM):c.8786+16T>C rs1057521277
NM_000051.3(ATM):c.8786+19delA rs730881307
NM_000051.3(ATM):c.8786+1G>A rs17174393
NM_000051.3(ATM):c.8786+1G>C rs17174393
NM_000051.3(ATM):c.8786+20G>C rs56283878
NM_000051.3(ATM):c.8787-14G>A rs994348665
NM_000051.3(ATM):c.8787-15T>C rs1057521788
NM_000051.3(ATM):c.8787-19A>G rs1555143457
NM_000051.3(ATM):c.8787-5T>C rs1479499265
NM_000051.3(ATM):c.8793T>A (p.Cys2931Ter) rs1555143494
NM_000051.3(ATM):c.8797A>G (p.Lys2933Glu) rs587779875
NM_000051.3(ATM):c.8802del (p.Met2935fs) rs876660567
NM_000051.3(ATM):c.8805G>A (p.Met2935Ile) rs772621438
NM_000051.3(ATM):c.8810T>C (p.Val2937Ala) rs587782149
NM_000051.3(ATM):c.8814_8824del (p.Met2938fs) rs758814126
NM_000051.3(ATM):c.8820C>T (p.Asn2940=) rs775823407
NM_000051.3(ATM):c.8831_8832CT[1] (p.Leu2945fs) rs786203030
NM_000051.3(ATM):c.8833C>T (p.Leu2945=) rs786203505
NM_000051.3(ATM):c.8844T>C (p.Ile2948=) rs878853551
NM_000051.3(ATM):c.8845G>A (p.Val2949Ile) rs587782497
NM_000051.3(ATM):c.8850+12dupT rs1555143639
NM_000051.3(ATM):c.8850+14T>C rs1294857465
NM_000051.3(ATM):c.8850+17G>A rs1027667991
NM_000051.3(ATM):c.8850+4A>C rs587782335
NM_000051.3(ATM):c.8850+5A>C rs1057522186
NM_000051.3(ATM):c.8850+8A>G rs1057520908
NM_000051.3(ATM):c.8851-10C>T rs1057521676
NM_000051.3(ATM):c.8851-2A>G rs886039647
NM_000051.3(ATM):c.8859A>G (p.Leu2953=) rs773994431
NM_000051.3(ATM):c.8860T>C (p.Tyr2954His) rs371619067
NM_000051.3(ATM):c.8861A>G (p.Tyr2954Cys) rs767507047
NM_000051.3(ATM):c.8876_8879del (p.Asp2959fs) rs786204726
NM_000051.3(ATM):c.8878T>C (p.Trp2960Arg) rs1064794739
NM_000051.3(ATM):c.8895G>C (p.Leu2965Phe) rs200899512
NM_000051.3(ATM):c.8902T>C (p.Leu2968=) rs775313366
NM_000051.3(ATM):c.8906A>G (p.Tyr2969Cys) rs376524155
NM_000051.3(ATM):c.8918G>T (p.Arg2973Met) rs730881331
NM_000051.3(ATM):c.8918_8929delinsTGT (p.Arg2973_Glu2977delinsMetTer) rs1064795675
NM_000051.3(ATM):c.8919G>A (p.Arg2973=) rs786203613
NM_000051.3(ATM):c.8921C>T (p.Pro2974Leu) rs139379666
NM_000051.3(ATM):c.8922G>A (p.Pro2974=) rs527248759
NM_000051.3(ATM):c.8928T>C (p.Asp2976=) rs786202343
NM_000051.3(ATM):c.8934T>C (p.Thr2978=) rs1057521029
NM_000051.3(ATM):c.8937G>A (p.Glu2979=) rs876658242
NM_000051.3(ATM):c.8942A>G (p.His2981Arg) rs750441954
NM_000051.3(ATM):c.8964C>T (p.Asp2988=) rs969795398
NM_000051.3(ATM):c.8965C>G (p.Gln2989Glu) rs147695170
NM_000051.3(ATM):c.8968G>A (p.Glu2990Lys) rs1800558
NM_000051.3(ATM):c.8977C>T (p.Arg2993Ter) rs770641163
NM_000051.3(ATM):c.8983C>A (p.Leu2995Ile) rs142322668
NM_000051.3(ATM):c.8987+20G>T rs1555151566
NM_000051.3(ATM):c.8987+3G>A rs56360226
NM_000051.3(ATM):c.8988-1G>A rs730881386
NM_000051.3(ATM):c.8988-1G>C rs730881386
NM_000051.3(ATM):c.8988-8G>A rs1555151666
NM_000051.3(ATM):c.9006C>T (p.Phe3002=) rs540172506
NM_000051.3(ATM):c.9008A>G (p.Asn3003Ser) rs144636562
NM_000051.3(ATM):c.9019G>T (p.Glu3007Ter) rs876660382
NM_000051.3(ATM):c.9021dup (p.Arg3008fs) rs876660235
NM_000051.3(ATM):c.9022C>T (p.Arg3008Cys) rs587782292
NM_000051.3(ATM):c.9023G>A (p.Arg3008His) rs587781894
NM_000051.3(ATM):c.9024T>C (p.Arg3008=) rs876658179
NM_000051.3(ATM):c.9031A>G (p.Met3011Val) rs372795527
NM_000051.3(ATM):c.9039dup (p.Gln3014fs) rs879253972
NM_000051.3(ATM):c.9041A>G (p.Gln3014Arg) rs1064793579
NM_000051.3(ATM):c.9045G>A (p.Glu3015=) rs786203336
NM_000051.3(ATM):c.9045_9052dup (p.Lys3018delinsArgAsnTer) rs1555151827
NM_000051.3(ATM):c.9048A>G (p.Lys3016=) rs553001467
NM_000051.3(ATM):c.9049C>T (p.Leu3017=) rs876658991
NM_000051.3(ATM):c.9060G>T (p.Val3020=) rs864622625
NM_000051.3(ATM):c.9067G>A (p.Gly3023Ser) rs879253964
NM_000051.3(ATM):c.9071C>T (p.Thr3024Ile) rs786203183
NM_000051.3(ATM):c.9079dup (p.Ser3027fs) rs587780645
NM_000051.3(ATM):c.9086G>A (p.Gly3029Asp) rs201199629
NM_000051.3(ATM):c.9086G>T (p.Gly3029Val) rs201199629
NM_000051.3(ATM):c.9087T>G (p.Gly3029=) rs759675675
NM_000051.3(ATM):c.9088G>A (p.Gly3030Arg) rs879254215
NM_000051.3(ATM):c.9094G>C (p.Val3032Leu) rs587779877
NM_000051.3(ATM):c.9102_9103delinsTT (p.Leu3034_Leu3035delinsPhePhe) rs730881308
NM_000051.3(ATM):c.9112del (p.Gln3038fs) rs587779878
NM_000051.3(ATM):c.9113A>T (p.Gln3038Leu) rs1131691391
NM_000051.3(ATM):c.9128A>G (p.Lys3043Arg) rs867893961
NM_000051.3(ATM):c.9139C>T (p.Arg3047Ter) rs121434219
NM_000051.3(ATM):c.9142C>G (p.Leu3048Val) rs876660534
NM_000051.3(ATM):c.9149C>T (p.Pro3050Leu) rs778267979
NM_000051.3(ATM):c.9151G>C (p.Gly3051Arg) rs730881332
NM_000051.3(ATM):c.9153A>C (p.Gly3051=) rs1555152080
NM_000051.3(ATM):c.9159A>G (p.Lys3053=) rs1060504315
NM_000051.3(ATM):c.9166G>T (p.Val3056Leu) rs371767164

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.