ClinVar Miner

List of variants in gene combination ATM, C11orf65 reported by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 1445
Download table as spreadsheet
HGVS dbSNP
NC_000011.9:g.(?_108093559)_(108239826_?)del
NC_000011.9:g.(?_108098342)_(108236245_?)del
NC_000011.9:g.(?_108098342)_(108236245_?)dup
NC_000011.9:g.(?_108098346)_(108236241_?)dup
NC_000011.9:g.(?_108114670)_(108225611_?)dup
NC_000011.9:g.(?_108114670)_(108236245_?)del
NC_000011.9:g.(?_108114674)_(108225607_?)dup
NC_000011.9:g.(?_108114680)_(108239826_?)del
NC_000011.9:g.(?_108115509)_(108236241_?)dup
NC_000011.9:g.(?_108126936)_(108236241_?)dup
NC_000011.9:g.(?_108137878)_(108236255_?)del
NC_000011.9:g.(?_108137888)_(108225611_?)del
NC_000011.9:g.(?_108137888)_(108225611_?)dup
NC_000011.9:g.(?_108137888)_(108236245_?)del
NC_000011.9:g.(?_108137888)_(108236245_?)dup
NC_000011.9:g.(?_108137892)_(108236241_?)del
NC_000011.9:g.(?_108151712)_(108236245_?)del
NC_000011.9:g.(?_108168014)_(108206688_?)del
NC_000011.9:g.(?_108172365)_(108236245_?)dup
NC_000011.9:g.(?_108188090)_(108188258_?)del
NC_000011.9:g.(?_108196037)_(108239826_?)del
NC_000011.9:g.(?_108198362)_(108202294_?)del
NC_000011.9:g.(?_108198372)_(108202284_?)del
NC_000011.9:g.(?_108198469)_(108225601_?)dup
NC_000011.9:g.(?_108205686)_(108225611_?)del
NC_000011.9:g.(?_108205690)_(108225607_?)del
NC_000011.9:g.(?_108205690)_(108236241_?)dup
NC_000011.9:g.(?_108206566)_(108236241_?)dup
NC_000011.9:g.(?_108206639)_(108211067_?)del
NC_000011.9:g.(?_108213939)_(108236245_?)del
NC_000011.9:g.(?_108213949)_(108239826_?)del
NC_000011.9:g.(?_108217996)_(108225611_?)del
NC_000011.9:g.(?_108234836)_(108236245_?)del
NC_000011.9:g.(?_108234836)_(108236255_?)del
NC_000011.9:g.(?_108235799)_(108236245_?)del
NC_000011.9:g.(?_108235803)_(108236241_?)del
NC_000011.9:g.(?_108235809)_(108236235_?)del
NM_000051.3(ATM):c.2467-?_8850+?dup6384
NM_000051.3(ATM):c.3403-?_*(1_?)del
NM_000051.3(ATM):c.5129_5763-1060del
NM_000051.3(ATM):c.5763-7T>C rs1555110216
NM_000051.3(ATM):c.5763A>G (p.Arg1921=) rs1057523784
NM_000051.3(ATM):c.5764C>T (p.Pro1922Ser) rs587781865
NM_000051.3(ATM):c.5765C>A (p.Pro1922His) rs751792004
NM_000051.3(ATM):c.5766_5768TTC[1] (p.Ser1924del) rs866749094
NM_000051.3(ATM):c.5769T>C (p.Ser1923=) rs1060504280
NM_000051.3(ATM):c.5771C>T (p.Ser1924Leu) rs876658831
NM_000051.3(ATM):c.5774G>A (p.Gly1925Glu) rs755055090
NM_000051.3(ATM):c.5776A>G (p.Thr1926Ala) rs781448339
NM_000051.3(ATM):c.5776_5790del (p.Thr1926_Asp1930del) rs786203678
NM_000051.3(ATM):c.5791delinsCCT (p.Ala1931fs) rs587779851
NM_000051.3(ATM):c.5792C>T (p.Ala1931Val) rs1243690083
NM_000051.3(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000051.3(ATM):c.5798G>A (p.Trp1933Ter) rs876658740
NM_000051.3(ATM):c.5803G>A (p.Asp1935Asn)
NM_000051.3(ATM):c.5805_5815delinsATT (p.Asp1935fs)
NM_000051.3(ATM):c.5812T>A (p.Tyr1938Asn) rs786203668
NM_000051.3(ATM):c.5817A>G (p.Leu1939=) rs749652134
NM_000051.3(ATM):c.5821G>C (p.Val1941Leu) rs147187700
NM_000051.3(ATM):c.5821G>T (p.Val1941Phe)
NM_000051.3(ATM):c.5822T>G (p.Val1941Gly) rs876660334
NM_000051.3(ATM):c.5824G>T (p.Ala1942Ser) rs1286443989
NM_000051.3(ATM):c.5825C>T (p.Ala1942Val) rs730881394
NM_000051.3(ATM):c.5828A>G (p.Lys1943Arg) rs746676271
NM_000051.3(ATM):c.5835T>G (p.Ala1945=) rs768106055
NM_000051.3(ATM):c.5838G>T (p.Gln1946His) rs1060501612
NM_000051.3(ATM):c.5845G>T (p.Ala1949Ser) rs1555110401
NM_000051.3(ATM):c.5851C>G (p.His1951Asp) rs1060501673
NM_000051.3(ATM):c.5854T>A (p.Phe1952Ile) rs1555110421
NM_000051.3(ATM):c.5856T>C (p.Phe1952=) rs864622297
NM_000051.3(ATM):c.5858C>G (p.Thr1953Arg)
NM_000051.3(ATM):c.5865A>G (p.Leu1955=) rs1555110432
NM_000051.3(ATM):c.5866C>T (p.Leu1956Phe) rs1565489956
NM_000051.3(ATM):c.5867T>A (p.Leu1956His) rs876658989
NM_000051.3(ATM):c.5868C>T (p.Leu1956=) rs540054724
NM_000051.3(ATM):c.5870_5871del (p.Tyr1957fs) rs1060501657
NM_000051.3(ATM):c.5879T>A (p.Ile1960Asn) rs587782503
NM_000051.3(ATM):c.5882A>G (p.Tyr1961Cys) rs56399311
NM_000051.3(ATM):c.5886A>G (p.Ala1962=) rs1057522876
NM_000051.3(ATM):c.5887G>A (p.Asp1963Asn) rs864622148
NM_000051.3(ATM):c.5888A>G (p.Asp1963Gly) rs1555110484
NM_000051.3(ATM):c.5890A>G (p.Lys1964Glu) rs201963507
NM_000051.3(ATM):c.5890A>T (p.Lys1964Ter) rs201963507
NM_000051.3(ATM):c.5891A>G (p.Lys1964Arg) rs1555110503
NM_000051.3(ATM):c.5892G>C (p.Lys1964Asn) rs786202728
NM_000051.3(ATM):c.5895A>T (p.Lys1965Asn) rs1565490147
NM_000051.3(ATM):c.5897G>A (p.Ser1966Asn) rs1555110520
NM_000051.3(ATM):c.5899A>G (p.Met1967Val) rs1060501541
NM_000051.3(ATM):c.5902_5903insSVA (p.Asp1968delinsXaaAsn)
NM_000051.3(ATM):c.5908C>T (p.Gln1970Ter) rs587781722
NM_000051.3(ATM):c.5909A>G (p.Gln1970Arg) rs1555110568
NM_000051.3(ATM):c.5910del (p.Glu1971fs) rs587782198
NM_000051.3(ATM):c.5912A>T (p.Glu1971Val) rs1565490253
NM_000051.3(ATM):c.5914A>G (p.Lys1972Glu) rs1060501652
NM_000051.3(ATM):c.5915A>C (p.Lys1972Thr) rs730881377
NM_000051.3(ATM):c.5917A>G (p.Arg1973Gly) rs786202089
NM_000051.3(ATM):c.5918+1G>A
NM_000051.3(ATM):c.5918+3A>G rs1555110595
NM_000051.3(ATM):c.5918+8A>C rs1401825950
NM_000051.3(ATM):c.5918G>A (p.Arg1973Lys) rs1555110591
NM_000051.3(ATM):c.5927C>T (p.Ala1976Val) rs1197973623
NM_000051.3(ATM):c.5930T>C (p.Phe1977Ser) rs780867575
NM_000051.3(ATM):c.5931del (p.Phe1977fs) rs1565493368
NM_000051.3(ATM):c.5932G>T (p.Glu1978Ter) rs587779852
NM_000051.3(ATM):c.5934A>C (p.Glu1978Asp) rs945198632
NM_000051.3(ATM):c.5938G>A (p.Gly1980Arg) rs786203765
NM_000051.3(ATM):c.5944C>T (p.Gln1982Ter) rs1555111775
NM_000051.3(ATM):c.5945A>G (p.Gln1982Arg) rs543980602
NM_000051.3(ATM):c.5950A>T (p.Thr1984Ser) rs1060501603
NM_000051.3(ATM):c.5951C>G (p.Thr1984Arg) rs770722380
NM_000051.3(ATM):c.5953A>G (p.Thr1985Ala) rs879254252
NM_000051.3(ATM):c.5955T>C (p.Thr1985=) rs1555111801
NM_000051.3(ATM):c.5956A>G (p.Ile1986Val) rs876660935
NM_000051.3(ATM):c.5961T>G (p.Ser1987=) rs1060504265
NM_000051.3(ATM):c.5964C>G (p.Ser1988Arg) rs774260725
NM_000051.3(ATM):c.5964C>T (p.Ser1988=) rs774260725
NM_000051.3(ATM):c.5966T>G (p.Leu1989Trp) rs1565493603
NM_000051.3(ATM):c.5971G>A (p.Glu1991Lys) rs786203404
NM_000051.3(ATM):c.5971G>T (p.Glu1991Ter) rs786203404
NM_000051.3(ATM):c.5971dup (p.Glu1991fs)
NM_000051.3(ATM):c.5972A>G (p.Glu1991Gly)
NM_000051.3(ATM):c.5975A>C (p.Lys1992Thr) rs150757822
NM_000051.3(ATM):c.5977A>C (p.Ser1993Arg)
NM_000051.3(ATM):c.5979_5983del (p.Ser1993fs) rs876660134
NM_000051.3(ATM):c.5982del (p.Glu1995fs) rs1555111855
NM_000051.3(ATM):c.5983G>A (p.Glu1995Lys) rs1555111886
NM_000051.3(ATM):c.5983_5985GAA[1] (p.Glu1996del) rs1555111872
NM_000051.3(ATM):c.5993G>T (p.Gly1998Val) rs1188125296
NM_000051.3(ATM):c.5994A>T (p.Gly1998=) rs56046250
NM_000051.3(ATM):c.5999G>A (p.Ser2000Asn) rs775921052
NM_000051.3(ATM):c.6006+1G>C rs786202016
NM_000051.3(ATM):c.6006+4_6006+5delAA rs879254108
NM_000051.3(ATM):c.6006+7A>G rs1060504289
NM_000051.3(ATM):c.6006+8T>C rs56019194
NM_000051.3(ATM):c.6006G>C (p.Gln2002His)
NM_000051.3(ATM):c.6007-5T>C rs863224294
NM_000051.3(ATM):c.6009T>C (p.Asp2003=) rs878853526
NM_000051.3(ATM):c.6009T>G (p.Asp2003Glu) rs878853526
NM_000051.3(ATM):c.6010C>A (p.Leu2004Ile) rs1060501561
NM_000051.3(ATM):c.6012T>C (p.Leu2004=) rs1324998068
NM_000051.3(ATM):c.6025T>C (p.Tyr2009His) rs199586999
NM_000051.3(ATM):c.6036A>G (p.Ile2012Met)
NM_000051.3(ATM):c.6040G>C (p.Glu2014Gln) rs375783941
NM_000051.3(ATM):c.6040G>T (p.Glu2014Ter) rs375783941
NM_000051.3(ATM):c.6042G>A (p.Glu2014=) rs138987778
NM_000051.3(ATM):c.6049_6052del (p.Ser2017fs)
NM_000051.3(ATM):c.6049dup (p.Ser2017fs) rs797045030
NM_000051.3(ATM):c.6050_6057delinsTA (p.Ser2017_Tyr2019delinsIle) rs1565498913
NM_000051.3(ATM):c.6053T>C (p.Leu2018Ser) rs755694394
NM_000051.3(ATM):c.6056A>G (p.Tyr2019Cys) rs876658415
NM_000051.3(ATM):c.6061T>C (p.Cys2021Arg)
NM_000051.3(ATM):c.6062G>A (p.Cys2021Tyr) rs876660062
NM_000051.3(ATM):c.6067G>A (p.Gly2023Arg) rs11212587
NM_000051.3(ATM):c.6068G>A (p.Gly2023Glu) rs1486220915
NM_000051.3(ATM):c.6070G>A (p.Gly2024Arg) rs1565499041
NM_000051.3(ATM):c.6071G>A (p.Gly2024Glu) rs1060501564
NM_000051.3(ATM):c.6078G>A (p.Met2026Ile) rs369349023
NM_000051.3(ATM):c.6080del (p.Leu2027fs) rs1060501548
NM_000051.3(ATM):c.6082C>G (p.Gln2028Glu)
NM_000051.3(ATM):c.6082C>T (p.Gln2028Ter) rs876659454
NM_000051.3(ATM):c.6086C>T (p.Pro2029Leu) rs863224575
NM_000051.3(ATM):c.6087C>T (p.Pro2029=) rs1060504316
NM_000051.3(ATM):c.6088A>G (p.Ile2030Val) rs145847315
NM_000051.3(ATM):c.6095+1G>A rs587781584
NM_000051.3(ATM):c.6095+4A>C
NM_000051.3(ATM):c.6095+4A>G rs1555113632
NM_000051.3(ATM):c.6095+5A>G rs757328753
NM_000051.3(ATM):c.6095+5delA rs1555113628
NM_000051.3(ATM):c.6095+6T>A rs1057522992
NM_000051.3(ATM):c.6095+6T>C rs1057522992
NM_000051.3(ATM):c.6095+8G>T rs547072690
NM_000051.3(ATM):c.6095G>A (p.Arg2032Lys) rs139770721
NM_000051.3(ATM):c.6096-1G>C
NM_000051.3(ATM):c.6096-3T>C rs748380897
NM_000051.3(ATM):c.6096-9_6096-5delTTCTT rs879254095
NM_000051.3(ATM):c.6097C>T (p.Leu2033=) rs769813736
NM_000051.3(ATM):c.6100C>A (p.Arg2034=) rs532480170
NM_000051.3(ATM):c.6100C>T (p.Arg2034Ter) rs532480170
NM_000051.3(ATM):c.6101G>A (p.Arg2034Gln) rs3218670
NM_000051.3(ATM):c.6103A>G (p.Thr2035Ala) rs876659555
NM_000051.3(ATM):c.6105A>G (p.Thr2035=) rs1555113708
NM_000051.3(ATM):c.6106T>G (p.Tyr2036Asp)
NM_000051.3(ATM):c.6107A>G (p.Tyr2036Cys) rs786204141
