ClinVar Miner

List of variants in gene combination ATM, C11orf65 reported as likely pathogenic by Invitae

Minimum submission review status: Collection method:
Minimum conflict level:
Gene type:
ClinVar version:
Total variants: 64
Download table as spreadsheet
HGVS dbSNP
NC_000011.9:g.(?_108114670)_(108225611_?)dup
NC_000011.9:g.(?_108114674)_(108225607_?)dup
NC_000011.9:g.(?_108137888)_(108225611_?)dup
NC_000011.9:g.(?_108198362)_(108202294_?)del
NC_000011.9:g.(?_108198372)_(108202284_?)del
NC_000011.9:g.(?_108205686)_(108225611_?)del
NC_000011.9:g.(?_108205690)_(108225607_?)del
NM_000051.3(ATM):c.2467-?_8850+?dup6384
NM_000051.3(ATM):c.5129_5763-1060del
NM_000051.3(ATM):c.5918+1G>A
NM_000051.3(ATM):c.6006+1G>C rs786202016
NM_000051.3(ATM):c.6095+1G>A rs587781584
NM_000051.3(ATM):c.6096-1G>C
NM_000051.3(ATM):c.6115G>A (p.Glu2039Lys) rs864622251
NM_000051.3(ATM):c.6198+2T>C rs1555113882
NM_000051.3(ATM):c.6199-2A>T rs1060501570
NM_000051.3(ATM):c.6199-2delA rs1555114545
NM_000051.3(ATM):c.6348-1G>A rs1057517302
NM_000051.3(ATM):c.6348-2A>G rs864622367
NM_000051.3(ATM):c.6453-1G>A
NM_000051.3(ATM):c.6453-1G>C rs1555117071
NM_000051.3(ATM):c.6573-2A>G rs751168951
NM_000051.3(ATM):c.6573-9G>A
NM_000051.3(ATM):c.6975+1G>T rs1565521129
NM_000051.3(ATM):c.6976-10_6989delTCTTATACAGAACAATCCCAGCCT rs587779859
NM_000051.3(ATM):c.6976-1G>A
NM_000051.3(ATM):c.6976-1G>T
NM_000051.3(ATM):c.6976-2A>C rs587782403
NM_000051.3(ATM):c.7181C>T (p.Ser2394Leu) rs587779861
NM_000051.3(ATM):c.7308-2A>C rs1555122938
NM_000051.3(ATM):c.7570G>C (p.Ala2524Pro) rs769142993
NM_000051.3(ATM):c.7629+1G>A rs1565532703
NM_000051.3(ATM):c.7629+2T>C rs786203059
NM_000051.3(ATM):c.7788+1G>T rs1565534524
NM_000051.3(ATM):c.7926A>C (p.Arg2642Ser) rs863224440
NM_000051.3(ATM):c.7927+1G>C rs1555125532
NM_000051.3(ATM):c.7928-1G>A rs1555126163
NM_000051.3(ATM):c.7928-2A>T rs864622610
NM_000051.3(ATM):c.8010+1delG rs876659350
NM_000051.3(ATM):c.8010+2T>C
NM_000051.3(ATM):c.8011-1G>T rs1555127017
NM_000051.3(ATM):c.8011-2A>C
NM_000051.3(ATM):c.8148_8151+2delTAAGGT rs1565541335
NM_000051.3(ATM):c.8189A>C (p.Gln2730Pro)
NM_000051.3(ATM):c.8293G>A (p.Gly2765Ser) rs748634900
NM_000051.3(ATM):c.8416_8418+5del
NM_000051.3(ATM):c.8418+1G>A rs766533795
NM_000051.3(ATM):c.8418+2T>C rs1060501713
NM_000051.3(ATM):c.8419-2A>G rs1555137917
NM_000051.3(ATM):c.8480T>G (p.Phe2827Cys) rs121434216
NM_000051.3(ATM):c.8546G>C (p.Arg2849Pro) rs587782202
NM_000051.3(ATM):c.8565_8566delinsAA (p.Ser2855_Val2856delinsArgIle) rs587781353
NM_000051.3(ATM):c.8584+1G>A rs876658182
NM_000051.3(ATM):c.8585-2A>C rs1060501700
NM_000051.3(ATM):c.8671+1G>T rs1555139694
NM_000051.3(ATM):c.8711A>G (p.Glu2904Gly) rs786202826
NM_000051.3(ATM):c.8737G>T (p.Asp2913Tyr) rs756899044
NM_000051.3(ATM):c.8786+2T>A rs1555142918
NM_000051.3(ATM):c.8988-1G>T
NM_000051.3(ATM):c.8988-2A>G rs786202087
NM_000051.3(ATM):c.9023G>A (p.Arg3008His) rs587781894
NM_000051.3(ATM):c.9050_9051insTTCA (p.Lys3018fs) rs1555151854
NM_000051.3(ATM):c.9079dup (p.Ser3027fs) rs587780645
NM_000051.3(ATM):c.9145_9146del (p.Phe3049fs) rs1555152058

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.