NM_000051.3(ATM):c.6108T>C (p.Tyr2036=) rs3092826
NM_000051.3(ATM):c.6108T>G (p.Tyr2036Ter)
NM_000051.3(ATM):c.6112C>A (p.His2038Asn) rs1060501643
NM_000051.3(ATM):c.6114C>G (p.His2038Gln) rs774993357
NM_000051.3(ATM):c.6114C>T (p.His2038=) rs774993357
NM_000051.3(ATM):c.6115G>A (p.Glu2039Lys) rs864622251
NM_000051.3(ATM):c.6115G>T (p.Glu2039Ter) rs864622251
NM_000051.3(ATM):c.6116A>G (p.Glu2039Gly) rs876659558
NM_000051.3(ATM):c.6118G>C (p.Ala2040Pro) rs863224576
NM_000051.3(ATM):c.6119C>T (p.Ala2040Val) rs1299506506
NM_000051.3(ATM):c.6121A>G (p.Met2041Val) rs759753186
NM_000051.3(ATM):c.6122T>C (p.Met2041Thr) rs1000032847
NM_000051.3(ATM):c.6124T>C (p.Trp2042Arg)
NM_000051.3(ATM):c.6125G>T (p.Trp2042Leu) rs1565499657
NM_000051.3(ATM):c.6127G>A (p.Gly2043Ser) rs767939328
NM_000051.3(ATM):c.6127_6136delinsT (p.Gly2043_Ala2045del) rs1064792941
NM_000051.3(ATM):c.6128G>T (p.Gly2043Val)
NM_000051.3(ATM):c.6133del (p.Ala2045fs) rs1555113762
NM_000051.3(ATM):c.6134C>A (p.Ala2045Asp) rs879254147
NM_000051.3(ATM):c.6135C>T (p.Ala2045=) rs1555113771
NM_000051.3(ATM):c.6136C>G (p.Leu2046Val)
NM_000051.3(ATM):c.6139_6141dup (p.Val2047dup)
NM_000051.3(ATM):c.6140T>G (p.Val2047Gly) rs878853528
NM_000051.3(ATM):c.6141A>G (p.Val2047=) rs978540099
NM_000051.3(ATM):c.6144A>G (p.Thr2048=) rs1201081443
NM_000051.3(ATM):c.6144_6145AT[1] (p.Thr2048_Tyr2049insTer) rs1565499757
NM_000051.3(ATM):c.6145T>G (p.Tyr2049Asp) rs786203767
NM_000051.3(ATM):c.6146A>G (p.Tyr2049Cys)
NM_000051.3(ATM):c.6147T>C (p.Tyr2049=) rs369940136
NM_000051.3(ATM):c.6153C>T (p.Leu2051=) rs876658452
NM_000051.3(ATM):c.6154G>A (p.Glu2052Lys) rs202206540
NM_000051.3(ATM):c.6160G>T (p.Ala2054Ser) rs587779853
NM_000051.3(ATM):c.6163_6165del (p.Ile2055del) rs1565499855
NM_000051.3(ATM):c.6165C>A (p.Ile2055=) rs779848229
NM_000051.3(ATM):c.6176C>T (p.Thr2059Ile) rs144761622
NM_000051.3(ATM):c.6177dup (p.Arg2060fs)
NM_000051.3(ATM):c.6178C>T (p.Arg2060Cys) rs587778078
NM_000051.3(ATM):c.6179G>A (p.Arg2060His) rs376521407
NM_000051.3(ATM):c.6179G>C (p.Arg2060Pro) rs376521407
NM_000051.3(ATM):c.6191T>C (p.Ile2064Thr) rs1555113854
NM_000051.3(ATM):c.6192C>A (p.Ile2064=) rs876659831
NM_000051.3(ATM):c.6194T>C (p.Ile2065Thr) rs372838622
NM_000051.3(ATM):c.6196C>G (p.Gln2066Glu) rs1361215494
NM_000051.3(ATM):c.6197A>G (p.Gln2066Arg) rs1565500074
NM_000051.3(ATM):c.6198+2T>C rs1555113882
NM_000051.3(ATM):c.6198+3A>G rs786202092
NM_000051.3(ATM):c.6198+4C>T rs749370650
NM_000051.3(ATM):c.6198+5A>G rs771047560
NM_000051.3(ATM):c.6199-1G>T
NM_000051.3(ATM):c.6199-2A>T rs1060501570
NM_000051.3(ATM):c.6199-2delA rs1555114545
NM_000051.3(ATM):c.6199-5T>A rs1555114533
NM_000051.3(ATM):c.6199-7T>A rs1060501631
NM_000051.3(ATM):c.6199-9C>A rs1060501611
NM_000051.3(ATM):c.6200C>A (p.Ala2067Asp) rs397514577
NM_000051.3(ATM):c.6205C>G (p.Gln2069Glu) rs1555114563
NM_000051.3(ATM):c.6214G>A (p.Gly2072Arg) rs1555114568
NM_000051.3(ATM):c.6215G>C (p.Gly2072Ala) rs1183544857
NM_000051.3(ATM):c.6217C>G (p.Leu2073Val) rs767406075
NM_000051.3(ATM):c.6217C>T (p.Leu2073Phe) rs767406075
NM_000051.3(ATM):c.6218T>C (p.Leu2073Pro) rs1555114582
NM_000051.3(ATM):c.6222C>A (p.Cys2074Ter) rs1565502708
NM_000051.3(ATM):c.6226A>G (p.Ile2076Val) rs755973863
NM_000051.3(ATM):c.6228del (p.Leu2077fs) rs786203008
NM_000051.3(ATM):c.6229C>G (p.Leu2077Val)
NM_000051.3(ATM):c.6232T>C (p.Ser2078Pro) rs587779854
NM_000051.3(ATM):c.6233C>T (p.Ser2078Phe) rs786204173
NM_000051.3(ATM):c.6234C>T (p.Ser2078=) rs569483748
NM_000051.3(ATM):c.6235G>A (p.Val2079Ile) rs1800060
NM_000051.3(ATM):c.6235_6236insAAG (p.Val2079_Tyr2080insGlu)
NM_000051.3(ATM):c.6239A>G (p.Tyr2080Cys) rs587779855
NM_000051.3(ATM):c.6239_6240del (p.Tyr2080fs) rs878853529
NM_000051.3(ATM):c.6246A>G (p.Lys2082=) rs745977589
NM_000051.3(ATM):c.6246A>T (p.Lys2082Asn)
NM_000051.3(ATM):c.6247G>A (p.Gly2083Arg) rs1060501586
NM_000051.3(ATM):c.6248G>A (p.Gly2083Glu) rs1060501559
NM_000051.3(ATM):c.6253G>C (p.Asp2085His)
NM_000051.3(ATM):c.6255T>A (p.Asp2085Glu) rs376898203
NM_000051.3(ATM):c.6256_6261del (p.Tyr2086_Glu2087del) rs1555114670
NM_000051.3(ATM):c.6257A>G (p.Tyr2086Cys) rs730881380
NM_000051.3(ATM):c.6257A>T (p.Tyr2086Phe) rs730881380
NM_000051.3(ATM):c.6260A>G (p.Glu2087Gly) rs1565503023
NM_000051.3(ATM):c.6267A>C (p.Lys2089Asn) rs863224577
NM_000051.3(ATM):c.6268G>A (p.Asp2090Asn) rs915524411
NM_000051.3(ATM):c.6269A>C (p.Asp2090Ala) rs1555114696
NM_000051.3(ATM):c.6272G>A (p.Trp2091Ter) rs1060501712
NM_000051.3(ATM):c.6277C>T (p.Pro2093Ser) rs946942912
NM_000051.3(ATM):c.6280del (p.Glu2094fs) rs1565503198
NM_000051.3(ATM):c.6287A>G (p.Glu2096Gly) rs1565503246
NM_000051.3(ATM):c.6293T>C (p.Leu2098Pro) rs587780631
NM_000051.3(ATM):c.6293T>G (p.Leu2098Arg)
NM_000051.3(ATM):c.6296A>G (p.His2099Arg) rs587782802
NM_000051.3(ATM):c.6302A>C (p.Gln2101Pro) rs1565503316
NM_000051.3(ATM):c.6311G>A (p.Trp2104Ter)
NM_000051.3(ATM):c.6313A>G (p.Arg2105Gly) rs879253983
NM_000051.3(ATM):c.6315G>C (p.Arg2105Ser) rs587780632
NM_000051.3(ATM):c.6317A>T (p.Asn2106Ile) rs587780633
NM_000051.3(ATM):c.6318T>C (p.Asn2106=) rs864622730
NM_000051.3(ATM):c.6323A>C (p.Gln2108Pro)
NM_000051.3(ATM):c.6323A>G (p.Gln2108Arg) rs773891864
NM_000051.3(ATM):c.6325T>G (p.Trp2109Gly) rs1060501654
NM_000051.3(ATM):c.6330C>T (p.Asp2110=) rs759029705
NM_000051.3(ATM):c.6332A>G (p.His2111Arg) rs876658300
NM_000051.3(ATM):c.6333T>C (p.His2111=) rs55756349
NM_000051.3(ATM):c.6335G>T (p.Cys2112Phe)
NM_000051.3(ATM):c.6336C>T (p.Cys2112=) rs755845798
NM_000051.3(ATM):c.6337A>G (p.Thr2113Ala) rs1555114835
NM_000051.3(ATM):c.6338C>G (p.Thr2113Ser) rs573290117
NM_000051.3(ATM):c.6341C>A (p.Ser2114Tyr)
NM_000051.3(ATM):c.6342C>T (p.Ser2114=) rs754020535
NM_000051.3(ATM):c.6343G>A (p.Val2115Ile) rs587780634
NM_000051.3(ATM):c.6343G>C (p.Val2115Leu) rs587780634
NM_000051.3(ATM):c.6347+1G>A rs1057517120
NM_000051.3(ATM):c.6347+3A>G rs1555114854
NM_000051.3(ATM):c.6347+4A>G rs1342227995
NM_000051.3(ATM):c.6347+6A>C rs750501197
NM_000051.3(ATM):c.6348-1G>A rs1057517302
NM_000051.3(ATM):c.6348-2A>G rs864622367
NM_000051.3(ATM):c.6348-3C>T rs946541820
NM_000051.3(ATM):c.6348-8T>C rs730881292
NM_000051.3(ATM):c.6355G>T (p.Val2119Leu) rs1266938537
NM_000051.3(ATM):c.6357A>G (p.Val2119=) rs1060504295
NM_000051.3(ATM):c.6357A>T (p.Val2119=) rs1060504295
NM_000051.3(ATM):c.6360A>T (p.Glu2120Asp) rs1565508657
NM_000051.3(ATM):c.6365C>G (p.Thr2122Ser) rs1555116369
NM_000051.3(ATM):c.6367A>G (p.Ser2123Gly) rs876659773
NM_000051.3(ATM):c.6368G>C (p.Ser2123Thr)
NM_000051.3(ATM):c.6373C>T (p.His2125Tyr) rs1201879809
NM_000051.3(ATM):c.6373del (p.His2125fs) rs878853530
NM_000051.3(ATM):c.6374A>T (p.His2125Leu) rs730881381
NM_000051.3(ATM):c.6378A>G (p.Glu2126=) rs1060504297
NM_000051.3(ATM):c.6382T>C (p.Leu2128=) rs753646931
NM_000051.3(ATM):c.6384G>C (p.Leu2128Phe) rs1060501629
NM_000051.3(ATM):c.6392C>A (p.Ala2131Asp) rs1060501594
NM_000051.3(ATM):c.6394C>T (p.Leu2132=) rs551408889
NM_000051.3(ATM):c.6396A>G (p.Leu2132=) rs370537345
NM_000051.3(ATM):c.6397C>T (p.Gln2133Ter) rs876658163
NM_000051.3(ATM):c.6399A>G (p.Gln2133=) rs750614487
NM_000051.3(ATM):c.6399del (p.Gln2133fs) rs1555116451
NM_000051.3(ATM):c.6400T>C (p.Ser2134Pro) rs758446561
NM_000051.3(ATM):c.6404T>C (p.Leu2135Pro)
NM_000051.3(ATM):c.6404_6405insTT (p.Leu2135_Arg2136insTer) rs587782554
NM_000051.3(ATM):c.6404dup (p.Arg2136fs) rs587782554
NM_000051.3(ATM):c.6411C>G (p.Asp2137Glu) rs780299607
NM_000051.3(ATM):c.6412A>G (p.Arg2138Gly) rs752069869
NM_000051.3(ATM):c.6413_6414GA[1] (p.Glu2139fs) rs863225466
NM_000051.3(ATM):c.6415G>T (p.Glu2139Ter)
NM_000051.3(ATM):c.6418T>C (p.Phe2140Leu) rs1397647612
NM_000051.3(ATM):c.6419T>G (p.Phe2140Cys) rs1297621371
NM_000051.3(ATM):c.6420C>A (p.Phe2140Leu) rs587780635
NM_000051.3(ATM):c.6424A>G (p.Thr2142Ala) rs1263398076
NM_000051.3(ATM):c.6437G>C (p.Ser2146Thr) rs56815840
NM_000051.3(ATM):c.6443A>C (p.Lys2148Thr)
NM_000051.3(ATM):c.6443A>G (p.Lys2148Arg) rs730881382
NM_000051.3(ATM):c.6444dup (p.Tyr2149fs) rs1555116533
NM_000051.3(ATM):c.6447T>C (p.Tyr2149=) rs1057519167
NM_000051.3(ATM):c.6452+5T>A rs533830556
NM_000051.3(ATM):c.6452+6A>G rs878853531
NM_000051.3(ATM):c.6453-1G>A
NM_000051.3(ATM):c.6453-1G>C rs1555117071
NM_000051.3(ATM):c.6456A>G (p.Val2152=) rs876660014
NM_000051.3(ATM):c.6462A>G (p.Glu2154=) rs756453090
NM_000051.3(ATM):c.6463_6478dup (p.Lys2160delinsSerGlyArgAspValTer) rs1555117084
NM_000051.3(ATM):c.6464T>C (p.Val2155Ala) rs1060501532
NM_000051.3(ATM):c.6465G>A (p.Val2155=) rs140423883
NM_000051.3(ATM):c.6466G>A (p.Glu2156Lys) rs1328099740
NM_000051.3(ATM):c.6473T>C (p.Met2158Thr) rs1453101465
NM_000051.3(ATM):c.6474G>A (p.Met2158Ile) rs1565511084
NM_000051.3(ATM):c.6475T>C (p.Cys2159Arg) rs150408832
NM_000051.3(ATM):c.6475T>G (p.Cys2159Gly) rs150408832
NM_000051.3(ATM):c.6477T>G (p.Cys2159Trp) rs587781789
NM_000051.3(ATM):c.6481C>T (p.Arg2161Cys) rs1064793958
NM_000051.3(ATM):c.6482G>A (p.Arg2161His) rs756626462
NM_000051.3(ATM):c.6486C>A (p.Ser2162Arg)
NM_000051.3(ATM):c.6486C>G (p.Ser2162Arg)
NM_000051.3(ATM):c.6486C>T (p.Ser2162=) rs138166710
NM_000051.3(ATM):c.6487C>G (p.Leu2163Val)
NM_000051.3(ATM):c.6490G>C (p.Glu2164Gln) rs1317619286
NM_000051.3(ATM):c.6491A>T (p.Glu2164Val)
NM_000051.3(ATM):c.6493T>A (p.Ser2165Thr) rs1555117132
NM_000051.3(ATM):c.6496_6497GT[1] (p.Tyr2167fs) rs1060501707
NM_000051.3(ATM):c.6497T>C (p.Val2166Ala) rs1232551114
NM_000051.3(ATM):c.6500A>G (p.Tyr2167Cys) rs768155385
NM_000051.3(ATM):c.6503C>T (p.Ser2168Leu) rs200431631
NM_000051.3(ATM):c.6504G>A (p.Ser2168=) rs786203522
NM_000051.3(ATM):c.6505_6519del (p.Leu2169_Leu2173del) rs1555117162
NM_000051.3(ATM):c.6506T>C (p.Leu2169Pro)
NM_000051.3(ATM):c.6507C>G (p.Leu2169=) rs863224295
NM_000051.3(ATM):c.6509A>G (p.Tyr2170Cys) rs1555117171
NM_000051.3(ATM):c.6517C>G (p.Leu2173Val) rs1565511354
NM_000051.3(ATM):c.6521G>A (p.Ser2174Asn) rs1470293148
NM_000051.3(ATM):c.6522C>A (p.Ser2174Arg) rs772850740
NM_000051.3(ATM):c.6522C>T (p.Ser2174=)
NM_000051.3(ATM):c.6523dup (p.Arg2175fs)
NM_000051.3(ATM):c.6525G>A (p.Arg2175=) rs1555117190
NM_000051.3(ATM):c.6530A>C (p.Gln2177Pro) rs1060501573
NM_000051.3(ATM):c.6536T>C (p.Ile2179Thr) rs878853532
NM_000051.3(ATM):c.6537T>G (p.Ile2179Met) rs146243469
NM_000051.3(ATM):c.6540A>G (p.Gly2180=) rs767516615
NM_000051.3(ATM):c.6543G>T (p.Glu2181Asp) rs138828590
NM_000051.3(ATM):c.6551G>C (p.Ser2184Thr) rs374551964
NM_000051.3(ATM):c.6552C>T (p.Ser2184=) rs565124064
NM_000051.3(ATM):c.6554T>C (p.Ile2185Thr) rs779611511
NM_000051.3(ATM):c.6554T>G (p.Ile2185Ser)
NM_000051.3(ATM):c.6555dup (p.Gly2186fs) rs1565511585
NM_000051.3(ATM):c.6562C>A (p.Leu2188Ile) rs1060501682
NM_000051.3(ATM):c.6571A>G (p.Arg2191Gly) rs587781861
NM_000051.3(ATM):c.6572+4T>C rs587780636
NM_000051.3(ATM):c.6572G>C (p.Arg2191Thr) rs1196814221
NM_000051.3(ATM):c.6573-2A>G rs751168951
NM_000051.3(ATM):c.6573-8G>A rs1555118989
NM_000051.3(ATM):c.6573-9G>A
NM_000051.3(ATM):c.6573A>G (p.Arg2191=) rs1565518004
NM_000051.3(ATM):c.6577G>A (p.Val2193Ile) rs754555043
NM_000051.3(ATM):c.6583C>T (p.His2195Tyr) rs780946471
NM_000051.3(ATM):c.6585_6586del (p.His2195fs) rs1555119004
NM_000051.3(ATM):c.6591A>G (p.Gln2197=) rs863224296
NM_000051.3(ATM):c.6596C>A (p.Ser2199Tyr)
NM_000051.3(ATM):c.6603A>G (p.Val2201=) rs863224297
NM_000051.3(ATM):c.6604T>G (p.Tyr2202Asp) rs730881311
NM_000051.3(ATM):c.6613T>C (p.Trp2205Arg) rs755656958
NM_000051.3(ATM):c.6615G>T (p.Trp2205Cys) rs1555119041
NM_000051.3(ATM):c.6620A>G (p.Lys2207Arg) rs1565518213
NM_000051.3(ATM):c.6622C>T (p.His2208Tyr) rs1060501641
NM_000051.3(ATM):c.6629A>C (p.Gln2210Pro) rs1252127806
NM_000051.3(ATM):c.6631C>T (p.Leu2211Phe) rs1555119051
NM_000051.3(ATM):c.6644G>C (p.Ser2215Thr)
NM_000051.3(ATM):c.6645T>G (p.Ser2215Arg) rs1064794485
NM_000051.3(ATM):c.6650_6657del (p.Phe2217fs) rs864622326
NM_000051.3(ATM):c.6652A>C (p.Ser2218Arg) rs749261367
NM_000051.3(ATM):c.6657del (p.Gln2220fs) rs876658603
NM_000051.3(ATM):c.6658C>T (p.Gln2220Ter) rs1060501536
NM_000051.3(ATM):c.6661G>A (p.Glu2221Lys)
NM_000051.3(ATM):c.6667A>G (p.Ile2223Val)
NM_000051.3(ATM):c.6667del (p.Ile2223fs) rs878853533
NM_000051.3(ATM):c.6670A>C (p.Met2224Leu)
NM_000051.3(ATM):c.6671T>C (p.Met2224Thr) rs730881313
NM_000051.3(ATM):c.6673G>A (p.Ala2225Thr) rs1555119121
NM_000051.3(ATM):c.6677T>C (p.Leu2226Pro) rs1565518489
NM_000051.3(ATM):c.6678A>G (p.Leu2226=) rs772173373
NM_000051.3(ATM):c.6679C>T (p.Arg2227Cys) rs564652222
NM_000051.3(ATM):c.6680G>A (p.Arg2227His) rs879254132
NM_000051.3(ATM):c.6681C>T (p.Arg2227=) rs775850434
NM_000051.3(ATM):c.6681_6682CA[1] (p.Thr2228fs) rs1565518539
NM_000051.3(ATM):c.6686T>A (p.Val2229Asp) rs1555119144
NM_000051.3(ATM):c.6686T>G (p.Val2229Gly) rs1555119144
NM_000051.3(ATM):c.6697A>C (p.Ile2233Leu)
NM_000051.3(ATM):c.6700C>T (p.Leu2234=) rs760602228
NM_000051.3(ATM):c.6701T>A (p.Leu2234Gln) rs1158183992
NM_000051.3(ATM):c.6710A>C (p.Lys2237Thr) rs35118109
NM_000051.3(ATM):c.6718G>C (p.Asp2240His) rs587782478
NM_000051.3(ATM):c.6722A>C (p.Asn2241Thr)
NM_000051.3(ATM):c.6722A>G (p.Asn2241Ser) rs786202583
NM_000051.3(ATM):c.6726A>G (p.Ser2242=) rs878853534
NM_000051.3(ATM):c.6729_6730del (p.Glu2245fs) rs1060501543
NM_000051.3(ATM):c.6739A>G (p.Ile2247Val) rs587781521
NM_000051.3(ATM):c.6741T>G (p.Ile2247Met) rs876658607
NM_000051.3(ATM):c.6742A>G (p.Lys2248Glu) rs1555119232
NM_000051.3(ATM):c.6743A>C (p.Lys2248Thr)
NM_000051.3(ATM):c.6746A>T (p.Asp2249Val)
NM_000051.3(ATM):c.6752_6755dup (p.Lys2253fs) rs863224461
NM_000051.3(ATM):c.6754del (p.Thr2252fs) rs1064793042
NM_000051.3(ATM):c.6757A>C (p.Lys2253Gln) rs863224578
NM_000051.3(ATM):c.6758A>C (p.Lys2253Thr) rs786203332
NM_000051.3(ATM):c.6759A>C (p.Lys2253Asn) rs1060501602
NM_000051.3(ATM):c.6761A>C (p.His2254Pro) rs1565518950
NM_000051.3(ATM):c.6762C>T (p.His2254=) rs563933875
NM_000051.3(ATM):c.6765T>C (p.Leu2255=) rs587780637
NM_000051.3(ATM):c.6766G>A (p.Val2256Ile) rs1565519006
NM_000051.3(ATM):c.6784G>C (p.Ala2262Pro) rs587781674
NM_000051.3(ATM):c.6786_6791del (p.Arg2263_Thr2264del) rs1565519112
NM_000051.3(ATM):c.6794T>G (p.Phe2265Cys) rs1179172483
NM_000051.3(ATM):c.6795C>A (p.Phe2265Leu) rs3218699
NM_000051.3(ATM):c.6795C>G (p.Phe2265Leu) rs3218699
NM_000051.3(ATM):c.6795C>T (p.Phe2265=) rs3218699
NM_000051.3(ATM):c.6797A>G (p.Lys2266Arg)
NM_000051.3(ATM):c.6807+10A>G rs924117395
NM_000051.3(ATM):c.6807+4A>G rs1555119382
NM_000051.3(ATM):c.6807+8delC rs1555119385
NM_000051.3(ATM):c.6807G>A (p.Gln2269=) rs587780638
NM_000051.3(ATM):c.6810C>T (p.Leu2270=) rs1060504305
NM_000051.3(ATM):c.6813T>C (p.Pro2271=) rs1555119714
NM_000051.3(ATM):c.6814G>A (p.Glu2272Lys) rs886039471
NM_000051.3(ATM):c.6814delinsCA (p.Glu2272fs) rs1565520117
NM_000051.3(ATM):c.6815A>C (p.Glu2272Ala)
NM_000051.3(ATM):c.6816A>G (p.Glu2272=) rs1555119726
NM_000051.3(ATM):c.6820G>A (p.Ala2274Thr) rs567060474
NM_000051.3(ATM):c.6823A>C (p.Ile2275Leu) rs587779857
NM_000051.3(ATM):c.6823A>G (p.Ile2275Val) rs587779857
NM_000051.3(ATM):c.6831A>G (p.Gln2277=) rs1339794219
NM_000051.3(ATM):c.6835A>G (p.Lys2279Glu) rs756898113
NM_000051.3(ATM):c.6839A>G (p.Gln2280Arg) rs1555119779
NM_000051.3(ATM):c.6839del (p.Gln2280fs) rs1407907917
NM_000051.3(ATM):c.6843C>G (p.Tyr2281Ter) rs1555119797
NM_000051.3(ATM):c.6843del (p.Gln2280_Tyr2281insTer) rs1565520291
NM_000051.3(ATM):c.6844A>G (p.Asn2282Asp) rs951881516
NM_000051.3(ATM):c.6845A>G (p.Asn2282Ser) rs863224579
NM_000051.3(ATM):c.6848C>T (p.Ser2283Leu) rs876660730
NM_000051.3(ATM):c.6850del (p.Val2284fs) rs876659569
NM_000051.3(ATM):c.6859G>A (p.Gly2287Arg) rs1181779478
NM_000051.3(ATM):c.6860G>A (p.Gly2287Glu) rs1800061
NM_000051.3(ATM):c.6860G>C (p.Gly2287Ala) rs1800061
NM_000051.3(ATM):c.6863T>A (p.Val2288Asp)
NM_000051.3(ATM):c.6867dup (p.Glu2290Ter) rs1555119834
NM_000051.3(ATM):c.6868G>A (p.Glu2290Lys) rs1479339581
NM_000051.3(ATM):c.6870G>A (p.Glu2290=) rs1555119845
NM_000051.3(ATM):c.6888A>T (p.Ala2296=) rs200735689
NM_000051.3(ATM):c.6890A>C (p.Gln2297Pro) rs1565520560
NM_000051.3(ATM):c.6891A>G (p.Gln2297=) rs773545588
NM_000051.3(ATM):c.6893T>C (p.Val2298Ala) rs1565520607
NM_000051.3(ATM):c.6895T>C (p.Phe2299Leu) rs1555119886
NM_000051.3(ATM):c.6897C>G (p.Phe2299Leu) rs777164914
NM_000051.3(ATM):c.6897C>T (p.Phe2299=) rs777164914
NM_000051.3(ATM):c.6898T>G (p.Trp2300Gly) rs1565520641
NM_000051.3(ATM):c.6900G>C (p.Trp2300Cys)
NM_000051.3(ATM):c.6901G>A (p.Ala2301Thr) rs1060501668
NM_000051.3(ATM):c.6901G>C (p.Ala2301Pro) rs1060501668
NM_000051.3(ATM):c.6908A>T (p.Lys2303Met) rs1064795166
NM_000051.3(ATM):c.6908dup (p.Glu2304fs) rs773570504
NM_000051.3(ATM):c.6910del (p.Glu2304fs) rs1555119940
NM_000051.3(ATM):c.6914_6915AG[1] (p.Leu2307fs) rs878853535
NM_000051.3(ATM):c.6919C>T (p.Leu2307Phe) rs56009889
NM_000051.3(ATM):c.6922G>T (p.Ala2308Ser)
NM_000051.3(ATM):c.6923C>T (p.Ala2308Val) rs876658454
NM_000051.3(ATM):c.6924C>A (p.Ala2308=) rs759878732
NM_000051.3(ATM):c.6925C>T (p.Leu2309=) rs763839047
NM_000051.3(ATM):c.6927G>T (p.Leu2309=) rs876660429
NM_000051.3(ATM):c.6929G>A (p.Ser2310Asn) rs1381019767
NM_000051.3(ATM):c.6931A>G (p.Ile2311Val)
NM_000051.3(ATM):c.6935T>C (p.Leu2312Pro)
NM_000051.3(ATM):c.6936C>T (p.Leu2312=) rs1555119992
NM_000051.3(ATM):c.6942A>C (p.Gln2314His) rs764859160
NM_000051.3(ATM):c.6944T>C (p.Met2315Thr) rs1555120006
NM_000051.3(ATM):c.6945G>A (p.Met2315Ile) rs1555120014
NM_000051.3(ATM):c.6950A>C (p.Lys2317Thr) rs750285816
NM_000051.3(ATM):c.6952A>C (p.Lys2318Gln) rs1449259481
NM_000051.3(ATM):c.6952A>G (p.Lys2318Glu) rs1449259481
NM_000051.3(ATM):c.6956T>G (p.Leu2319Trp) rs1555120049
NM_000051.3(ATM):c.6958G>T (p.Asp2320Tyr) rs1565521026
NM_000051.3(ATM):c.6959A>G (p.Asp2320Gly) rs1060501640
NM_000051.3(ATM):c.6961G>C (p.Ala2321Pro) rs1060501538
NM_000051.3(ATM):c.6966C>T (p.Ser2322=) rs864622593
NM_000051.3(ATM):c.6968G>A (p.Cys2323Tyr) rs876660924
NM_000051.3(ATM):c.6974C>T (p.Ala2325Val) rs200940211
NM_000051.3(ATM):c.6975+13delT rs763287238
NM_000051.3(ATM):c.6975+13dupT rs763287238
NM_000051.3(ATM):c.6975+1G>T rs1565521129
NM_000051.3(ATM):c.6975+4T>G
NM_000051.3(ATM):c.6975+5G>T rs575354684
NM_000051.3(ATM):c.6975+5_6975+8delGTTT rs1565521135
NM_000051.3(ATM):c.6975+6T>C rs1169579742
NM_000051.3(ATM):c.6975+7T>A rs754834282
NM_000051.3(ATM):c.6975G>A (p.Ala2325=) rs556778314
NM_000051.3(ATM):c.6975G>C (p.Ala2325=) rs556778314
NM_000051.3(ATM):c.6975G>T (p.Ala2325=) rs556778314
NM_000051.3(ATM):c.6976-10_6989delTCTTATACAGAACAATCCCAGCCT rs587779859
NM_000051.3(ATM):c.6976-1G>A
NM_000051.3(ATM):c.6976-1G>T
NM_000051.3(ATM):c.6976-2A>C rs587782403
NM_000051.3(ATM):c.6976-3_6976-2insT rs1060501533
NM_000051.3(ATM):c.6976-6dupA rs760058702
NM_000051.3(ATM):c.6982C>G (p.Pro2328Ala)
NM_000051.3(ATM):c.6983C>T (p.Pro2328Leu) rs786202730
NM_000051.3(ATM):c.6988C>G (p.Leu2330Val) rs148432863
NM_000051.3(ATM):c.6995T>C (p.Leu2332Pro) rs4988111
NM_000051.3(ATM):c.6995T>G (p.Leu2332Arg) rs4988111
NM_000051.3(ATM):c.6996_6999TACA[1] (p.Tyr2334fs) rs786203421
NM_000051.3(ATM):c.6997dup (p.Thr2333fs) rs587781299
NM_000051.3(ATM):c.6998C>A (p.Thr2333Lys) rs150503164
NM_000051.3(ATM):c.6998C>T (p.Thr2333Ile) rs150503164
NM_000051.3(ATM):c.6999A>G (p.Thr2333=) rs759267807
NM_000051.3(ATM):c.7001A>G (p.Tyr2334Cys) rs879254258
NM_000051.3(ATM):c.7004C>T (p.Thr2335Ile) rs3092831
NM_000051.3(ATM):c.7005A>G (p.Thr2335=) rs1555120978
NM_000051.3(ATM):c.7010G>A (p.Cys2337Tyr) rs876658563
NM_000051.3(ATM):c.7010_7011del (p.Cys2337fs) rs864622416
NM_000051.3(ATM):c.7011T>C (p.Cys2337=) rs878853536
NM_000051.3(ATM):c.7011T>G (p.Cys2337Trp) rs878853536
NM_000051.3(ATM):c.7012C>T (p.Leu2338=) rs1555120990
NM_000051.3(ATM):c.7016G>A (p.Arg2339Lys) rs1305313302
NM_000051.3(ATM):c.7023T>C (p.Cys2341=) rs878853537
NM_000051.3(ATM):c.7024G>A (p.Gly2342Ser) rs1555121015
NM_000051.3(ATM):c.7032G>A (p.Trp2344Ter) rs1131691162
NM_000051.3(ATM):c.7036G>A (p.Ala2346Thr) rs144497088
NM_000051.3(ATM):c.7038A>T (p.Ala2346=) rs146167034
NM_000051.3(ATM):c.7043C>T (p.Thr2348Met)
NM_000051.3(ATM):c.7044G>A (p.Thr2348=) rs140104789
NM_000051.3(ATM):c.7052A>G (p.Glu2351Gly)
NM_000051.3(ATM):c.7061C>T (p.Ala2354Val) rs1555121079
NM_000051.3(ATM):c.7062G>A (p.Ala2354=) rs143489373
NM_000051.3(ATM):c.7062G>C (p.Ala2354=) rs143489373
NM_000051.3(ATM):c.7066A>G (p.Ile2356Val) rs876658517
NM_000051.3(ATM):c.7070_7072dup (p.Gln2358_Thr2359insLeu)
NM_000051.3(ATM):c.7071G>T (p.Met2357Ile) rs753951063
NM_000051.3(ATM):c.7074G>T (p.Gln2358His) rs1060501593
NM_000051.3(ATM):c.7076C>A (p.Thr2359Asn)
NM_000051.3(ATM):c.7077C>T (p.Thr2359=) rs1555121132
NM_000051.3(ATM):c.7080T>G (p.Tyr2360Ter) rs1555121147
NM_000051.3(ATM):c.7081C>A (p.Leu2361Ile) rs1412288141
NM_000051.3(ATM):c.7089+3A>G rs1565524203
NM_000051.3(ATM):c.7091C>T (p.Ala2364Val) rs1555121919
NM_000051.3(ATM):c.7091del (p.Ala2364fs) rs878853538
NM_000051.3(ATM):c.7093G>A (p.Val2365Ile)
NM_000051.3(ATM):c.7096G>A (p.Glu2366Lys) rs587781672
NM_000051.3(ATM):c.7096G>T (p.Glu2366Ter) rs587781672
NM_000051.3(ATM):c.7099G>A (p.Val2367Ile) rs1060501647
NM_000051.3(ATM):c.7108A>G (p.Asn2370Asp) rs767494363
NM_000051.3(ATM):c.7111T>G (p.Tyr2371Asp) rs1555121956
NM_000051.3(ATM):c.7113T>C (p.Tyr2371=) rs760534895
NM_000051.3(ATM):c.7116T>C (p.Asp2372=) rs3218675
NM_000051.3(ATM):c.7121A>C (p.Glu2374Ala) rs587782225
NM_000051.3(ATM):c.7122A>C (p.Glu2374Asp) rs376159946
NM_000051.3(ATM):c.7125T>C (p.Ser2375=) rs878853539
NM_000051.3(ATM):c.7129G>T (p.Asp2377Tyr) rs1555122008
NM_000051.3(ATM):c.7131T>C (p.Asp2377=) rs373309822
NM_000051.3(ATM):c.7135C>G (p.Leu2379Val) rs778888033
NM_000051.3(ATM):c.7140A>G (p.Arg2380=) rs750569023
NM_000051.3(ATM):c.7145G>C (p.Gly2382Ala) rs1060501639
NM_000051.3(ATM):c.7155G>A (p.Lys2385=) rs878853540
NM_000051.3(ATM):c.7156G>C (p.Ala2386Pro) rs876659392
NM_000051.3(ATM):c.7157C>A (p.Ala2386Glu) rs786203697
NM_000051.3(ATM):c.7157C>G (p.Ala2386Gly) rs786203697
NM_000051.3(ATM):c.7159_7160insAGCC (p.Phe2387Ter)
NM_000051.3(ATM):c.7164C>A (p.Leu2388=) rs1239532344
NM_000051.3(ATM):c.7166C>T (p.Ser2389Leu) rs1018140779
NM_000051.3(ATM):c.7174C>T (p.Arg2392Trp) rs149827260
NM_000051.3(ATM):c.7175G>T (p.Arg2392Leu)
NM_000051.3(ATM):c.7178T>G (p.Phe2393Cys) rs1555122073
NM_000051.3(ATM):c.7179T>G (p.Phe2393Leu) rs1057520430
NM_000051.3(ATM):c.7181C>T (p.Ser2394Leu) rs587779861
NM_000051.3(ATM):c.7184A>T (p.Asp2395Val) rs1555122090
NM_000051.3(ATM):c.7186del (p.Thr2396fs) rs1555122092
NM_000051.3(ATM):c.7187C>G (p.Thr2396Ser) rs370559102
NM_000051.3(ATM):c.7189C>G (p.Gln2397Glu) rs747372355
NM_000051.3(ATM):c.7189C>T (p.Gln2397Ter) rs747372355
NM_000051.3(ATM):c.7190A>G (p.Gln2397Arg) rs1060501592
NM_000051.3(ATM):c.7194C>A (p.Tyr2398Ter)
NM_000051.3(ATM):c.7196A>G (p.Gln2399Arg) rs1565526758
NM_000051.3(ATM):c.7198A>C (p.Arg2400=) rs777423778
NM_000051.3(ATM):c.7200A>G (p.Arg2400=) rs1060501534
NM_000051.3(ATM):c.7201A>G (p.Ile2401Val) rs1565526813
NM_000051.3(ATM):c.7202T>C (p.Ile2401Thr) rs1555122117
NM_000051.3(ATM):c.7209C>T (p.Asn2403=) rs373662499
NM_000051.3(ATM):c.7211A>G (p.Tyr2404Cys) rs1064794093
NM_000051.3(ATM):c.7213A>C (p.Met2405Leu)
NM_000051.3(ATM):c.7213A>G (p.Met2405Val) rs587781323
NM_000051.3(ATM):c.7220C>A (p.Ser2407Ter) rs1555122149
NM_000051.3(ATM):c.7221A>G (p.Ser2407=) rs786201881
NM_000051.3(ATM):c.7223C>T (p.Ser2408Leu) rs730881315
NM_000051.3(ATM):c.7224G>A (p.Ser2408=) rs145747513
NM_000051.3(ATM):c.7229T>A (p.Phe2410Tyr) rs758351633
NM_000051.3(ATM):c.7229T>C (p.Phe2410Ser) rs758351633
NM_000051.3(ATM):c.7230T>G (p.Phe2410Leu) rs1565527030
NM_000051.3(ATM):c.7235A>C (p.Asn2412Thr) rs786203311
NM_000051.3(ATM):c.7235A>G (p.Asn2412Ser) rs786203311
NM_000051.3(ATM):c.7239G>A (p.Lys2413=) rs1555122182
NM_000051.3(ATM):c.7240C>T (p.Gln2414Ter) rs863224462
NM_000051.3(ATM):c.7244C>G (p.Ala2415Gly) rs370567994
NM_000051.3(ATM):c.7246C>T (p.Leu2416Phe) rs1060501615
NM_000051.3(ATM):c.7261_7262insT (p.Lys2421fs)
NM_000051.3(ATM):c.7262A>C (p.Lys2421Thr) rs1360453074
NM_000051.3(ATM):c.7262A>T (p.Lys2421Ile)
NM_000051.3(ATM):c.7264G>A (p.Glu2422Lys) rs1163371592
NM_000051.3(ATM):c.7265A>G (p.Glu2422Gly) rs758614348
NM_000051.3(ATM):c.7266G>A (p.Glu2422=) rs876659834
NM_000051.3(ATM):c.7267G>A (p.Glu2423Lys) rs1555122245
NM_000051.3(ATM):c.7267_7270delinsTAC (p.Glu2423fs)
NM_000051.3(ATM):c.7269A>T (p.Glu2423Asp) rs864622471
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7274del (p.Gly2425fs) rs1565527283
NM_000051.3(ATM):c.7277T>C (p.Leu2426Pro)
NM_000051.3(ATM):c.7282A>G (p.Arg2428Gly) rs1555122281
NM_000051.3(ATM):c.7289A>G (p.His2430Arg) rs786202856
NM_000051.3(ATM):c.7291A>G (p.Lys2431Glu) rs864622563
NM_000051.3(ATM):c.7293_7294del (p.Lys2431fs) rs1060501525
NM_000051.3(ATM):c.7294A>T (p.Ile2432Phe) rs587781838
NM_000051.3(ATM):c.7299G>A (p.Gln2433=) rs1057520451
NM_000051.3(ATM):c.7299_7302del (p.Asn2435fs) rs886039628
NM_000051.3(ATM):c.7303A>G (p.Asn2435Asp) rs1555122326
NM_000051.3(ATM):c.7305C>G (p.Asn2435Lys) rs1160508407
NM_000051.3(ATM):c.7307+3A>C rs1565527512
NM_000051.3(ATM):c.7307+3_7307+4insGTTC rs587782288
NM_000051.3(ATM):c.7307+4A>T
NM_000051.3(ATM):c.7307G>A (p.Arg2436Lys) rs786203394
NM_000051.3(ATM):c.7308-10T>C rs745319720
NM_000051.3(ATM):c.7308-10T>G rs745319720
NM_000051.3(ATM):c.7308-2A>C rs1555122938
NM_000051.3(ATM):c.7308-6T>C rs574836628
NM_000051.3(ATM):c.7308-9C>T rs878853541
NM_000051.3(ATM):c.7308A>C (p.Arg2436Ser) rs730881317
NM_000051.3(ATM):c.7309T>C (p.Tyr2437His) rs1565529213
NM_000051.3(ATM):c.7310A>G (p.Tyr2437Cys) rs1555122944
NM_000051.3(ATM):c.7311C>A (p.Tyr2437Ter) rs763470424
NM_000051.3(ATM):c.7312A>C (p.Thr2438Pro) rs1565529248
NM_000051.3(ATM):c.7313C>G (p.Thr2438Arg) rs147604227
NM_000051.3(ATM):c.7313C>T (p.Thr2438Ile) rs147604227
NM_000051.3(ATM):c.7314A>C (p.Thr2438=) rs199909913
NM_000051.3(ATM):c.7315G>C (p.Val2439Leu)
NM_000051.3(ATM):c.7316T>C (p.Val2439Ala) rs776266049
NM_000051.3(ATM):c.7317A>G (p.Val2439=) rs878853542
NM_000051.3(ATM):c.7321G>T (p.Val2441Phe) rs876659556
NM_000051.3(ATM):c.7326G>T (p.Gln2442His) rs1555122970
NM_000051.3(ATM):c.7327C>G (p.Arg2443Gly)
NM_000051.3(ATM):c.7327C>T (p.Arg2443Ter) rs121434220
NM_000051.3(ATM):c.7328G>A (p.Arg2443Gln) rs587782310
NM_000051.3(ATM):c.7334T>A (p.Leu2445Gln) rs1555122992
NM_000051.3(ATM):c.7336G>A (p.Glu2446Lys) rs730881318
NM_000051.3(ATM):c.7339T>G (p.Leu2447Val)
NM_000051.3(ATM):c.7346A>C (p.Glu2449Ala) rs1555123004
NM_000051.3(ATM):c.7351G>C (p.Ala2451Pro) rs587779862
NM_000051.3(ATM):c.7351G>T (p.Ala2451Ser) rs587779862
NM_000051.3(ATM):c.7354C>G (p.Leu2452Val) rs587779863
NM_000051.3(ATM):c.7357C>T (p.Arg2453Cys) rs755418571
NM_000051.3(ATM):c.7358G>A (p.Arg2453His) rs587781361
NM_000051.3(ATM):c.7359T>G (p.Arg2453=) rs786201541
NM_000051.3(ATM):c.7364T>G (p.Leu2455Arg) rs1555123056
NM_000051.3(ATM):c.7370A>C (p.Glu2457Ala) rs778482902
NM_000051.3(ATM):c.7371G>A (p.Glu2457=) rs1454725863
NM_000051.3(ATM):c.7373A>T (p.Asp2458Val) rs879254201
NM_000051.3(ATM):c.7375C>G (p.Arg2459Gly) rs730881383
NM_000051.3(ATM):c.7375C>T (p.Arg2459Cys) rs730881383
NM_000051.3(ATM):c.7381C>T (p.Arg2461Cys) rs201314561
NM_000051.3(ATM):c.7382G>A (p.Arg2461His) rs768461085
NM_000051.3(ATM):c.7382G>C (p.Arg2461Pro) rs768461085
NM_000051.3(ATM):c.7384T>C (p.Phe2462Leu) rs878853543
NM_000051.3(ATM):c.7390T>C (p.Cys2464Arg) rs55801750
NM_000051.3(ATM):c.7399G>A (p.Val2467Ile) rs769722643
NM_000051.3(ATM):c.7400T>C (p.Val2467Ala)
NM_000051.3(ATM):c.7408T>G (p.Tyr2470Asp) rs876659365
NM_000051.3(ATM):c.7409A>G (p.Tyr2470Cys) rs878853544
NM_000051.3(ATM):c.7412T>G (p.Ile2471Ser)
NM_000051.3(ATM):c.7415A>G (p.Asn2472Ser) rs1565529851
NM_000051.3(ATM):c.7420T>C (p.Leu2474=) rs1555123149
NM_000051.3(ATM):c.7424T>C (p.Leu2475Ser) rs1224883896
NM_000051.3(ATM):c.7427G>A (p.Ser2476Asn)
NM_000051.3(ATM):c.7434A>G (p.Glu2478=) rs1555123171
NM_000051.3(ATM):c.7435G>C (p.Glu2479Gln) rs1060501583
NM_000051.3(ATM):c.7444A>G (p.Met2482Val) rs951373716
NM_000051.3(ATM):c.7445T>C (p.Met2482Thr) rs1555123191
NM_000051.3(ATM):c.7456C>T (p.Arg2486Ter) rs587779865
NM_000051.3(ATM):c.7457G>A (p.Arg2486Gln) rs773944604
NM_000051.3(ATM):c.7462T>C (p.Cys2488Arg) rs1555123216
NM_000051.3(ATM):c.7463G>A (p.Cys2488Tyr) rs774281788
NM_000051.3(ATM):c.7463G>T (p.Cys2488Phe)
NM_000051.3(ATM):c.7468C>T (p.Leu2490Phe) rs753262623
NM_000051.3(ATM):c.7473G>T (p.Trp2491Cys) rs1555123257
NM_000051.3(ATM):c.7474C>T (p.Leu2492Phe) rs1555123259
NM_000051.3(ATM):c.7475T>G (p.Leu2492Arg) rs56399857
NM_000051.3(ATM):c.7484C>T (p.Ser2495Phe) rs1449747119
NM_000051.3(ATM):c.7486G>C (p.Gly2496Arg) rs1565530187
NM_000051.3(ATM):c.7492T>G (p.Ser2498Ala) rs754245181
NM_000051.3(ATM):c.7494T>C (p.Ser2498=) rs34393781
NM_000051.3(ATM):c.7499_7502delinsCCAG (p.Val2500_Asn2501delinsAlaSer) rs1555123310
NM_000051.3(ATM):c.7500C>T (p.Val2500=) rs1060504286
NM_000051.3(ATM):c.7502A>G (p.Asn2501Ser) rs531617441
NM_000051.3(ATM):c.7507A>G (p.Met2503Val) rs780931855
NM_000051.3(ATM):c.7509G>A (p.Met2503Ile) rs1266101531
NM_000051.3(ATM):c.7510dup (p.Met2504fs)
NM_000051.3(ATM):c.7511T>C (p.Met2504Thr) rs1060501644
NM_000051.3(ATM):c.7515+4A>G rs1565530434
NM_000051.3(ATM):c.7515+5G>A rs1555123361
NM_000051.3(ATM):c.7516A>G (p.Arg2506Gly) rs200441272
NM_000051.3(ATM):c.7517G>A (p.Arg2506Lys) rs1555123920
NM_000051.3(ATM):c.7517_7520delGAGA rs587781905
NM_000051.3(ATM):c.7521C>T (p.Asp2507=) rs751234924
NM_000051.3(ATM):c.7522G>A (p.Gly2508Arg) rs754395517
NM_000051.3(ATM):c.7527G>A (p.Met2509Ile) rs1060501579
NM_000051.3(ATM):c.7531A>T (p.Ile2511Phe) rs146069748
NM_000051.3(ATM):c.7534C>A (p.Pro2512Thr) rs1565532052
NM_000051.3(ATM):c.7535C>T (p.Pro2512Leu) rs1237858258
NM_000051.3(ATM):c.7540T>C (p.Tyr2514His) rs1555123985
NM_000051.3(ATM):c.7540_7541TA[1] (p.Tyr2514_Lys2515delinsTer) rs1555123981
NM_000051.3(ATM):c.7541A>G (p.Tyr2514Cys) rs1555123994
NM_000051.3(ATM):c.7542T>C (p.Tyr2514=) rs777925486
NM_000051.3(ATM):c.7543A>G (p.Lys2515Glu) rs1555124004
NM_000051.3(ATM):c.7545A>G (p.Lys2515=) rs1467809725
NM_000051.3(ATM):c.7547T>G (p.Phe2516Cys) rs774312539
NM_000051.3(ATM):c.7549_7562delinsATG (p.Leu2517fs)
NM_000051.3(ATM):c.7552C>T (p.Pro2518Ser) rs374876799
NM_000051.3(ATM):c.7553C>A (p.Pro2518His)
NM_000051.3(ATM):c.7553C>T (p.Pro2518Leu) rs879254136
NM_000051.3(ATM):c.7555C>G (p.Leu2519Val) rs1555124019
NM_000051.3(ATM):c.7557T>C (p.Leu2519=) rs1060504266
NM_000051.3(ATM):c.7559T>G (p.Met2520Arg) rs587782692
NM_000051.3(ATM):c.7563C>G (p.Tyr2521Ter) rs772228129
NM_000051.3(ATM):c.7564C>G (p.Gln2522Glu)
NM_000051.3(ATM):c.7565A>G (p.Gln2522Arg) rs1555124039
NM_000051.3(ATM):c.7566A>G (p.Gln2522=) rs775621333
NM_000051.3(ATM):c.7566A>T (p.Gln2522His) rs775621333
NM_000051.3(ATM):c.7570G>C (p.Ala2524Pro) rs769142993
NM_000051.3(ATM):c.7570G>T (p.Ala2524Ser)
NM_000051.3(ATM):c.7577G>C (p.Arg2526Thr) rs876659323
NM_000051.3(ATM):c.7592T>C (p.Met2531Thr) rs587781365
NM_000051.3(ATM):c.7593G>A (p.Met2531Ile) rs786203764
NM_000051.3(ATM):c.7598G>A (p.Gly2533Glu) rs864622688
NM_000051.3(ATM):c.7602C>T (p.Gly2534=) rs562264493
NM_000051.3(ATM):c.7608del (p.His2538fs) rs1565532554
NM_000051.3(ATM):c.7617A>C (p.Glu2539Asp)
NM_000051.3(ATM):c.7618G>A (p.Val2540Ile) rs35203200
NM_000051.3(ATM):c.7620C>A (p.Val2540=) rs863224298
NM_000051.3(ATM):c.7620C>T (p.Val2540=) rs863224298
NM_000051.3(ATM):c.7621C>T (p.Leu2541Phe) rs1565532615
NM_000051.3(ATM):c.7626T>A (p.Asn2542Lys) rs1555124134
NM_000051.3(ATM):c.7629+1G>A rs1565532703
NM_000051.3(ATM):c.7629+2T>C rs786203059
NM_000051.3(ATM):c.7629+3A>C rs752251778
NM_000051.3(ATM):c.7629T>C (p.Asn2543=) rs767123895
NM_000051.3(ATM):c.7629_7629+4del rs876660041
NM_000051.3(ATM):c.7630-2A>C rs587779866
NM_000051.3(ATM):c.7630-2A>G rs587779866
NM_000051.3(ATM):c.7630-3C>G rs587782448
NM_000051.3(ATM):c.7630-3C>T rs587782448
NM_000051.3(ATM):c.7630-7C>T rs730881276
NM_000051.3(ATM):c.7631T>C (p.Leu2544Pro) rs1555124459
NM_000051.3(ATM):c.7631del (p.Leu2544fs)
NM_000051.3(ATM):c.7638_7646del (p.Arg2547_Ser2549del) rs587776547
NM_000051.3(ATM):c.7639A>G (p.Arg2547Gly) rs1565533544
NM_000051.3(ATM):c.7648A>C (p.Met2550Leu) rs878853545
NM_000051.3(ATM):c.7648A>G (p.Met2550Val) rs878853545
NM_000051.3(ATM):c.7650G>T (p.Met2550Ile) rs1565533594
NM_000051.3(ATM):c.7652A>G (p.Asp2551Gly) rs1565533613
NM_000051.3(ATM):c.7654C>A (p.His2552Asn) rs786202174
NM_000051.3(ATM):c.7655_7656insGA (p.His2552fs) rs1565533629
NM_000051.3(ATM):c.7656C>A (p.His2552Gln) rs1555124473
NM_000051.3(ATM):c.7657C>A (p.Pro2553Thr) rs1555124475
NM_000051.3(ATM):c.7658C>A (p.Pro2553His) rs864622368
NM_000051.3(ATM):c.7658C>T (p.Pro2553Leu) rs864622368
NM_000051.3(ATM):c.7660C>T (p.His2554Tyr) rs1555124482
NM_000051.3(ATM):c.7661A>T (p.His2554Leu) rs1555124487
NM_000051.3(ATM):c.7665delinsGTGA (p.His2555delinsGlnTer) rs1555124503
NM_000051.3(ATM):c.7669_7670del (p.Leu2557fs) rs1565533778
NM_000051.3(ATM):c.7671_7674del (p.Phe2558fs) rs1555124506
NM_000051.3(ATM):c.7681C>T (p.Leu2561=) rs1060504314
NM_000051.3(ATM):c.7684G>T (p.Ala2562Ser)
NM_000051.3(ATM):c.7687T>G (p.Leu2563Val) rs1208002418
NM_000051.3(ATM):c.7690G>A (p.Ala2564Thr) rs940285361
NM_000051.3(ATM):c.7693A>G (p.Asn2565Asp) rs1555124543
NM_000051.3(ATM):c.7696G>A (p.Ala2566Thr) rs1060501604
NM_000051.3(ATM):c.7699_7702del (p.Asn2567fs) rs1060501547
NM_000051.3(ATM):c.7703G>A (p.Arg2568Lys)
NM_000051.3(ATM):c.7703_7704GA[1] (p.Arg2568_Asp2569insTer) rs759965045
NM_000051.3(ATM):c.7710A>G (p.Glu2570=) rs760215505
NM_000051.3(ATM):c.7712T>C (p.Phe2571Ser) rs1555124612
NM_000051.3(ATM):c.7716G>C (p.Leu2572=) rs763730344
NM_000051.3(ATM):c.7720A>C (p.Lys2574Gln) rs1357229307
NM_000051.3(ATM):c.7736G>C (p.Arg2579Thr) rs879254206
NM_000051.3(ATM):c.7740A>C (p.Arg2580Ser) rs199915459
NM_000051.3(ATM):c.7744A>G (p.Arg2582Gly) rs750224234
NM_000051.3(ATM):c.7757A>G (p.Asn2586Ser) rs587778079
NM_000051.3(ATM):c.7764dup (p.Lys2589Ter)
NM_000051.3(ATM):c.7766A>G (p.Lys2589Arg) rs878853546
NM_000051.3(ATM):c.7767del (p.Lys2589fs) rs1057517025
NM_000051.3(ATM):c.7768C>T (p.Gln2590Ter)
NM_000051.3(ATM):c.7770A>G (p.Gln2590=) rs864622437
NM_000051.3(ATM):c.7772G>A (p.Ser2591Asn) rs730881319
NM_000051.3(ATM):c.7775C>G (p.Ser2592Cys) rs755009196
NM_000051.3(ATM):c.7777C>T (p.Gln2593Ter) rs781215442
NM_000051.3(ATM):c.7778A>G (p.Gln2593Arg) rs587779867
NM_000051.3(ATM):c.7779G>A (p.Gln2593=) rs770321620
NM_000051.3(ATM):c.7785T>C (p.Asp2595=) rs34838175
NM_000051.3(ATM):c.7786G>A (p.Glu2596Lys) rs1555124747
NM_000051.3(ATM):c.7788+1G>T rs1565534524
NM_000051.3(ATM):c.7788+7G>A rs749610251
NM_000051.3(ATM):c.7788+8G>T rs112775908
NM_000051.3(ATM):c.7788G>A (p.Glu2596=) rs587780639
NM_000051.3(ATM):c.7788G>T (p.Glu2596Asp) rs587780639
NM_000051.3(ATM):c.7789-3T>G rs864622185
NM_000051.3(ATM):c.7792C>T (p.Arg2598Ter) rs138941496
NM_000051.3(ATM):c.7792del (p.Arg2598fs)
NM_000051.3(ATM):c.7793G>A (p.Arg2598Gln) rs140263969
NM_000051.3(ATM):c.7808A>G (p.Asn2603Ser) rs150355232
NM_000051.3(ATM):c.7816A>G (p.Ile2606Val) rs376824528
NM_000051.3(ATM):c.7818A>G (p.Ile2606Met) rs1027959208
NM_000051.3(ATM):c.7819T>C (p.Cys2607Arg) rs1459650575
NM_000051.3(ATM):c.7825A>G (p.Ile2609Val) rs779400418
NM_000051.3(ATM):c.7826T>C (p.Ile2609Thr) rs369846067
NM_000051.3(ATM):c.7827C>T (p.Ile2609=) rs768423205
NM_000051.3(ATM):c.7835G>A (p.Arg2612Lys) rs138048269
NM_000051.3(ATM):c.7836G>A (p.Arg2612=) rs761324887
NM_000051.3(ATM):c.7836_7837GA[3] (p.Pro2614fs) rs730881293
NM_000051.3(ATM):c.7843C>G (p.Gln2615Glu)
NM_000051.3(ATM):c.7846A>G (p.Met2616Val) rs876658208
NM_000051.3(ATM):c.7852A>G (p.Arg2618Gly) rs1057521185
NM_000051.3(ATM):c.7854A>C (p.Arg2618Ser) rs1565536250
NM_000051.3(ATM):c.7865C>G (p.Ala2622Gly) rs766351395
NM_000051.3(ATM):c.7867C>G (p.Leu2623Val)
NM_000051.3(ATM):c.7871G>C (p.Cys2624Ser)
NM_000051.3(ATM):c.7875_7876delTGinsGC (p.Asp2625_Ala2626delinsGluPro) rs267606668
NM_000051.3(ATM):c.7880A>G (p.Tyr2627Cys) rs767670019
NM_000051.3(ATM):c.7880del (p.Tyr2627fs) rs1057516599
NM_000051.3(ATM):c.7881_7885TATTA[1] (p.Ile2629fs) rs1450394308
NM_000051.3(ATM):c.7882A>C (p.Ile2628Leu)
NM_000051.3(ATM):c.7888T>G (p.Leu2630Val) rs1555125427
NM_000051.3(ATM):c.7889T>A (p.Leu2630Ter)
NM_000051.3(ATM):c.7890A>G (p.Leu2630=) rs756181210
NM_000051.3(ATM):c.7897T>G (p.Leu2633Val) rs587779868
NM_000051.3(ATM):c.7901A>T (p.Asp2634Val) rs876660909
NM_000051.3(ATM):c.7902T>G (p.Asp2634Glu) rs373147078
NM_000051.3(ATM):c.7904C>G (p.Ala2635Gly) rs754002355
NM_000051.3(ATM):c.7905C>T (p.Ala2635=) rs757829783
NM_000051.3(ATM):c.7912T>G (p.Trp2638Gly) rs563137460
NM_000051.3(ATM):c.7913G>A (p.Trp2638Ter) rs377349459
NM_000051.3(ATM):c.7914G>T (p.Trp2638Cys) rs758843096
NM_000051.3(ATM):c.7917G>A (p.Lys2639=) rs1555125501
NM_000051.3(ATM):c.7919C>T (p.Thr2640Ile) rs4988125
NM_000051.3(ATM):c.7921C>T (p.Gln2641Ter) rs769523686
NM_000051.3(ATM):c.7926A>C (p.Arg2642Ser) rs863224440
NM_000051.3(ATM):c.7927+10T>C rs730881277
NM_000051.3(ATM):c.7927+13dup rs587781324
NM_000051.3(ATM):c.7927+1G>C rs1555125532
NM_000051.3(ATM):c.7927+5G>A rs1299306446
NM_000051.3(ATM):c.7927+5delG rs786204437
NM_000051.3(ATM):c.7927+6T>G
NM_000051.3(ATM):c.7928-10T>C rs188404773
NM_000051.3(ATM):c.7928-10T>G rs188404773
NM_000051.3(ATM):c.7928-1G>A rs1555126163
NM_000051.3(ATM):c.7928-2A>T rs864622610
NM_000051.3(ATM):c.7928-9T>C rs1060504261
NM_000051.3(ATM):c.7929A>T (p.Lys2643Asn) rs780247224
NM_000051.3(ATM):c.7936A>C (p.Asn2646His) rs1060501575
NM_000051.3(ATM):c.7942C>A (p.Pro2648Thr) rs878853547
NM_000051.3(ATM):c.7942C>G (p.Pro2648Ala) rs878853547
NM_000051.3(ATM):c.7947A>C (p.Ala2649=) rs1060504301
NM_000051.3(ATM):c.7947A>G (p.Ala2649=) rs1060504301
NM_000051.3(ATM):c.7949A>C (p.Asp2650Ala) rs1060501635
NM_000051.3(ATM):c.7950C>T (p.Asp2650=) rs1060504298
NM_000051.3(ATM):c.7955C>T (p.Pro2652Leu) rs1565538433
NM_000051.3(ATM):c.7957A>G (p.Ile2653Val) rs747448699
NM_000051.3(ATM):c.7967T>G (p.Leu2656Arg) rs121434218
NM_000051.3(ATM):c.7969A>G (p.Lys2657Glu) rs755706903
NM_000051.3(ATM):c.7974T>C (p.Asn2658=) rs777548685
NM_000051.3(ATM):c.7978del (p.Glu2660fs)
NM_000051.3(ATM):c.7980A>T (p.Glu2660Asp) rs1555126247
NM_000051.3(ATM):c.7983T>C (p.Asp2661=) rs143972422
NM_000051.3(ATM):c.7983_7985TGT[2] (p.Val2664del) rs876660743
NM_000051.3(ATM):c.7984G>A (p.Val2662Ile) rs1315805984
NM_000051.3(ATM):c.7985T>A (p.Val2662Asp) rs863224463
NM_000051.3(ATM):c.7988T>C (p.Val2663Ala) rs377648506
NM_000051.3(ATM):c.7991_8010+8dup rs1555126295
NM_000051.3(ATM):c.7993C>G (p.Pro2665Ala) rs1555126304
NM_000051.3(ATM):c.7994C>A (p.Pro2665His)
NM_000051.3(ATM):c.7994C>T (p.Pro2665Leu)
NM_000051.3(ATM):c.7996A>C (p.Thr2666Pro) rs745775382
NM_000051.3(ATM):c.7996A>G (p.Thr2666Ala) rs745775382
NM_000051.3(ATM):c.7997C>A (p.Thr2666Asn) rs730881384
NM_000051.3(ATM):c.7998dup (p.Met2667fs) rs587779869
NM_000051.3(ATM):c.7999A>G (p.Met2667Val) rs34099398
NM_000051.3(ATM):c.7999A>T (p.Met2667Leu) rs34099398
NM_000051.3(ATM):c.8000T>C (p.Met2667Thr) rs1060501566
NM_000051.3(ATM):c.8001G>A (p.Met2667Ile)
NM_000051.3(ATM):c.8010+1delG rs876659350
NM_000051.3(ATM):c.8010+2T>C
NM_000051.3(ATM):c.8010+5T>A rs56256497
NM_000051.3(ATM):c.8010+5T>C rs56256497
NM_000051.3(ATM):c.8010+5T>G rs56256497
NM_000051.3(ATM):c.8011-10C>G rs1555127008
NM_000051.3(ATM):c.8011-1G>T rs1555127017
NM_000051.3(ATM):c.8011-2A>C
NM_000051.3(ATM):c.8011-6T>G rs762092284
NM_000051.3(ATM):c.8014G>T (p.Asp2672Tyr) rs1555127024
NM_000051.3(ATM):c.8015A>C (p.Asp2672Ala) rs763161651
NM_000051.3(ATM):c.8015A>G (p.Asp2672Gly)
NM_000051.3(ATM):c.8017C>T (p.His2673Tyr) rs1555127035
NM_000051.3(ATM):c.8026G>A (p.Glu2676Lys) rs786202859
NM_000051.3(ATM):c.8030A>G (p.Tyr2677Cys) rs28942103
NM_000051.3(ATM):c.8032G>A (p.Gly2678Arg) rs766730487
NM_000051.3(ATM):c.8036_8051del (p.Asn2679fs) rs587780640
NM_000051.3(ATM):c.8045C>G (p.Thr2682Ser)
NM_000051.3(ATM):c.8046_8047TA[1] (p.Ile2683fs) rs1565540673
NM_000051.3(ATM):c.8047A>G (p.Ile2683Val) rs587781344
NM_000051.3(ATM):c.8048T>C (p.Ile2683Thr) rs1555127096
NM_000051.3(ATM):c.8049A>G (p.Ile2683Met) rs1292192410
NM_000051.3(ATM):c.8056T>C (p.Phe2686Leu) rs1555127125
NM_000051.3(ATM):c.8066A>G (p.Glu2689Gly) rs759779781
NM_000051.3(ATM):c.8071C>T (p.Arg2691Cys) rs531980488
NM_000051.3(ATM):c.8072G>A (p.Arg2691His) rs876658385
NM_000051.3(ATM):c.8072G>C (p.Arg2691Pro) rs876658385
NM_000051.3(ATM):c.8073C>G (p.Arg2691=)
NM_000051.3(ATM):c.8079_8081AGG[1] (p.Gly2695del) rs1565540828
NM_000051.3(ATM):c.8080G>A (p.Gly2694Arg) rs1555127157
NM_000051.3(ATM):c.8082A>C (p.Gly2694=) rs540266635
NM_000051.3(ATM):c.8083G>A (p.Gly2695Ser) rs1555127166
NM_000051.3(ATM):c.8083G>T (p.Gly2695Cys) rs1555127166
NM_000051.3(ATM):c.8084G>A (p.Gly2695Asp) rs1060501680
NM_000051.3(ATM):c.8084G>C (p.Gly2695Ala)
NM_000051.3(ATM):c.8086G>A (p.Val2696Ile) rs989577687
NM_000051.3(ATM):c.8089A>G (p.Asn2697Asp) rs1555127177
NM_000051.3(ATM):c.8096C>G (p.Pro2699Arg) rs879254209
NM_000051.3(ATM):c.8100A>G (p.Lys2700=) rs778601472
NM_000051.3(ATM):c.8100A>T (p.Lys2700Asn) rs778601472
NM_000051.3(ATM):c.8105T>G (p.Ile2702Arg) rs876659735
NM_000051.3(ATM):c.8107G>A (p.Asp2703Asn) rs1555127236
NM_000051.3(ATM):c.8108A>T (p.Asp2703Val) rs1565541059
NM_000051.3(ATM):c.8109T>C (p.Asp2703=) rs201689025
NM_000051.3(ATM):c.8111G>A (p.Cys2704Tyr) rs1555127249
NM_000051.3(ATM):c.8113G>A (p.Val2705Ile) rs587779870
NM_000051.3(ATM):c.8113G>T (p.Val2705Leu) rs587779870
NM_000051.3(ATM):c.8119T>A (p.Ser2707Thr) rs1555127276
NM_000051.3(ATM):c.8120C>G (p.Ser2707Cys) rs748016261
NM_000051.3(ATM):c.8121C>T (p.Ser2707=) rs770138283
NM_000051.3(ATM):c.8122G>A (p.Asp2708Asn) rs587782719
NM_000051.3(ATM):c.8122G>C (p.Asp2708His) rs587782719
NM_000051.3(ATM):c.8125G>A (p.Gly2709Ser) rs3218680
NM_000051.3(ATM):c.8127del (p.Lys2710fs)
NM_000051.3(ATM):c.8129A>G (p.Lys2710Arg) rs587782001
NM_000051.3(ATM):c.8138G>A (p.Arg2713Lys) rs876659351
NM_000051.3(ATM):c.8138G>C (p.Arg2713Thr) rs876659351
NM_000051.3(ATM):c.8140C>A (p.Gln2714Lys) rs1060501695
NM_000051.3(ATM):c.8140C>G (p.Gln2714Glu) rs1060501695
NM_000051.3(ATM):c.8140C>T (p.Gln2714Ter) rs1060501695
NM_000051.3(ATM):c.8147T>C (p.Val2716Ala) rs587782652
NM_000051.3(ATM):c.8148_8151+2delTAAGGT rs1565541335
NM_000051.3(ATM):c.8149A>C (p.Lys2717Gln)
NM_000051.3(ATM):c.8151+4A>T rs1294982909
NM_000051.3(ATM):c.8151+8T>C rs768069197
NM_000051.3(ATM):c.8152-6C>T rs200389039
NM_000051.3(ATM):c.8152-9A>G rs1555128181
NM_000051.3(ATM):c.8152G>A (p.Gly2718Ser) rs1060501689
NM_000051.3(ATM):c.8154C>T (p.Gly2718=) rs371021126
NM_000051.3(ATM):c.8155C>T (p.Arg2719Cys) rs138526014
NM_000051.3(ATM):c.8156G>A (p.Arg2719His) rs55982963
NM_000051.3(ATM):c.8156G>T (p.Arg2719Leu) rs55982963
NM_000051.3(ATM):c.8158G>C (p.Asp2720His)
NM_000051.3(ATM):c.8161G>C (p.Asp2721His) rs876659066
NM_000051.3(ATM):c.8164C>T (p.Leu2722=) rs587782399
NM_000051.3(ATM):c.8164_8181del (p.Leu2722_Val2727del) rs1555128287
NM_000051.3(ATM):c.8168G>T (p.Arg2723Ile) rs1555128301
NM_000051.3(ATM):c.8171A>G (p.Gln2724Arg) rs1565543300
NM_000051.3(ATM):c.8173G>C (p.Asp2725His) rs587782049
NM_000051.3(ATM):c.8178T>C (p.Ala2726=) rs367575159
NM_000051.3(ATM):c.8180T>G (p.Val2727Gly)
NM_000051.3(ATM):c.8182A>T (p.Met2728Leu) rs1555128338
NM_000051.3(ATM):c.8185C>T (p.Gln2729Ter) rs587781967
NM_000051.3(ATM):c.8186A>C (p.Gln2729Pro) rs1555128350
NM_000051.3(ATM):c.8187A>C (p.Gln2729His) rs587781946
NM_000051.3(ATM):c.8187A>G (p.Gln2729=) rs587781946
NM_000051.3(ATM):c.8187A>T (p.Gln2729His) rs587781946
NM_000051.3(ATM):c.8189A>C (p.Gln2730Pro)
NM_000051.3(ATM):c.8189A>G (p.Gln2730Arg)
NM_000051.3(ATM):c.8193C>A (p.Val2731=) rs1060504307
NM_000051.3(ATM):c.8194T>C (p.Phe2732Leu) rs876659619
NM_000051.3(ATM):c.8194T>G (p.Phe2732Val) rs876659619
NM_000051.3(ATM):c.8198A>G (p.Gln2733Arg)
NM_000051.3(ATM):c.8199G>A (p.Gln2733=) rs770552705
NM_000051.3(ATM):c.8202_8203GT[3] (p.Asn2736fs) rs1555128432
NM_000051.3(ATM):c.8206A>T (p.Asn2736Tyr) rs1060501577
NM_000051.3(ATM):c.8207A>G (p.Asn2736Ser) rs1190456608
NM_000051.3(ATM):c.8215C>T (p.Leu2739=) rs1060504311
NM_000051.3(ATM):c.8218C>T (p.Gln2740Ter) rs866402530
NM_000051.3(ATM):c.8220G>A (p.Gln2740=) rs1060504313
NM_000051.3(ATM):c.8224_8225del (p.Asn2742fs) rs1162534390
NM_000051.3(ATM):c.8228C>T (p.Thr2743Met) rs730881321
NM_000051.3(ATM):c.8229G>A (p.Thr2743=) rs150603052
NM_000051.3(ATM):c.8231A>C (p.Glu2744Ala) rs764003317
NM_000051.3(ATM):c.8240A>G (p.Lys2747Arg) rs1038749014
NM_000051.3(ATM):c.8246A>G (p.Lys2749Arg) rs779145081
NM_000051.3(ATM):c.8246A>T (p.Lys2749Ile) rs779145081
NM_000051.3(ATM):c.8248T>C (p.Leu2750=) rs876658559
NM_000051.3(ATM):c.8248_8268del (p.Leu2750_Lys2756del) rs771146489
NM_000051.3(ATM):c.8249dup (p.Leu2750fs) rs1565543844
NM_000051.3(ATM):c.8256C>G (p.Ile2752Met) rs1555128574
NM_000051.3(ATM):c.8258G>T (p.Cys2753Phe) rs1284049490
NM_000051.3(ATM):c.8260A>G (p.Thr2754Ala) rs587781414
NM_000051.3(ATM):c.8261C>T (p.Thr2754Ile) rs587779871
NM_000051.3(ATM):c.8264_8268del (p.Tyr2755fs) rs730881294
NM_000051.3(ATM):c.8265T>C (p.Tyr2755=) rs758654836
NM_000051.3(ATM):c.8266A>T (p.Lys2756Ter) rs371638537
NM_000051.3(ATM):c.8268+5C>T rs1565544035
NM_000051.3(ATM):c.8268+6T>A rs747153940
NM_000051.3(ATM):c.8269-10_8269-9delGT rs587780641
NM_000051.3(ATM):c.8269G>A (p.Val2757Met) rs761625350
NM_000051.3(ATM):c.8269G>C (p.Val2757Leu) rs761625350
NM_000051.3(ATM):c.8275C>G (p.Pro2759Ala)
NM_000051.3(ATM):c.8275C>T (p.Pro2759Ser) rs764906663
NM_000051.3(ATM):c.8277C>T (p.Pro2759=) rs878853548
NM_000051.3(ATM):c.8278C>G (p.Leu2760Val) rs758609900
NM_000051.3(ATM):c.8279T>C (p.Leu2760Pro) rs1060501578
NM_000051.3(ATM):c.8279_8280TC[1] (p.Gln2762fs)
NM_000051.3(ATM):c.8287C>T (p.Arg2763Ter) rs876659872
NM_000051.3(ATM):c.8288G>A (p.Arg2763Gln) rs551411717
NM_000051.3(ATM):c.8291_8293GTG[1] (p.Gly2765del) rs1565557806
NM_000051.3(ATM):c.8292_8293del (p.Ser2764fs) rs879254036
NM_000051.3(ATM):c.8293G>A (p.Gly2765Ser) rs748634900
NM_000051.3(ATM):c.8296G>A (p.Val2766Ile) rs730881322
NM_000051.3(ATM):c.8300T>G (p.Leu2767Arg)
NM_000051.3(ATM):c.8301T>G (p.Leu2767=) rs1060504303
NM_000051.3(ATM):c.8305T>C (p.Trp2769Arg)
NM_000051.3(ATM):c.8305_8317del (p.Trp2769fs) rs786202318
NM_000051.3(ATM):c.8307G>A (p.Trp2769Ter) rs778269655
NM_000051.3(ATM):c.8311A>G (p.Thr2771Ala) rs876660587
NM_000051.3(ATM):c.8314G>A (p.Gly2772Arg) rs1064794239
NM_000051.3(ATM):c.8319_8323dup (p.Pro2775fs) rs1555135596
NM_000051.3(ATM):c.8321_8322delinsA (p.Val2774fs) rs1060501630
NM_000051.3(ATM):c.8322C>A (p.Val2774=) rs1060504267
NM_000051.3(ATM):c.8327T>C (p.Ile2776Thr) rs746475628
NM_000051.3(ATM):c.8353G>A (p.Asp2785Asn) rs587782417
NM_000051.3(ATM):c.8354A>G (p.Asp2785Gly)
NM_000051.3(ATM):c.8355T>C (p.Asp2785=) rs372834825
NM_000051.3(ATM):c.8360C>T (p.Ala2787Val) rs879253877
NM_000051.3(ATM):c.8366A>G (p.Lys2789Arg)
NM_000051.3(ATM):c.8367delinsTT (p.Lys2789fs) rs786202418
NM_000051.3(ATM):c.8371_8374del (p.Tyr2791fs) rs1064793046
NM_000051.3(ATM):c.8372A>G (p.Tyr2791Cys)
NM_000051.3(ATM):c.8373C>A (p.Tyr2791Ter) rs1060504292
NM_000051.3(ATM):c.8373C>G (p.Tyr2791Ter)
NM_000051.3(ATM):c.8373C>T (p.Tyr2791=) rs1060504292
NM_000051.3(ATM):c.8377C>T (p.Pro2793Ser) rs1174335574
NM_000051.3(ATM):c.8382T>A (p.Asn2794Lys) rs1555135797
NM_000051.3(ATM):c.8383G>A (p.Asp2795Asn)
NM_000051.3(ATM):c.8383G>T (p.Asp2795Tyr) rs1565558417
NM_000051.3(ATM):c.8385_8394TTTCAGTGCC[1] (p.Phe2799fs) rs786202800
NM_000051.3(ATM):c.8386T>C (p.Phe2796Leu)
NM_000051.3(ATM):c.8390G>A (p.Ser2797Asn) rs1203037698
NM_000051.3(ATM):c.8391T>C (p.Ser2797=) rs566485657
NM_000051.3(ATM):c.8392G>T (p.Ala2798Ser)
NM_000051.3(ATM):c.8393C>A (p.Ala2798Asp) rs772992098
NM_000051.3(ATM):c.8397del (p.Gln2800fs) rs587781837
NM_000051.3(ATM):c.8400G>C (p.Gln2800His) rs879253901
NM_000051.3(ATM):c.8403C>A (p.Cys2801Ter) rs1555135852
NM_000051.3(ATM):c.8405A>G (p.Gln2802Arg) rs730881324
NM_000051.3(ATM):c.8410A>C (p.Lys2804Gln) rs878853549
NM_000051.3(ATM):c.8416_8418+5del
NM_000051.3(ATM):c.8417T>C (p.Met2806Thr) rs1234463032
NM_000051.3(ATM):c.8418+1G>A rs766533795
NM_000051.3(ATM):c.8418+2T>C rs1060501713
NM_000051.3(ATM):c.8418+5G>T rs1305740166
NM_000051.3(ATM):c.8418+5_8418+8delGTGA rs730881295
NM_000051.3(ATM):c.8418G>A (p.Met2806Ile) rs762744146
NM_000051.3(ATM):c.8419-2A>G rs1555137917
NM_000051.3(ATM):c.8419-7_8419-4delTTTA rs730881306
NM_000051.3(ATM):c.8419-8A>G rs567215034
NM_000051.3(ATM):c.8419G>A (p.Glu2807Lys) rs1555137929
NM_000051.3(ATM):c.8419G>T (p.Glu2807Ter) rs1555137929
NM_000051.3(ATM):c.8422G>A (p.Val2808Met) rs876660616
NM_000051.3(ATM):c.8425C>G (p.Gln2809Glu) rs1555137973
NM_000051.3(ATM):c.8425C>T (p.Gln2809Ter) rs1555137973
NM_000051.3(ATM):c.8427A>G (p.Gln2809=) rs538173062
NM_000051.3(ATM):c.8428A>C (p.Lys2810Gln) rs730881325
NM_000051.3(ATM):c.8428A>G (p.Lys2810Glu) rs730881325
NM_000051.3(ATM):c.8429A>C (p.Lys2810Thr) rs1555137999
NM_000051.3(ATM):c.8432del (p.Lys2811fs) rs587782558
NM_000051.3(ATM):c.8434T>C (p.Ser2812Pro) rs786202372
NM_000051.3(ATM):c.8434T>G (p.Ser2812Ala) rs786202372
NM_000051.3(ATM):c.8435_8436del (p.Ser2812fs) rs767533596
NM_000051.3(ATM):c.8435_8437del (p.Ser2812del)
NM_000051.3(ATM):c.8437T>C (p.Phe2813Leu) rs1280239284
NM_000051.3(ATM):c.8438T>C (p.Phe2813Ser) rs1555138027
NM_000051.3(ATM):c.8440del (p.Glu2814fs) rs752526400
NM_000051.3(ATM):c.8443G>A (p.Glu2815Lys)
NM_000051.3(ATM):c.8450A>G (p.Tyr2817Cys) rs747764678
NM_000051.3(ATM):c.8456T>G (p.Val2819Gly) rs1565563392
NM_000051.3(ATM):c.8461A>G (p.Met2821Val) rs876660081
NM_000051.3(ATM):c.8469T>C (p.Val2823=) rs1555138081
NM_000051.3(ATM):c.8471G>A (p.Cys2824Tyr) rs876660927
NM_000051.3(ATM):c.8471G>C (p.Cys2824Ser)
NM_000051.3(ATM):c.8473C>T (p.Gln2825Ter) rs587781363
NM_000051.3(ATM):c.8479T>A (p.Phe2827Ile) rs370152402
NM_000051.3(ATM):c.8480T>G (p.Phe2827Cys) rs121434216
NM_000051.3(ATM):c.8481T>G (p.Phe2827Leu) rs886047614
NM_000051.3(ATM):c.8482C>G (p.Gln2828Glu) rs1555138125
NM_000051.3(ATM):c.8486C>T (p.Pro2829Leu) rs938431501
NM_000051.3(ATM):c.8492T>C (p.Phe2831Ser)
NM_000051.3(ATM):c.8494C>T (p.Arg2832Cys) rs587779872
NM_000051.3(ATM):c.8495G>A (p.Arg2832His) rs529296539
NM_000051.3(ATM):c.8495G>T (p.Arg2832Leu) rs529296539
NM_000051.3(ATM):c.8505C>A (p.Cys2835Ter) rs587781597
NM_000051.3(ATM):c.8506A>G (p.Met2836Val) rs879253968
NM_000051.3(ATM):c.8515T>A (p.Phe2839Ile) rs876658958
NM_000051.3(ATM):c.8519T>C (p.Leu2840Ser)
NM_000051.3(ATM):c.8520G>C (p.Leu2840Phe) rs752652869
NM_000051.3(ATM):c.8524C>T (p.Pro2842Ser) rs876659505
NM_000051.3(ATM):c.8528C>T (p.Ala2843Val) rs1060501637
NM_000051.3(ATM):c.8530A>G (p.Ile2844Val) rs756230327
NM_000051.3(ATM):c.8530_8532dup (p.Ile2844dup) rs1555138275
NM_000051.3(ATM):c.8532T>C (p.Ile2844=) rs730881278
NM_000051.3(ATM):c.8542A>G (p.Lys2848Glu) rs1565563932
NM_000051.3(ATM):c.8545C>T (p.Arg2849Ter) rs587778080
NM_000051.3(ATM):c.8546G>A (p.Arg2849Gln) rs587782202
NM_000051.3(ATM):c.8546G>C (p.Arg2849Pro) rs587782202
NM_000051.3(ATM):c.8548T>C (p.Leu2850=) rs1555138320
NM_000051.3(ATM):c.8549T>A (p.Leu2850Ter) rs876658716
NM_000051.3(ATM):c.8549T>C (p.Leu2850Ser) rs876658716
NM_000051.3(ATM):c.8556T>C (p.Tyr2852=) rs779394254
NM_000051.3(ATM):c.8558C>G (p.Thr2853Arg) rs141534716
NM_000051.3(ATM):c.8558C>T (p.Thr2853Met) rs141534716
NM_000051.3(ATM):c.8559G>A (p.Thr2853=) rs368058202
NM_000051.3(ATM):c.8560C>T (p.Arg2854Cys) rs201958469
NM_000051.3(ATM):c.8561G>A (p.Arg2854His) rs1060501605
NM_000051.3(ATM):c.8561G>T (p.Arg2854Leu) rs1060501605
NM_000051.3(ATM):c.8562C>T (p.Arg2854=) rs878853550
NM_000051.3(ATM):c.8565T>G (p.Ser2855Arg) rs780905851
NM_000051.3(ATM):c.8565_8566delinsAA (p.Ser2855_Val2856delinsArgIle) rs587781353
NM_000051.3(ATM):c.8567T>A (p.Val2856Glu) rs1060501649
NM_000051.3(ATM):c.8571T>C (p.Ala2857=) rs786203050
NM_000051.3(ATM):c.8572A>G (p.Thr2858Ala) rs749193688
NM_000051.3(ATM):c.8574T>C (p.Thr2858=) rs786203415
NM_000051.3(ATM):c.8576C>G (p.Ser2859Cys) rs786203542
NM_000051.3(ATM):c.8578_8580delTCT (p.SER1512DEL) rs786203976
NM_000051.3(ATM):c.8584+10T>C rs373321041
NM_000051.3(ATM):c.8584+1G>A rs876658182
NM_000051.3(ATM):c.8584+6C>G rs863224300
NM_000051.3(ATM):c.8584+7T>C rs1374271708
NM_000051.3(ATM):c.8584+7T>G rs1374271708
NM_000051.3(ATM):c.8585-2A>C rs1060501700
NM_000051.3(ATM):c.8585-4C>G rs1555139447
NM_000051.3(ATM):c.8592C>T (p.Tyr2864=) rs56025670
NM_000051.3(ATM):c.8593A>G (p.Ile2865Val) rs786202223
NM_000051.3(ATM):c.8594T>C (p.Ile2865Thr) rs587779873
NM_000051.3(ATM):c.8596C>G (p.Leu2866Val) rs368666328
NM_000051.3(ATM):c.8596C>T (p.Leu2866Phe) rs368666328
NM_000051.3(ATM):c.8597T>C (p.Leu2866Pro) rs1555139517
NM_000051.3(ATM):c.8602C>A (p.Leu2868Ile) rs587780642
NM_000051.3(ATM):c.8602C>G (p.Leu2868Val)
NM_000051.3(ATM):c.8605G>A (p.Gly2869Ser)
NM_000051.3(ATM):c.8606G>A (p.Gly2869Asp) rs1555139531
NM_000051.3(ATM):c.8606G>C (p.Gly2869Ala) rs1555139531
NM_000051.3(ATM):c.8608G>A (p.Asp2870Asn) rs55798854
NM_000051.3(ATM):c.8608_8650dup (p.Glu2884delinsGlyTer)
NM_000051.3(ATM):c.8609A>G (p.Asp2870Gly) rs1555139540
NM_000051.3(ATM):c.8610T>C (p.Asp2870=) rs1370524851
NM_000051.3(ATM):c.8615A>G (p.His2872Arg)
NM_000051.3(ATM):c.8616T>G (p.His2872Gln) rs1555139556
NM_000051.3(ATM):c.8617G>A (p.Val2873Ile) rs730881327
NM_000051.3(ATM):c.8618T>C (p.Val2873Ala)
NM_000051.3(ATM):c.8624A>C (p.Asn2875Thr) rs587782451
NM_000051.3(ATM):c.8624A>G (p.Asn2875Ser) rs587782451
NM_000051.3(ATM):c.8625_8627delinsAAAA (p.Asn2875fs) rs1565567205
NM_000051.3(ATM):c.8629T>C (p.Leu2877=) rs730881279
NM_000051.3(ATM):c.8636A>G (p.Asn2879Ser) rs1565567277
NM_000051.3(ATM):c.8643G>T (p.Gln2881His)
NM_000051.3(ATM):c.8653C>T (p.Leu2885Phe) rs775185939
NM_000051.3(ATM):c.8655dup (p.Val2886fs) rs753961188
NM_000051.3(ATM):c.8656G>A (p.Val2886Ile) rs1064795066
NM_000051.3(ATM):c.8659C>G (p.His2887Asp)
NM_000051.3(ATM):c.8660A>C (p.His2887Pro) rs864622173
NM_000051.3(ATM):c.8663T>C (p.Ile2888Thr) rs760955058
NM_000051.3(ATM):c.8665G>C (p.Asp2889His) rs587781814
NM_000051.3(ATM):c.8667T>G (p.Asp2889Glu) rs1565567506
NM_000051.3(ATM):c.8668C>G (p.Leu2890Val) rs587779874
NM_000051.3(ATM):c.8671+1G>T rs1555139694
NM_000051.3(ATM):c.8671+2dup rs1555139698
NM_000051.3(ATM):c.8671+9T>C rs200190537
NM_000051.3(ATM):c.8671+9T>G rs200190537
NM_000051.3(ATM):c.8671G>A (p.Gly2891Ser) rs1565567541
NM_000051.3(ATM):c.8672-3T>C rs1060501550
NM_000051.3(ATM):c.8672-3T>G
NM_000051.3(ATM):c.8672G>A (p.Gly2891Asp) rs748192003
NM_000051.3(ATM):c.8672G>T (p.Gly2891Val) rs748192003
NM_000051.3(ATM):c.8675T>C (p.Val2892Ala)
NM_000051.3(ATM):c.8677G>A (p.Ala2893Thr) rs1555142808
NM_000051.3(ATM):c.8686_8694del (p.Gln2896_Lys2898del) rs1060501671
NM_000051.3(ATM):c.8697C>G (p.Ile2899Met) rs1333079704
NM_000051.3(ATM):c.8710G>C (p.Glu2904Gln)
NM_000051.3(ATM):c.8711A>G (p.Glu2904Gly) rs786202826
NM_000051.3(ATM):c.8716G>A (p.Val2906Ile) rs587780643
NM_000051.3(ATM):c.8717T>C (p.Val2906Ala) rs730881328
NM_000051.3(ATM):c.8720C>A (p.Pro2907His) rs56887719
NM_000051.3(ATM):c.8720C>G (p.Pro2907Arg) rs56887719
NM_000051.3(ATM):c.8725A>T (p.Arg2909Ter) rs1555142845
NM_000051.3(ATM):c.8730C>A (p.Leu2910=) rs551041839
NM_000051.3(ATM):c.8730C>G (p.Leu2910=) rs551041839
NM_000051.3(ATM):c.8731A>C (p.Thr2911Pro) rs786203271
NM_000051.3(ATM):c.8732C>T (p.Thr2911Ile) rs794728018
NM_000051.3(ATM):c.8734A>G (p.Arg2912Gly) rs376676328
NM_000051.3(ATM):c.8737G>C (p.Asp2913His) rs756899044
NM_000051.3(ATM):c.8737G>T (p.Asp2913Tyr) rs756899044
NM_000051.3(ATM):c.8739T>G (p.Asp2913Glu) rs764778912
NM_000051.3(ATM):c.8741T>C (p.Ile2914Thr) rs780303327
NM_000051.3(ATM):c.8751C>T (p.Gly2917=) rs779858366
NM_000051.3(ATM):c.8752A>T (p.Met2918Leu) rs1555142873
NM_000051.3(ATM):c.8757C>T (p.Gly2919=) rs987508358
NM_000051.3(ATM):c.8759T>C (p.Ile2920Thr) rs1565579485
NM_000051.3(ATM):c.8762C>A (p.Thr2921Lys) rs730881329
NM_000051.3(ATM):c.8762C>T (p.Thr2921Met) rs730881329
NM_000051.3(ATM):c.8763G>A (p.Thr2921=) rs781528244
NM_000051.3(ATM):c.8773G>A (p.Gly2925Ser) rs876658519
NM_000051.3(ATM):c.8773G>C (p.Gly2925Arg)
NM_000051.3(ATM):c.8774G>A (p.Gly2925Asp)
NM_000051.3(ATM):c.8774G>C (p.Gly2925Ala)
NM_000051.3(ATM):c.8781_8786+2delCAGAAGGT
NM_000051.3(ATM):c.8783G>A (p.Arg2928Lys) rs1555142909
NM_000051.3(ATM):c.8785A>C (p.Arg2929=) rs1013290424
NM_000051.3(ATM):c.8786+1G>A rs17174393
NM_000051.3(ATM):c.8786+1G>C rs17174393
NM_000051.3(ATM):c.8786+1G>T rs17174393
NM_000051.3(ATM):c.8786+2T>A rs1555142918
NM_000051.3(ATM):c.8786+7G>A rs1555142923
NM_000051.3(ATM):c.8786+8A>C rs4986839
NM_000051.3(ATM):c.8786+8A>G rs4986839
NM_000051.3(ATM):c.8786+9T>C rs1060504271
NM_000051.3(ATM):c.8786_8786+3delGGTA rs1060501569
NM_000051.3(ATM):c.8787-4C>G rs944858078
NM_000051.3(ATM):c.8787-5T>C rs1479499265
NM_000051.3(ATM):c.8788T>G (p.Cys2930Gly) rs876659807
NM_000051.3(ATM):c.8789G>T (p.Cys2930Phe) rs1060501572
NM_000051.3(ATM):c.8792G>A (p.Cys2931Tyr)
NM_000051.3(ATM):c.8792G>C (p.Cys2931Ser) rs1060501563
NM_000051.3(ATM):c.8793T>A (p.Cys2931Ter) rs1555143494
NM_000051.3(ATM):c.8797A>G (p.Lys2933Glu) rs587779875
NM_000051.3(ATM):c.8800A>G (p.Thr2934Ala) rs746351323
NM_000051.3(ATM):c.8801C>A (p.Thr2934Asn)
NM_000051.3(ATM):c.8805G>A (p.Met2935Ile) rs772621438
NM_000051.3(ATM):c.8806G>C (p.Glu2936Gln) rs1060501537
NM_000051.3(ATM):c.8810T>A (p.Val2937Glu) rs587782149
NM_000051.3(ATM):c.8810T>C (p.Val2937Ala) rs587782149
NM_000051.3(ATM):c.8814_8824del (p.Met2938fs) rs758814126
NM_000051.3(ATM):c.8818_8821dup (p.Ser2941Ter) rs876658959
NM_000051.3(ATM):c.8821T>G (p.Ser2941Ala) rs1555143549
NM_000051.3(ATM):c.8823T>C (p.Ser2941=) rs1060504288
NM_000051.3(ATM):c.8824C>T (p.Gln2942Ter)
NM_000051.3(ATM):c.8831C>T (p.Thr2944Ile) rs1555143562
NM_000051.3(ATM):c.8831_8832CT[1] (p.Leu2945fs) rs786203030
NM_000051.3(ATM):c.8833C>G (p.Leu2945Val) rs786203505
NM_000051.3(ATM):c.8835_8836del (p.Leu2946fs) rs786202547
NM_000051.3(ATM):c.8840C>A (p.Thr2947Asn) rs1555143579
NM_000051.3(ATM):c.8842A>G (p.Ile2948Val)
NM_000051.3(ATM):c.8843T>C (p.Ile2948Thr) rs876659516
NM_000051.3(ATM):c.8844T>C (p.Ile2948=) rs878853551
NM_000051.3(ATM):c.8845G>A (p.Val2949Ile) rs587782497
NM_000051.3(ATM):c.8848G>A (p.Glu2950Lys) rs898091069
NM_000051.3(ATM):c.8850+10T>C rs762487236
NM_000051.3(ATM):c.8850+4A>C rs587782335
NM_000051.3(ATM):c.8850+4A>G rs587782335
NM_000051.3(ATM):c.8850+5A>T
NM_000051.3(ATM):c.8851-10C>T rs1057521676
NM_000051.3(ATM):c.8851-10_8851-7delCTCT
NM_000051.3(ATM):c.8851-3T>G rs748874219
NM_000051.3(ATM):c.8851-?_*3591dup3912
NM_000051.3(ATM):c.8851G>A (p.Val2951Ile) rs1555151205
NM_000051.3(ATM):c.8853C>G (p.Val2951=) rs878853552
NM_000051.3(ATM):c.8854C>G (p.Leu2952Val) rs1555151218
NM_000051.3(ATM):c.8855T>C (p.Leu2952Pro)
NM_000051.3(ATM):c.8859A>G (p.Leu2953=) rs773994431
NM_000051.3(ATM):c.8860T>C (p.Tyr2954His) rs371619067
NM_000051.3(ATM):c.8861A>G (p.Tyr2954Cys) rs767507047
NM_000051.3(ATM):c.8863_8865del (p.Asp2955del) rs587780644
NM_000051.3(ATM):c.8867C>T (p.Pro2956Leu) rs1555151244
NM_000051.3(ATM):c.8870T>G (p.Leu2957Arg) rs1555151255
NM_000051.3(ATM):c.8873_8874del (p.Leu2957_Phe2958insTer) rs864622669
NM_000051.3(ATM):c.8876_8879del (p.Asp2959fs) rs786204726
NM_000051.3(ATM):c.8879G>A (p.Trp2960Ter) rs1131691149
NM_000051.3(ATM):c.8880G>A (p.Trp2960Ter) rs1060501650
NM_000051.3(ATM):c.8881A>G (p.Thr2961Ala) rs1565607505
NM_000051.3(ATM):c.8882C>T (p.Thr2961Ile)
NM_000051.3(ATM):c.8893T>C (p.Leu2965=) rs1060504287
NM_000051.3(ATM):c.8894T>G (p.Leu2965Trp) rs1555151299
NM_000051.3(ATM):c.8895G>C (p.Leu2965Phe) rs200899512
NM_000051.3(ATM):c.8895G>T (p.Leu2965Phe) rs200899512
NM_000051.3(ATM):c.8902T>C (p.Leu2968=) rs775313366
NM_000051.3(ATM):c.8903T>A (p.Leu2968Ter) rs1555151315
NM_000051.3(ATM):c.8906A>G (p.Tyr2969Cys) rs376524155
NM_000051.3(ATM):c.8911C>T (p.Gln2971Ter) rs1565607653
NM_000051.3(ATM):c.8912A>G (p.Gln2971Arg) rs1060501714
NM_000051.3(ATM):c.8915A>G (p.Gln2972Arg) rs763773991
NM_000051.3(ATM):c.8918G>T (p.Arg2973Met) rs730881331
NM_000051.3(ATM):c.8918_8929delinsTGT (p.Arg2973_Glu2977delinsMetTer) rs1064795675
NM_000051.3(ATM):c.8919G>A (p.Arg2973=) rs786203613
NM_000051.3(ATM):c.8920C>T (p.Pro2974Ser) rs984616023
NM_000051.3(ATM):c.8921C>T (p.Pro2974Leu) rs139379666
NM_000051.3(ATM):c.8922G>A (p.Pro2974=) rs527248759
NM_000051.3(ATM):c.8937G>A (p.Glu2979=) rs876658242
NM_000051.3(ATM):c.8938C>A (p.Leu2980Ile) rs786203721
NM_000051.3(ATM):c.8941C>T (p.His2981Tyr) rs1555151422
NM_000051.3(ATM):c.8942A>G (p.His2981Arg) rs750441954
NM_000051.3(ATM):c.8942del (p.His2981fs) rs786203489
NM_000051.3(ATM):c.8944C>T (p.Pro2982Ser) rs1485620194
NM_000051.3(ATM):c.8950C>A (p.Leu2984Met) rs747445236
NM_000051.3(ATM):c.8955T>C (p.Asn2985=) rs755561691
NM_000051.3(ATM):c.8955T>G (p.Asn2985Lys) rs755561691
NM_000051.3(ATM):c.8958A>C (p.Ala2986=) rs863224567
NM_000051.3(ATM):c.8959G>C (p.Asp2987His) rs863224582
NM_000051.3(ATM):c.8959G>T (p.Asp2987Tyr) rs863224582
NM_000051.3(ATM):c.8964C>T (p.Asp2988=) rs969795398
NM_000051.3(ATM):c.8965C>G (p.Gln2989Glu) rs147695170
NM_000051.3(ATM):c.8966A>G (p.Gln2989Arg) rs1555151490
NM_000051.3(ATM):c.8968G>A (p.Glu2990Lys) rs1800558
NM_000051.3(ATM):c.8972G>A (p.Cys2991Tyr)
NM_000051.3(ATM):c.8977C>T (p.Arg2993Ter) rs770641163
NM_000051.3(ATM):c.8978G>A (p.Arg2993Gln) rs587778081
NM_000051.3(ATM):c.8979A>G (p.Arg2993=) rs1042288533
NM_000051.3(ATM):c.8983C>A (p.Leu2995Ile) rs142322668
NM_000051.3(ATM):c.8987+10A>G rs1060504308
NM_000051.3(ATM):c.8987+3G>A rs56360226
NM_000051.3(ATM):c.8987G>A (p.Ser2996Asn) rs1555151525
NM_000051.3(ATM):c.8988-1G>A rs730881386
NM_000051.3(ATM):c.8988-1G>C rs730881386
NM_000051.3(ATM):c.8988-1G>T
NM_000051.3(ATM):c.8988-2A>G rs786202087
NM_000051.3(ATM):c.8988-3T>C rs1565608600
NM_000051.3(ATM):c.8988-6_8988-4delCCT rs767175242
NM_000051.3(ATM):c.8988-7T>G rs1487809821
NM_000051.3(ATM):c.8988-8dup
NM_000051.3(ATM):c.8993T>C (p.Ile2998Thr) rs778670498
NM_000051.3(ATM):c.8996A>T (p.Asp2999Val) rs1555151684
NM_000051.3(ATM):c.8998C>G (p.Gln3000Glu) rs587781698
NM_000051.3(ATM):c.8999_9000AG[1] (p.Ser3001fs) rs876660022
NM_000051.3(ATM):c.9002G>A (p.Ser3001Asn) rs587781413
NM_000051.3(ATM):c.9002G>C (p.Ser3001Thr) rs587781413
NM_000051.3(ATM):c.9005T>A (p.Phe3002Tyr) rs1565608780
NM_000051.3(ATM):c.9006C>A (p.Phe3002Leu) rs540172506
NM_000051.3(ATM):c.9006C>T (p.Phe3002=) rs540172506
NM_000051.3(ATM):c.9008A>G (p.Asn3003Ser) rs144636562
NM_000051.3(ATM):c.9016G>A (p.Ala3006Thr) rs876658767
NM_000051.3(ATM):c.9019G>T (p.Glu3007Ter) rs876660382
NM_000051.3(ATM):c.9021A>C (p.Glu3007Asp) rs1565608897
NM_000051.3(ATM):c.9021dup (p.Arg3008fs) rs876660235
NM_000051.3(ATM):c.9022C>T (p.Arg3008Cys) rs587782292
NM_000051.3(ATM):c.9023G>A (p.Arg3008His) rs587781894
NM_000051.3(ATM):c.9023G>C (p.Arg3008Pro)
NM_000051.3(ATM):c.9024T>C (p.Arg3008=) rs876658179
NM_000051.3(ATM):c.9026T>G (p.Val3009Gly) rs1565608934
NM_000051.3(ATM):c.9031A>G (p.Met3011Val) rs372795527
NM_000051.3(ATM):c.9037_9040del (p.Leu3013fs) rs1565609008
NM_000051.3(ATM):c.9041A>G (p.Gln3014Arg) rs1064793579
NM_000051.3(ATM):c.9042A>G (p.Gln3014=) rs1060504291
NM_000051.3(ATM):c.9042A>T (p.Gln3014His)
NM_000051.3(ATM):c.9043G>A (p.Glu3015Lys)
NM_000051.3(ATM):c.9044A>G (p.Glu3015Gly) rs1565609065
NM_000051.3(ATM):c.9045G>A (p.Glu3015=) rs786203336
NM_000051.3(ATM):c.9048A>G (p.Lys3016=) rs553001467
NM_000051.3(ATM):c.9049C>T (p.Leu3017=) rs876658991
NM_000051.3(ATM):c.9050T>C (p.Leu3017Pro) rs786204218
NM_000051.3(ATM):c.9050_9051insTTCA (p.Lys3018fs) rs1555151854
NM_000051.3(ATM):c.9060G>T (p.Val3020=) rs864622625
NM_000051.3(ATM):c.9063A>G (p.Glu3021=) rs1555151874
NM_000051.3(ATM):c.9068G>A (p.Gly3023Asp) rs769548726
NM_000051.3(ATM):c.9068G>T (p.Gly3023Val) rs769548726
NM_000051.3(ATM):c.9070A>C (p.Thr3024Pro) rs587781630
NM_000051.3(ATM):c.9072T>G (p.Thr3024=) rs1308894113
NM_000051.3(ATM):c.9073G>A (p.Val3025Met) rs1555151925
NM_000051.3(ATM):c.9073del (p.Val3025fs) rs1555151928
NM_000051.3(ATM):c.9079A>C (p.Ser3027Arg) rs763152094
NM_000051.3(ATM):c.9079dup (p.Ser3027fs) rs587780645
NM_000051.3(ATM):c.9080G>C (p.Ser3027Thr) rs1565609342
NM_000051.3(ATM):c.9084_9086TGG[1] (p.Gly3030del)
NM_000051.3(ATM):c.9086G>A (p.Gly3029Asp) rs201199629
NM_000051.3(ATM):c.9086G>T (p.Gly3029Val) rs201199629
NM_000051.3(ATM):c.9088G>A (p.Gly3030Arg) rs879254215
NM_000051.3(ATM):c.9088G>C (p.Gly3030Arg) rs879254215
NM_000051.3(ATM):c.9089G>A (p.Gly3030Glu) rs876658529
NM_000051.3(ATM):c.9089G>T (p.Gly3030Val)
NM_000051.3(ATM):c.9092_9098delinsT (p.Gln3031_Asn3033delinsLeu) rs1555151979
NM_000051.3(ATM):c.9094G>A (p.Val3032Met) rs587779877
NM_000051.3(ATM):c.9094G>C (p.Val3032Leu) rs587779877
NM_000051.3(ATM):c.9101T>G (p.Leu3034Trp) rs1555151992
NM_000051.3(ATM):c.9111G>T (p.Gln3037His) rs1555152012
NM_000051.3(ATM):c.9113A>T (p.Gln3038Leu) rs1131691391
NM_000051.3(ATM):c.9119T>C (p.Ile3040Thr) rs369870357
NM_000051.3(ATM):c.9128A>G (p.Lys3043Arg) rs867893961
NM_000051.3(ATM):c.9131dup (p.Asn3044fs)
NM_000051.3(ATM):c.9133C>G (p.Leu3045Val) rs1555152033
NM_000051.3(ATM):c.9139C>T (p.Arg3047Ter) rs121434219
NM_000051.3(ATM):c.9142C>G (p.Leu3048Val) rs876660534
NM_000051.3(ATM):c.9145_9146del (p.Phe3049fs) rs1555152058
NM_000051.3(ATM):c.9149C>T (p.Pro3050Leu) rs778267979
NM_000051.3(ATM):c.9152G>A (p.Gly3051Glu)
NM_000051.3(ATM):c.9152G>C (p.Gly3051Ala) rs1555152073
NM_000051.3(ATM):c.9159A>G (p.Lys3053=) rs1060504315
NM_000051.3(ATM):c.9160G>A (p.Ala3054Thr) rs1565609869
NM_000051.3(ATM):c.9161C>G (p.Ala3054Gly) rs1555152117
NM_000051.3(ATM):c.9166G>T (p.Val3056Leu) rs371767164
NM_001351834.2(ATM):c.5763-1050A>G rs774925473

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.